ID: 1097807468

View in Genome Browser
Species Human (GRCh38)
Location 12:63981764-63981786
Sequence GGGGAGTCCTGGGGGAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 282}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097807468_1097807476 13 Left 1097807468 12:63981764-63981786 CCTGTTTTCCCCCAGGACTCCCC 0: 1
1: 0
2: 1
3: 26
4: 282
Right 1097807476 12:63981800-63981822 TCTGAAGCCTGACCTTATTGAGG 0: 1
1: 0
2: 0
3: 6
4: 95
1097807468_1097807477 14 Left 1097807468 12:63981764-63981786 CCTGTTTTCCCCCAGGACTCCCC 0: 1
1: 0
2: 1
3: 26
4: 282
Right 1097807477 12:63981801-63981823 CTGAAGCCTGACCTTATTGAGGG 0: 1
1: 0
2: 0
3: 5
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097807468 Original CRISPR GGGGAGTCCTGGGGGAAAAC AGG (reversed) Intronic
900110632 1:1004048-1004070 GGGGAGACTGTGGGGAAAACCGG + Intergenic
900585479 1:3430540-3430562 GGGCAGTCCTGTGGGGAAGCTGG - Intronic
900742781 1:4340749-4340771 GGTGGGACCTGGGGGAAGACGGG + Intergenic
902632262 1:17711972-17711994 GGGAAGTCCTGAGGGAGAACTGG - Intergenic
903141429 1:21341544-21341566 GGGGAGGCCAGGGGAAGAACAGG - Intronic
903494459 1:23756034-23756056 CGGGAGAGCTGGGGGAGAACTGG + Intronic
905255693 1:36681787-36681809 GGGGACTCAGGGGGGAAAAGTGG - Intergenic
909475268 1:76074794-76074816 GGGCAGTCCTGGGGGCAGGCTGG - Exonic
910218201 1:84863648-84863670 TGAGAGTCCTGGGGGGAAACTGG - Intronic
911037493 1:93566205-93566227 TGAGAGACCTTGGGGAAAACTGG - Intronic
913250809 1:116910534-116910556 AGGGAGACCTGGGGGAAAGACGG - Intronic
913530190 1:119728515-119728537 GCAGAGACCTGGGGGAAGACAGG - Intronic
915004718 1:152625357-152625379 GGGAATTCCTGGTGGAAAGCTGG + Intergenic
915835822 1:159173577-159173599 AGGGAGTCCTTGGGGAGAGCAGG + Intronic
916192309 1:162191516-162191538 AAAGAGTCCTGGGGGAACACAGG - Intronic
918148024 1:181774938-181774960 GAGGAGTCCTGGGGCAGAGCAGG + Intronic
918756635 1:188345913-188345935 GGTGAGTCCTGGGGCTGAACTGG - Intergenic
918796669 1:188907216-188907238 GGCGGGTCGTGGGGGAGAACTGG - Intergenic
920790323 1:209083883-209083905 GTAGAGTCTTGGGGGAACACAGG + Intergenic
921058769 1:211564823-211564845 GGGGTGTCTTGAGGGCAAACAGG - Intergenic
921425611 1:214997958-214997980 AGAGAGTCCAGGGGGAAAAGGGG - Intergenic
921982403 1:221272926-221272948 GGGGAGTTCAAGGGGAAAAGAGG - Intergenic
923683889 1:236141414-236141436 GGGGAGTGCTCTGGGAAAAGAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924628503 1:245715431-245715453 GGGGAGTCCTGAGGGAAGGAAGG + Intergenic
1065434931 10:25696055-25696077 GCTGAGTTCTGGGGGAAAATAGG + Intergenic
1069626554 10:69871468-69871490 GGGGAGTCCTTGGGGAATGTGGG - Intronic
1071285630 10:84141555-84141577 GGGGAGGCCTTGGTGAAAGCTGG - Exonic
1071836512 10:89423678-89423700 CTGGAGTCCTGGGAGAAAAGGGG - Intergenic
