ID: 1097812096

View in Genome Browser
Species Human (GRCh38)
Location 12:64029998-64030020
Sequence TCTCAAGTACTCATTGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097812096_1097812098 11 Left 1097812096 12:64029998-64030020 CCCACTACAATGAGTACTTGAGA 0: 1
1: 0
2: 0
3: 9
4: 115
Right 1097812098 12:64030032-64030054 TTTGCTAAATTAGAATTTATTGG 0: 1
1: 0
2: 4
3: 55
4: 614

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097812096 Original CRISPR TCTCAAGTACTCATTGTAGT GGG (reversed) Intronic
900767957 1:4518096-4518118 TCTCAAGTATTCTCTGCAGTGGG + Intergenic
901572950 1:10176568-10176590 TCTTAAATACTCATCCTAGTGGG + Intronic
901583773 1:10269124-10269146 TCTAAAGTACTCATTTTATAAGG - Intronic
906038636 1:42768886-42768908 TCTCAAATACAGATTGTATTGGG - Intronic
909648334 1:77942326-77942348 TGTTAAGTACACTTTGTAGTAGG + Intronic
910330903 1:86071773-86071795 TCTCCAGCAATTATTGTAGTAGG - Intronic
910804504 1:91177142-91177164 TCCCATGGACTCAATGTAGTTGG + Intergenic
911511798 1:98816212-98816234 TCAATAGTACTCATTGTAGCAGG - Intergenic
912180339 1:107211481-107211503 GGTCAAGTAATCATTGTACTAGG - Intronic
915327669 1:155089182-155089204 TCTCGAGGACCCATAGTAGTGGG + Intergenic
917987147 1:180332300-180332322 TCTGAAGAACAGATTGTAGTGGG - Intronic
918877443 1:190066676-190066698 TTTCAAGTACTCATTGTTTAAGG - Intergenic
920020463 1:202951949-202951971 TCTGAAATACTCATTTGAGTAGG - Intronic
920574832 1:207051713-207051735 TAACAAGTATTCATTGCAGTTGG + Intronic
921429649 1:215050778-215050800 TGTTAAGTGCTCATTGGAGTTGG + Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923946223 1:238890732-238890754 TCTCAAGAGCCCATTGAAGTAGG + Intergenic
1068010127 10:51438068-51438090 ATTCAAATTCTCATTGTAGTAGG - Intronic
1071390751 10:85172867-85172889 TCTCCAGTTCTCATTCTATTTGG - Intergenic
1086357730 11:86022212-86022234 TATCAAGTACTTTTTGTGGTAGG - Intronic
1097812096 12:64029998-64030020 TCTCAAGTACTCATTGTAGTGGG - Intronic
1099177996 12:79444157-79444179 GCTGAATGACTCATTGTAGTAGG - Exonic
1099190407 12:79555929-79555951 TCACAACTAATAATTGTAGTAGG - Intergenic
1100715719 12:97303211-97303233 TGTATAGTATTCATTGTAGTAGG + Intergenic
1102134383 12:110560930-110560952 TATCAAGTACCCATCCTAGTAGG - Intronic
1105726284 13:23165497-23165519 TCTAAAATACTCATTTCAGTAGG + Intergenic
1107697746 13:43017302-43017324 TGTGAAGCACTAATTGTAGTTGG - Intergenic
1109968462 13:69733948-69733970 ACTCAACTACTGAGTGTAGTTGG - Intronic
1111116412 13:83783933-83783955 TCTCACCTACTCTTTGTATTTGG + Intergenic
1113552127 13:111200755-111200777 TCCCAAGTACACTTTGTAGATGG + Intronic
1114465360 14:22918495-22918517 TTTCAAGCACTCATTCCAGTAGG - Intronic
1114782398 14:25552781-25552803 GCTGGAGTACACATTGTAGTTGG + Intergenic
1117642668 14:57816851-57816873 TATCAAGTAGTCACTGTTGTGGG - Intronic
1119364806 14:74082909-74082931 TCTCAATGACTCATTGTGATGGG + Intronic
1120036302 14:79702433-79702455 TCTCATGCACTCATTCTACTAGG + Intronic
1122472813 14:101983225-101983247 TCTCAATTACTCAAAGTATTGGG + Exonic
1125347702 15:38734737-38734759 CCTCAATTTCTCAATGTAGTTGG + Intergenic