1072503189 10:96039453-96039475 GGGGAATCCTGGAGGAAGAAGGG + Intergenic
1072762021 10:98064437-98064459 GGGGAGACTTCGTGGAAAACGGG - Intergenic
1073449288 10:103600211-103600233 GGGGAGTCCTTGGGGGAAGCCGG + Exonic
1074353314 10:112759043-112759065 GGGGAGGCCTGGGAGGGAACAGG - Intronic
1074401450 10:113144203-113144225 GAGGTGTCCTGTGGGAATACAGG + Intronic
1074801940 10:117008699-117008721 GGGGAGGTCTGGGAGAAAACAGG + Intronic
1075616796 10:123895769-123895791 GGGTAGTAATGGGGGCAAACTGG + Intronic
1076016973 10:127035473-127035495 AGGGAGTGCTGGAAGAAAACAGG - Intronic
1076333639 10:129690725-129690747 GGGAAGGCCTGGGGGAAAAGGGG + Intronic
1077284734 11:1760646-1760668 GGGGGGCCCTGGGGGGAACCAGG - Intronic
1077557295 11:3231793-3231815 GGGGAGTCATGGGGGCAGCCGGG - Intronic
1077914460 11:6602208-6602230 TTGGAGCCCTGGAGGAAAACAGG + Exonic
1078067754 11:8089366-8089388 GGGGAGTCCCTGGGGAAACAGGG + Intronic
1078302059 11:10141752-10141774 GGGGAGTCTTGTTGGAGAACTGG - Intronic
1078857210 11:15215885-15215907 GGGGAGTAAGGAGGGAAAACAGG + Intronic
1079503756 11:21131938-21131960 GGAGATTTCTGAGGGAAAACTGG + Intronic
1079982513 11:27166082-27166104 GGGGAGTCCTGTTAGAAAACAGG - Intergenic
1080214298 11:29823514-29823536 ATGGAGTCATGGGGGAAAAAAGG + Intergenic
1080218731 11:29875861-29875883 AGGGAGTTCTAGGGGAACACTGG - Intergenic
1080394502 11:31877304-31877326 CGGGACTTCTGGGGGTAAACTGG - Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1080953964 11:37071097-37071119 GGGGGGTCTTGGGGGAAGAAGGG - Intergenic
1081778004 11:45689645-45689667 GGGAACACCTGGGGTAAAACAGG + Intergenic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1083990865 11:66244960-66244982 GGTGGGTCCTGGGGAAAAACGGG - Intergenic
1084868682 11:72080885-72080907 GGTGAGTCGGGCGGGAAAACAGG + Exonic
1084878124 11:72149122-72149144 TGGGACTCCTTGGGGAAAACAGG + Intergenic
1088432219 11:109771093-109771115 GGCGACTCCGGGGGGAAAAGGGG + Intergenic
1089668621 11:120036124-120036146 GGCCAGCCCTGGGAGAAAACTGG + Intergenic
1089850926 11:121495722-121495744 GGGGATTCTTGGGGGATCACTGG + Intronic
1092173423 12:6387550-6387572 TGGGAGGCCTGGGGAGAAACTGG - Intronic
1093510819 12:19926020-19926042 GGGGAGAACTGGAGGAGAACAGG - Intergenic
1093616465 12:21231454-21231476 GAGGAGTCCTTGGGAAAAATAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095478968 12:42613939-42613961 GAGGAGGACTGGGGGAAGACAGG + Intergenic
1097019036 12:56007366-56007388 GGAGACTGCTGGGGGAAAATGGG - Intergenic
1097788610 12:63789266-63789288 GGGGAGAAATGGGGGAATACTGG + Intronic
1097807468 12:63981764-63981786 GGGGAGTCCTGGGGGAAAACAGG - Intronic
1098029510 12:66239688-66239710 GGGAGGCACTGGGGGAAAACAGG - Intronic
1098281055 12:68863283-68863305 GAGGAGTCCAGGGGAAAGACAGG + Intronic