1133457802 16:5958240-5958262 TCTCATGTACTCATTAAAGCAGG - Intergenic
1140582498 16:76248159-76248181 TCTCAAGTTCTCACTCTAGTAGG + Intergenic
1155861343 18:30904452-30904474 TTTCAAATACTCAAAGTAGTAGG + Intergenic
1156713010 18:39969990-39970012 TCTCAAGTACCCTTTGAAGTTGG - Intergenic
1156736617 18:40267329-40267351 TTTAAAGTGCTCATTTTAGTGGG - Intergenic
1159791149 18:72780340-72780362 TCTCTAGAAGTCATTGAAGTGGG - Intronic
926791914 2:16582142-16582164 TCTTAAGTTCACATTTTAGTTGG - Intronic
930245297 2:48977641-48977663 TCTGCAGTGCTCATTGTACTGGG + Intronic
937550743 2:123086962-123086984 ACCAAAGTACTCATTGTAATAGG - Intergenic
940960053 2:159775153-159775175 TCTCAAGCATACATTCTAGTGGG - Intronic
945621074 2:212137854-212137876 TTTCAAGTACTAACTGTAATTGG + Intronic
945709697 2:213279967-213279989 TCTGAAGTGCTCATTGTAATGGG + Intergenic
1170231648 20:14054097-14054119 TCTAAAGCACTTATTGTAATTGG + Intronic
1171294000 20:24001000-24001022 TCTCAATTTCTCATTTTATTTGG - Intergenic
1173432034 20:42996695-42996717 TCTCAAGTAATGATTCAAGTTGG - Intronic
1173627574 20:44484711-44484733 TCTCAAGTACTCTCTGGAGTAGG + Intronic
1173971132 20:47153086-47153108 TCTCAGGGACTCAGTGTGGTGGG - Intronic
1177472550 21:21577521-21577543 TCTCAAGTATTCATTTTACATGG - Intergenic
1178398046 21:32259786-32259808 TCCCAAGAATTCATTGTATTTGG + Intergenic
1182269147 22:29142584-29142606 TCTCAGGTACTCTTGGGAGTTGG + Intronic
949642312 3:6050901-6050923 TCTCCAGTACTAATAGAAGTGGG - Intergenic
955725993 3:61933338-61933360 TCTCAACTATTAATTGTACTGGG + Intronic
955757919 3:62244749-62244771 TATAAAGCTCTCATTGTAGTGGG - Intronic
960387255 3:117035339-117035361 TCTCAAGAACTCATGGTTTTGGG + Intronic
962877644 3:139548018-139548040 TCTCAAGTACTTGGTGTACTTGG + Intergenic
963080977 3:141393537-141393559 TCTGAAGTACTCAGGGTACTGGG + Intronic
964871967 3:161322634-161322656 TCTCAAGTTATTATTGTATTAGG - Intergenic
965199647 3:165641167-165641189 TTTTAAGTACACAATGTAGTTGG + Intergenic
967260529 3:187637409-187637431 ACTAAAGTAATCATTTTAGTAGG + Intergenic
969547593 4:7841779-7841801 TCACAACTACTCTTAGTAGTAGG + Intronic
970199093 4:13583926-13583948 TCTCAAGTCCTCTGTGTTGTGGG + Intronic
970844857 4:20524209-20524231 TCTCATGTAACCATTGTTGTTGG - Intronic
971483637 4:27137886-27137908 TCTCAAATCATCATTGTAATGGG + Intergenic
978259103 4:106731329-106731351 TCTCAAATAATTAATGTAGTAGG - Intergenic
981561162 4:146049963-146049985 TCTCATATGCTCACTGTAGTGGG + Intergenic
983267485 4:165522702-165522724 TCTCAGGTATTTATAGTAGTTGG + Intergenic
987741414 5:21913797-21913819 TCCCAAGTAGTCCCTGTAGTGGG + Intronic
988287131 5:29234769-29234791 TCTCAAGTATTCTTTGTATCTGG - Intergenic
988504581 5:31810652-31810674 GCTCACCTACTCATTGCAGTTGG - Intronic
990739424 5:58897040-58897062 TCATAAGTACTCAATGGAGTCGG + Intergenic
992723379 5:79582267-79582289 TCTCATGTTCTCTATGTAGTAGG + Intergenic
999574525 5:152961061-152961083 TCTCAAGTTCACGCTGTAGTTGG - Intergenic
1001020603 5:168179291-168179313 TCTCAAGAACCCTTTGTGGTGGG - Intronic
1003625367 6:7736792-7736814 CGTCAGTTACTCATTGTAGTGGG + Intronic
1006848718 6:37081729-37081751 TCTCAAGGACTCTTTCTAGCTGG + Intergenic
1008125149 6:47659778-47659800 TCTCAAGTCATCATTGCAGCTGG + Intronic
1008321573 6:50120716-50120738 TCTAAAATACTCTTTGTAATAGG - Intergenic
1015311614 6:131773077-131773099 TCTCAAGCACTGATTTTAGGAGG + Intergenic
1016285686 6:142470031-142470053 TCTGACTTGCTCATTGTAGTAGG - Intergenic
1016287090 6:142485670-142485692 TCTCCAGTGCTCTTTGTAGTTGG - Intergenic
1019176968 6:170164970-170164992 TCTGAAGTTCTCCTTGGAGTGGG - Intergenic
1023603689 7:41907505-41907527 TCTCAAATGCTCTTTGTACTGGG - Intergenic
1024660663 7:51490373-51490395 TCACAAGTACTCACTGAAGTAGG + Intergenic
1024996891 7:55279084-55279106 TCTCAAAGACTCAGTGTAATAGG - Intergenic
1031737635 7:125386302-125386324 TCTGAAGTCCTCAGTGTATTTGG + Intergenic
1037401886 8:18502266-18502288 TCTCAATCACTCCATGTAGTAGG - Intergenic
1039214621 8:35256277-35256299 CCACAAATATTCATTGTAGTTGG - Intronic
1039596692 8:38796897-38796919 TCTCACATAGTCTTTGTAGTTGG + Intronic
1040104392 8:43533373-43533395 CCTCAAGTCCTCATTCTTGTTGG + Intergenic
1041840627 8:62266577-62266599 TCTCATGTAATAGTTGTAGTTGG + Intronic
1044276776 8:90310160-90310182 TCTCAAGTATTTATTTTTGTAGG + Intergenic
1044590039 8:93905428-93905450 TGTCATGTACTCACTGTGGTTGG + Intronic
1045194346 8:99915077-99915099 TCTCAAGTACTCTTTTCAGCTGG + Intergenic
1052730067 9:32275008-32275030 TCTCATGCTCTCATTGTAGGTGG - Intergenic
1052847166 9:33347130-33347152 TCTCAAGTGCTCATTGTTCCAGG + Intronic
1053441133 9:38117395-38117417 TCTCAAGTTCTCAATCTAGAGGG - Intergenic
1055820370 9:80254661-80254683 TCTTAATTACTAATTGTGGTTGG + Intergenic
1056462595 9:86822840-86822862 TCTGACTTAGTCATTGTAGTAGG + Intergenic
1058669430 9:107348090-107348112 TGTCAAGTCCTCATGGCAGTTGG - Intergenic
1060423039 9:123483175-123483197 TCCAAAGCACTCAGTGTAGTAGG - Intronic
1060810416 9:126608862-126608884 TCTCAAGTAGTCATAATAATTGG - Intergenic
1185976655 X:4728629-4728651 TATCAAGTCCTCATAGTTGTAGG - Intergenic
1186090466 X:6041585-6041607 CCTCAATTATTCACTGTAGTTGG + Intronic
1186137739 X:6536873-6536895 TCTCAATTATTGATTTTAGTTGG - Intergenic
1186298400 X:8172875-8172897 TCTCAATTATTCATTTTAGTTGG - Intergenic
1188645264 X:32558857-32558879 TCTCAAATACCTATTATAGTTGG + Intronic
1189954390 X:46262882-46262904 TCTCAACTCCTCATGGTAGGGGG + Intergenic
1190995918 X:55608692-55608714 TCTCAATAACTCATTGAGGTAGG + Intergenic
1192928197 X:75778477-75778499 TCTCAGGCAGTCATTTTAGTGGG + Intergenic
1194505777 X:94731769-94731791 TCTCAAGTATACATTGAAATGGG - Intergenic
1195742847 X:108082803-108082825 TCTAAGGAATTCATTGTAGTTGG + Intergenic
1196386904 X:115165323-115165345 TTTCAAGTACTCTTTCAAGTAGG + Intronic
1197876299 X:131111815-131111837 TCTCCAGTTCTCATTGTATTGGG + Intergenic
1199508791 X:148596479-148596501 TCTCAAGTACCTATTGTATTTGG - Intronic
1200319366 X:155170393-155170415 TCTCACGTATTCATTATATTTGG + Intergenic
1201439080 Y:13988686-13988708 TCTCAATTATTGATTTTAGTTGG - Intergenic
1201445493 Y:14054022-14054044 TCTCAATTATTGATTTTAGTTGG + Intergenic
1201506583 Y:14708534-14708556 CCTCAATTATTCACTGTAGTTGG - Intronic