1100229297 12:92591097-92591119 GGGAAGTCTTGAGGGAAAATGGG + Intergenic
1100539908 12:95548419-95548441 GGGGCGAGCTGGGGGAGAACGGG - Intronic
1103247882 12:119473608-119473630 GGGGACTCCTGGGGGAAGGGTGG - Intronic
1103271367 12:119676543-119676565 GTAGGGTCCTGGGGGAGAACTGG - Exonic
1104256823 12:127146523-127146545 GGGGCGTCCTGAGGGAGAACTGG + Intergenic
1105071256 12:133235666-133235688 GGGGGGTCCTGGAGGATAAGGGG - Exonic
1106101580 13:26698069-26698091 GGGTAGCCTTGGGGGAAAATGGG - Intergenic
1107910719 13:45103155-45103177 GAGCAGTCCTGGGGTCAAACTGG + Intergenic
1108432216 13:50365758-50365780 TGTGAGGCCTGGGGGAAATCAGG + Intronic
1109469546 13:62787785-62787807 TGGAACTCTTGGGGGAAAACAGG + Intergenic
1112466097 13:99646321-99646343 GGGGTGGCCTGGGGGAAGAAGGG + Intronic
1113451022 13:110409839-110409861 GGGGAGTCTTGGGGGAGTGCAGG + Intronic
1113544786 13:111139814-111139836 GGGCAGTCCTGGGAGAGCACTGG + Intronic
1114143214 14:19941568-19941590 GGAGAGCCCTGGAGTAAAACAGG + Intergenic
1118727105 14:68636815-68636837 GGGGAGTCCTCTGGCAAAGCAGG + Intronic
1119387295 14:74265650-74265672 GGGTAGGCCTAGGGGACAACTGG + Intergenic
1121201579 14:92122217-92122239 GGCGAGTCCTCGGGGGAGACCGG - Intronic
1121580320 14:95025188-95025210 GTGGAGACCTGGGAGTAAACAGG + Intergenic
1121585535 14:95060646-95060668 GGGATGGGCTGGGGGAAAACTGG - Intergenic
1121892201 14:97604774-97604796 AGTGAGTCTTGGGGAAAAACTGG + Intergenic
1122877024 14:104672255-104672277 GGGGAGACCTGGGGGTACAGGGG + Intergenic
1125389559 15:39177426-39177448 GGAGAGTAATGGGGGAATACAGG + Intergenic
1125965159 15:43869001-43869023 GGGGAGTTCTCCAGGAAAACAGG + Intergenic
1129177097 15:73848009-73848031 TGAGAGTCCTGGGGGAAAGAGGG + Intergenic
1130373296 15:83305701-83305723 GGGCAGTGCTGAGGGTAAACAGG - Intergenic
1130806235 15:87326505-87326527 AGGGAATTCTGGGGGAAAAAAGG + Intergenic
1131054640 15:89368276-89368298 GAGGAGGACTGGGGGAAAGCTGG - Intergenic
1132285376 15:100658621-100658643 GGGGAGAACTCGGGGAACACGGG - Intergenic
1132553048 16:561033-561055 GGGGAGAGCTGGGGGAGAACCGG - Intronic
1132693674 16:1192756-1192778 GGGCAGGCCTGGGAGAAATCGGG + Intronic
1134241408 16:12509546-12509568 GGGGTGTCCTGGCAGTAAACAGG + Intronic
1134470676 16:14522583-14522605 GGGCAGCCCTGGTGGAAAAAAGG + Intronic
1136485791 16:30571116-30571138 TGGGAATCCTGGGAGAGAACAGG + Exonic
1136600991 16:31288196-31288218 GAGGAGTGGTGGGAGAAAACAGG + Intronic
1137436143 16:48455601-48455623 GAGGAGGACTGGGGGAAAAAGGG + Intergenic
1137719380 16:50618918-50618940 GGGAGGTCCTGAGGGAAGACAGG + Intronic
1139484873 16:67249685-67249707 GGGGAGAGCTGGAGGAAAAGTGG - Intronic
1140143963 16:72287368-72287390 GGTGAGTCCTGAGAGAACACAGG + Intergenic
1140272617 16:73480420-73480442 GGGGAGGTGAGGGGGAAAACTGG - Intergenic
1140974489 16:80045776-80045798 GGGGAATGCGGGGGGAAAGCAGG - Intergenic
1141195616 16:81858618-81858640 GGTATGTGCTGGGGGAAAACAGG + Intronic
1142130990 16:88431376-88431398 GGGTGGTCCTGGGGGCACACAGG + Exonic
1142294238 16:89209870-89209892 AGGGAGACCTGGGGGAGACCGGG + Intergenic
1142369891 16:89673308-89673330 GGGCTGTCCTGGTGGAAAAATGG - Intergenic
1142509803 17:386175-386197 GGTGAGTCCGGGGGGGAAGCGGG - Intronic
1143031195 17:3968185-3968207 GGGGAGGCCTGAAGGAAATCAGG - Intergenic
1143073867 17:4322611-4322633 GGGGTGTCCTGGGAAAATACAGG + Intronic
1143513255 17:7407175-7407197 GGGGGGTTCTGGAGGAAGACGGG - Intronic
1145351956 17:22091180-22091202 GGGAGGTGATGGGGGAAAACGGG + Intergenic
1145780139 17:27557333-27557355 GAGGAGTCCTGGGGGGATAGCGG + Intronic
1146016205 17:29235693-29235715 GAGGTCTCCTGGGGGAAAAATGG + Intergenic
1146962723 17:36998061-36998083 GGGGACTCGTGGGGGAAGAGTGG + Intronic
1147141170 17:38461345-38461367 GTGGAGTCCTGGTGGAAGTCAGG + Intronic
1147426007 17:40346251-40346273 GGGGAGTCATGGGGGATACCAGG - Intronic
1147703336 17:42409639-42409661 TGTGAGTCATGGGGGAAACCTGG - Intronic
1147980871 17:44273074-44273096 GGGGAGTCCTGGGAGGAAGGCGG + Intergenic
1150804372 17:68307636-68307658 GGGGTGACCTGGGAGCAAACTGG + Exonic
1152235658 17:79137015-79137037 TGGGAGTCCTGGGGGATGCCAGG - Intronic
1153606851 18:6842709-6842731 GGAGAGTTCTGGGAGAAAAGAGG - Intronic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1155735484 18:29217570-29217592 GGGGAGTAGTTGGGGAATACAGG - Intergenic
1155792474 18:29991095-29991117 TGGCAGTCCTGGTGGAAAATTGG + Intergenic
1155859331 18:30877213-30877235 GGGGAGAGATGGGGGAAAAATGG + Intergenic
1155928891 18:31685391-31685413 GGGGAGCCGCGGAGGAAAACCGG + Intronic
1159366470 18:67472127-67472149 GGGAAGTCTTGTGGGTAAACTGG - Intergenic
1161070456 19:2257307-2257329 TGGGAGTCCTGAGGGAAGAGGGG + Intronic
1161910854 19:7192771-7192793 AGGGAGAACTGGGGGAAAATTGG - Intronic
1162069457 19:8145040-8145062 GGGGATTCCTGGGTGAAGACAGG - Intronic
1162321358 19:9972897-9972919 GGTGAGTCCTGGGGGGAAGTGGG - Exonic
1163701986 19:18790703-18790725 AGGGAGTCCTTGGCGAAAAGAGG - Intronic
1164506709 19:28867086-28867108 GAGGAGTCCTGTGGGAAGACGGG + Intergenic
1164678271 19:30117562-30117584 TGGGGGTGCTGGGGCAAAACCGG + Intergenic
1165738646 19:38193010-38193032 GGGAGTCCCTGGGGGAAAACTGG + Intronic
1165742826 19:38213749-38213771 GGGGTGTCCTGGGGGCCAAGGGG + Exonic
1166328904 19:42067581-42067603 AGGGACTCCTGGGGCAAATCAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166691270 19:44822453-44822475 GAGGAGTCCCTGGGGAAAGCGGG + Intergenic
1167573405 19:50305074-50305096 GGGGAGCCCTGGGGGCAATGGGG + Intronic
1167713818 19:51128069-51128091 GGAGAGCCCTGGGGGAGGACAGG + Intronic
1167724376 19:51200569-51200591 GGGAAGTACTGGGGAAATACAGG - Intergenic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
926222374 2:10944676-10944698 GTGGAGTCCTGGAGGACAGCAGG - Intergenic
926802189 2:16668360-16668382 GTGGAGGCCTGGGTGAAAAGTGG + Intergenic
927879829 2:26682517-26682539 GGGGAGGCCTGGGGGTACTCAGG - Intergenic
929601702 2:43208539-43208561 GGGAAGGGATGGGGGAAAACAGG + Intergenic
929940394 2:46329376-46329398 GGGGAGGCCTATGGAAAAACAGG + Intronic
932080957 2:68714947-68714969 GGGGAGTGCTGGGAGAGAAGGGG - Intronic
932090218 2:68799734-68799756 GGGAAGTGCTGGGGGAAGAAGGG + Intronic
934917606 2:98312568-98312590 TGTGAGTGCAGGGGGAAAACAGG - Exonic
934919532 2:98331742-98331764 GGGCAGTCCTGAAGGTAAACTGG + Exonic
935512703 2:103995631-103995653 GGGCAGAGCTGGGGTAAAACAGG - Intergenic
937381037 2:121376531-121376553 GGGGGGTCGGGGAGGAAAACAGG + Intronic
937796637 2:126030343-126030365 GGGAGGTTCTGGTGGAAAACTGG - Intergenic
937990852 2:127661548-127661570 GGTGTCTCCTGGGGGATAACTGG - Intronic
938761581 2:134431022-134431044 GGTGAGTCCTGAAGGCAAACTGG + Intronic
940738410 2:157479797-157479819 GGTGAGTCCTAGGGCTAAACTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942946959 2:181682740-181682762 GGGGAGTTCCGGAGGAGAACTGG + Intergenic
944833636 2:203557257-203557279 TGGGAATCCTGGGGAAAAAAAGG + Intergenic
945035072 2:205697597-205697619 GGGTAGTCCTGGGGGTAACCGGG - Exonic
948040575 2:234898456-234898478 GGAAAGTCCTCGGGGATAACAGG - Intergenic
948223567 2:236291684-236291706 GGGAAGGCTTGGGGGGAAACAGG + Intergenic
949032170 2:241802405-241802427 GGGAAGCCCTGGGGGGAAGCCGG - Intronic
1169655526 20:7918549-7918571 GGGGATTCCTTGGGGAGAAAAGG - Intronic
1171562287 20:26136461-26136483 GGGAGGTGATGGGGGAAAACAGG + Intergenic
1172024536 20:31938941-31938963 GAGGAGCCTTGGGGGAAAAATGG + Intronic
1172388449 20:34549890-34549912 ATGGAGTCCTGGGGGAAACAGGG - Exonic
1174209357 20:48865120-48865142 GGGGAGTCTCTGGGGGAAACAGG + Intergenic
1174298146 20:49563245-49563267 GGTGAGCCCTGGGGGAAGAATGG - Intronic
1174765666 20:53251763-53251785 GGGGAAAACTGTGGGAAAACTGG - Intronic
1175171154 20:57082400-57082422 GGGGTGACCTGGGAGAAAAGGGG - Intergenic
1175788098 20:61724361-61724383 GGGGAGTCTTGGCGGGACACGGG - Intronic
1175922122 20:62455135-62455157 GAGGAGGCCTGGGGGAGAGCCGG + Intergenic
1176173070 20:63704938-63704960 AGGGAGCCCTGGAGGAGAACTGG - Intronic
1176649035 21:9529188-9529210 GGGAGGTGATGGGGGAAAACGGG - Intergenic
1178689780 21:34741339-34741361 TGGGAGACCTGGAGGAAACCAGG + Intergenic
1179987185 21:44928343-44928365 ATGGACTCCAGGGGGAAAACCGG + Intronic
1180231000 21:46426714-46426736 GGGGAGGACTTGGGGAAAAGTGG - Intronic
1180937416 22:19634755-19634777 GGGGAGTGCTGGGGGAGACTGGG + Intergenic
1181467877 22:23119984-23120006 GGGGAGTCCTGGGCACAAGCAGG + Intronic
1181807061 22:25381325-25381347 GGGGACACCTGGGGGCAAAGGGG + Intronic
1182585851 22:31344036-31344058 AGGGAGCCCTGGGGGAAGAATGG + Intronic
1182841707 22:33395956-33395978 TTAGAGTCCTGGGGGAAAAGGGG - Intronic
1182959629 22:34460078-34460100 TGGAATTCCTGGGGGAAAAGAGG - Intergenic
1183245724 22:36692053-36692075 GGAGAGCCATGGGGCAAAACTGG + Intronic
1183675460 22:39296867-39296889 GGGGTGGGCTGGGGGAGAACGGG - Intergenic
1183818851 22:40327542-40327564 GGGGAGGTCTGGGGGAAAAGGGG - Exonic
950305222 3:11911591-11911613 GAGGAGGTCTGGGGGAAAAGGGG - Intergenic
952889438 3:38030484-38030506 GGAGAGTCCCTTGGGAAAACTGG + Intergenic
953569342 3:44058852-44058874 GGGGAGTGTTGGGGGAGAAGGGG - Intergenic
954634164 3:52062612-52062634 GGGGAATCCGGGGTGAATACAGG - Intergenic
957726247 3:84071137-84071159 GGGGATTCCTTGGGAAAAATAGG - Intergenic
959279182 3:104316548-104316570 GGTGAGTCCTAGTGGAGAACTGG + Intergenic
961037026 3:123649413-123649435 GGGGAGACCTGGTGGAGAAGTGG - Intronic
961222779 3:125212935-125212957 GGGCAGGGCTGGGGGAAAACAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
962269129 3:133965317-133965339 GGGGAGTCCTCAGGGAAAACTGG + Intronic
963008934 3:140751377-140751399 GGGGAGTACTGGGAGAATTCTGG - Intergenic
967156108 3:186693862-186693884 GGTGAGTCCTGGGGAGAAAAAGG + Intergenic
967809891 3:193749291-193749313 GGGGAGGCCTGAGGGAGAAAGGG + Intergenic
968618340 4:1592498-1592520 GGTCCTTCCTGGGGGAAAACAGG + Intergenic
969402006 4:6961867-6961889 GGGGAGTCCTGGTGTTAACCTGG + Intronic
969500515 4:7549806-7549828 GGTGTGTCCTGGGGGCAAAGAGG - Intronic
969700224 4:8763973-8763995 AAGGAGGCCTGGGGGAAAAATGG + Intergenic
969713760 4:8858820-8858842 GGGAGGTCCTGGGGGGACACTGG + Intronic
971938960 4:33189369-33189391 GGGGGGTCCTGAGGCAAAGCTGG - Intergenic
972350346 4:38230963-38230985 GGGCACTCCTGGGGGCCAACAGG + Intergenic
972557812 4:40198175-40198197 GAGGGGGCCTGGGGGCAAACTGG + Intronic
973215267 4:47661184-47661206 GGGTAGTGGTGGGGGAAAGCAGG + Intronic
973992805 4:56427422-56427444 GTGAAGTCATGGTGGAAAACAGG - Intronic
974501652 4:62712446-62712468 GGGGAGTAGCGGGGGAAAAAGGG + Intergenic
975769597 4:77707101-77707123 TGGGAGACCTGGAGGGAAACTGG + Intergenic
976053172 4:81031641-81031663 GGGGGGTCCCGGGAGAAAGCTGG - Intronic
976600742 4:86935394-86935416 TGGGAGCCCTCGGGGAGAACGGG + Intronic
976953790 4:90868324-90868346 TGGGAGTGGTGGGGGAAAAAGGG - Intronic
979646954 4:123080694-123080716 GGGTTGTCCTGTGGGACAACTGG - Intronic
985791043 5:1926856-1926878 TGGGAGAACTGGGGGAGAACCGG - Intergenic
987109626 5:14672889-14672911 GGTGAATCTTGGGGGAAAAGGGG + Intronic
988455476 5:31383578-31383600 GGGCAGTCTTGAGGAAAAACTGG + Intergenic
988625062 5:32866083-32866105 GGTGAATCCTGGGGGGAAACTGG + Intergenic
990986019 5:61641747-61641769 GGGGTGTCCTAGGGGAATAGGGG + Intronic
992312150 5:75511669-75511691 GGGGAGTAGTGGGGGAGAATGGG - Intronic
992838039 5:80659398-80659420 GGGGAGTGCTGGGGCAGAACAGG - Intronic
994238457 5:97392480-97392502 GGGGAATCTTGGGGGAAACTTGG + Intergenic
997955548 5:138275888-138275910 GGGTGGAGCTGGGGGAAAACAGG - Intergenic
998335864 5:141371742-141371764 TAGGAGGCCTGGTGGAAAACGGG - Exonic
998395319 5:141814449-141814471 GGGGAGTAATGGGGAAAAAGGGG - Intergenic
1000215863 5:159155360-159155382 GGGGCCTTCTGGGGGAAATCTGG - Intergenic
1000265130 5:159629012-159629034 GTGGAGTCCTGGGGGACCTCAGG + Intergenic
1001276569 5:170355559-170355581 GGGGAATCATGGGGGTCAACAGG + Intronic
1001825103 5:174738181-174738203 GGAAAGTCCTGGGGCAACACAGG - Intergenic
1003110766 6:3250449-3250471 GGGGAAGCCTGTGGGAAAGCAGG + Intronic
1003379786 6:5613978-5614000 TGGGAGTCCTGGGGGGAAAAGGG + Intronic
1003868353 6:10382891-10382913 GGGGTGCCCTGGCGGATAACAGG + Intergenic
1004676958 6:17852320-17852342 GGGGAGGATTGGGGGAAAAAGGG + Intronic
1006333942 6:33410932-33410954 GGGGAGGACTGGGGGAAAGGAGG - Intronic
1006360350 6:33584036-33584058 GGGGACGCCTCTGGGAAAACAGG + Intergenic
1007175310 6:39892462-39892484 GGGGAGTACTAGGGGACAAGAGG - Intronic
1010373711 6:75141462-75141484 GTGGAGTGCTGGGGGATACCGGG - Intronic
1010719146 6:79262714-79262736 TGGGACTCCTTGGGCAAAACAGG - Intergenic
1011814111 6:91168366-91168388 GGGCAGTCCTGGTGGCAAATGGG - Intergenic
1013390971 6:109686120-109686142 GGAGAGTCCTTGGGTAAGACTGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1017809605 6:157975374-157975396 GGGGAGACCTGGATGACAACAGG + Intergenic
1020660420 7:10974408-10974430 GGAGAGTCCTGCGGGAAAGCAGG + Intronic
1025275573 7:57579258-57579280 GGGAGGTGATGGGGGAAAACGGG - Intergenic
1026642676 7:72140825-72140847 GCACAGTCCTGGGGGAAAGCTGG + Intronic
1028622116 7:92836417-92836439 GGGGGGTCCCGGGGGAGATCTGG - Intronic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1029883457 7:103841614-103841636 AAGTATTCCTGGGGGAAAACGGG - Intronic
1031328439 7:120432433-120432455 GGGGAGGCATGTGGTAAAACAGG + Intronic
1032085538 7:128881571-128881593 GAGGAGCCCAGGGGGAACACAGG - Intronic
1032482036 7:132254994-132255016 GGGGTGGCCTGGGGGAAGGCCGG + Intronic
1032947753 7:136871247-136871269 AGGGAGTCTCTGGGGAAAACGGG + Intronic
1034256235 7:149726020-149726042 TGGGAGTCCTGTGGGGAACCAGG + Exonic
1034532877 7:151707667-151707689 AAGGAGTCCTGAGGGAGAACTGG + Intronic
1035097710 7:156368980-156369002 GTGGATCCCTGAGGGAAAACAGG + Intergenic
1036805631 8:11830723-11830745 GGGGAGTGCTGGGTAAAACCTGG + Intronic
1039333771 8:36567623-36567645 GGGTAGCCTTGGGGGAAAATAGG + Intergenic
1040436089 8:47393145-47393167 TGGGATACCTGGGGAAAAACTGG - Intronic
1042759323 8:72253448-72253470 GGGGAATGCTGGGAGAAAAGTGG + Intergenic
1045569085 8:103351351-103351373 GGGGATTCCTGGGGGGAAGGTGG + Intergenic
1046878636 8:119283621-119283643 GGAGATTCCTGTGGCAAAACAGG + Intergenic
1047455143 8:125001420-125001442 GGAGAGCTCTGGAGGAAAACAGG - Intronic
1048348387 8:133595588-133595610 GGGGACTCCTGGGGGAAGAGGGG + Intergenic
1048795529 8:138145985-138146007 GGGGCTCCCTGGAGGAAAACTGG - Exonic
1049279464 8:141736970-141736992 GGGGATTCCTGGAGCAACACAGG - Intergenic
1051257136 9:15225879-15225901 GGGCATTCCTGGGGGAAGAGGGG - Intronic
1051749361 9:20325372-20325394 GGAGAGACCTGAGGGAAACCTGG + Intergenic
1053144305 9:35702026-35702048 AGGGAGACCAGGGAGAAAACTGG + Intronic
1054967939 9:71051058-71051080 GAGGAGTTCTAGGGGAAAAGAGG + Intronic
1055305732 9:74927448-74927470 GGGGAGAGCAGAGGGAAAACCGG - Intergenic
1055907018 9:81306678-81306700 GGGGACTCGTGGGGGAAGAATGG + Intergenic
1056659895 9:88535782-88535804 GGGGAGGCCTGGGGGAACATGGG - Intronic
1057009568 9:91589579-91589601 TGGGAGTGCTGGGGGGACACTGG + Intronic
1057780672 9:98047458-98047480 TGGGACTCCTTGGGTAAAACAGG + Intergenic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058669344 9:107347473-107347495 GGAGGGCCCTGGGGGAACACAGG + Intergenic
1060369896 9:123058896-123058918 GGGGCATGCTGGGGGAAGACTGG - Intronic
1061720789 9:132550024-132550046 GGGGAGTGATGGGGGAATAGCGG + Intronic
1062261163 9:135663917-135663939 GGGGAGACCTGGGGGGCAGCGGG + Intronic
1062363778 9:136199362-136199384 GGGGAGCCCGCGGGGAAATCAGG - Intronic
1062723073 9:138054462-138054484 GGGAAGAGCTGGGGGAAAGCTGG + Intronic
1203626771 Un_KI270750v1:32737-32759 GGGAGGTGATGGGGGAAAACGGG - Intergenic
1186046033 X:5537419-5537441 GGGGTGTCATGGAGAAAAACGGG + Intergenic
1187258759 X:17666012-17666034 GGGGAGTCCTGGGGAAAGAATGG + Intronic
1188055170 X:25532107-25532129 GGAGACTCCTGAGGGAAAAAAGG - Intergenic
1188355661 X:29187757-29187779 GGGGAGTAAGGGGTGAAAACGGG - Intronic
1188766992 X:34105819-34105841 GTGGGGTACTGGGGGAAAATGGG - Intergenic
1189278397 X:39803884-39803906 GGGGAGCCCTGGGGTCAAAAGGG + Intergenic
1189701401 X:43718354-43718376 GGGTAGTAGTGGGGGAAAACAGG + Intronic
1190402953 X:50057219-50057241 GGAGAGTCCTGAGGAAAAAGTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1198788100 X:140313425-140313447 GGTGAGTCCTGGTGCTAAACTGG + Intergenic
1199197411 X:145047735-145047757 GGGGAGTCCTGGTGCTGAACTGG + Intergenic
1199750677 X:150814694-150814716 GGGGAGTCCTGAGACAAAAAAGG + Intronic
1200141392 X:153904614-153904636 GGGGAGGCCTGGGGGAAAGGGGG + Intronic
1200218798 X:154380534-154380556 TGAGAGTCCTGGGGGCAAAAGGG + Intronic
1201357398 Y:13112088-13112110 GAGGAGTCCTGGGGTAGGACTGG + Intergenic