ID: 1097812616

View in Genome Browser
Species Human (GRCh38)
Location 12:64035016-64035038
Sequence AACTCTTTCAGCCCTGATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097812615_1097812616 -9 Left 1097812615 12:64035002-64035024 CCTCAGGGATCAGCAACTCTTTC 0: 1
1: 0
2: 1
3: 13
4: 205
Right 1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG 0: 1
1: 0
2: 2
3: 13
4: 155
1097812614_1097812616 1 Left 1097812614 12:64034992-64035014 CCACTCATGACCTCAGGGATCAG 0: 1
1: 0
2: 1
3: 15
4: 163
Right 1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG 0: 1
1: 0
2: 2
3: 13
4: 155
1097812611_1097812616 9 Left 1097812611 12:64034984-64035006 CCTGCTGGCCACTCATGACCTCA 0: 1
1: 0
2: 4
3: 21
4: 161
Right 1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG 0: 1
1: 0
2: 2
3: 13
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097812616 Original CRISPR AACTCTTTCAGCCCTGATGC TGG Intronic
901520364 1:9779169-9779191 AGCCGTTTCAGACCTGATGCTGG - Intronic
902811971 1:18893076-18893098 AACTCTTTCAGCCGAGAAGCGGG + Intronic
903789937 1:25885938-25885960 CACTGTTTTAGCCCTGATGAAGG - Intronic
904416692 1:30366194-30366216 ACCTCCTTCACCCCAGATGCCGG + Intergenic
904991615 1:34597949-34597971 AACCCTTTGAGCTCTGCTGCTGG - Intergenic
908140470 1:61179217-61179239 ATCTTTATCAGCACTGATGCTGG - Intronic
910442219 1:87264654-87264676 AAGTTTTTCAGCCCAGATGTTGG + Intergenic
910693303 1:89986277-89986299 AACTGTGGCAGCCCTGATTCAGG + Intergenic
915630114 1:157147107-157147129 AATTCTCTCAGCCCTTCTGCAGG - Intergenic
919602713 1:199642116-199642138 AACTCTCTTACCCCTGATACTGG - Intergenic
920031452 1:203039818-203039840 AACTCTTACAACCCTGAAGTTGG + Intronic
921388376 1:214594447-214594469 CTCTCTTTCATCCCTGACGCTGG - Intergenic
922963366 1:229666874-229666896 AGCTCTGTCTGCCCTGCTGCAGG - Intergenic
1062927694 10:1329387-1329409 AGCTCTTTCAGACCAGAAGCAGG + Intronic
1064772531 10:18738262-18738284 AATGATTTGAGCCCTGATGCTGG + Intergenic
1064827994 10:19427787-19427809 GACTCTTTTAGCCCTCATGTAGG - Intronic
1067129923 10:43554236-43554258 TACTCTTTCATTCCTGATACAGG + Intergenic
1070219500 10:74425291-74425313 ACCTCTTTCAAACTTGATGCTGG - Intronic
1071049757 10:81432095-81432117 AACCCTTTCAACACTAATGCTGG - Intergenic
1073469867 10:103715878-103715900 AACTCTGCCAGCCCTGCTTCAGG - Intronic
1076439663 10:130472455-130472477 ATGTCTTTCAGCCTTGAGGCAGG + Intergenic
1078944031 11:16043738-16043760 AAATCTTCCAGTCCTGAAGCAGG - Intronic
1088579893 11:111305040-111305062 AAGTCTTTCAGTCTTGATTCAGG + Intronic
1090167102 11:124561278-124561300 AACTCCTTCAGCCCTCATAAAGG + Intergenic
1091447892 12:554342-554364 AACCCTTCCAGCCCACATGCAGG - Intronic
1092376148 12:7956974-7956996 TTCTCTTTCATCCCAGATGCTGG + Intergenic
1092528156 12:9323084-9323106 AATTCTCTCAGCCCTGAAGAAGG + Intergenic
1092539114 12:9408677-9408699 AATTCTCTCAGCCCTGACGAAGG - Intergenic
1096225696 12:49865573-49865595 CACACTTTGAGCCCTGATCCAGG + Intergenic
1097812616 12:64035016-64035038 AACTCTTTCAGCCCTGATGCTGG + Intronic
1099979864 12:89586080-89586102 AAATATTTGGGCCCTGATGCAGG + Intergenic
1101984926 12:109438525-109438547 AACTCTTTCAGCCATCAAACTGG + Exonic
1102456440 12:113073676-113073698 AGCTCTTTCAGCCCTGAGTAGGG + Intronic
1103998694 12:124846441-124846463 ATCTGTTTTAACCCTGATGCCGG - Intronic
1104286401 12:127428605-127428627 AAATCCTTCAGCCCTAATGCTGG - Intergenic
1105357396 13:19671221-19671243 TACTCATTCAGCCCTGTTGCAGG + Exonic
1106879901 13:34117698-34117720 AACTCTATCAGGCCTCATGCTGG - Intergenic
1108985955 13:56587797-56587819 ACCTTTTACAGCCCTGAAGCAGG + Intergenic
1109469791 13:62790303-62790325 AATTCTTACAGCCGAGATGCTGG - Intergenic
1111409865 13:87860726-87860748 AACACTTTCAACCCTGATCCAGG - Intergenic
1112600513 13:100850905-100850927 AACTCTTTCATCCCTTATGAGGG - Intergenic
1112609971 13:100946370-100946392 ACCACTCTCAACCCTGATGCTGG + Intergenic
1113371696 13:109731210-109731232 AGCTCCTCCAGCCCTGAAGCAGG - Intergenic
1113977791 13:114243038-114243060 TACTCTTTCAGGGCTGAGGCAGG - Intronic
1119155294 14:72404709-72404731 CACTCTTTCAGCCTTCATTCTGG - Intronic
1120410515 14:84148998-84149020 AGCTCTTTGAATCCTGATGCAGG - Intergenic
1122711753 14:103663664-103663686 AACCCTTTCACCCCTGTTGAAGG + Intronic
1202902397 14_GL000194v1_random:51312-51334 AAGTATTTCATCTCTGATGCCGG - Intergenic
1124094237 15:26633866-26633888 AGTTCTTTCAGCCCTGAAGAAGG - Intronic
1124789743 15:32717332-32717354 GGTTCTTTCAGCCCAGATGCCGG - Intergenic
1125931023 15:43600255-43600277 GGCTCTTTCAGCACTGCTGCGGG - Exonic
1125944187 15:43700071-43700093 GGCTCTTTCAGCACTGCTGCGGG - Intergenic
1127120115 15:55764612-55764634 AACTCTTACAGCCTGGAAGCTGG + Intergenic
1130944160 15:88538527-88538549 AATTCTCTCAGCCCTGAGGAAGG - Intronic
1135381990 16:22003267-22003289 AAGTCTTTCAGCCCTGAAGGGGG - Intergenic
1137066799 16:35855235-35855257 AACTTCTACACCCCTGATGCTGG - Intergenic
1137458509 16:48636840-48636862 GACTCTATCAGCCCGGATCCCGG - Intergenic
1139036233 16:62949968-62949990 AGCTCTTTCAGCCTGGCTGCTGG - Intergenic
1140183469 16:72744668-72744690 TACTCTTTCTTCTCTGATGCTGG - Intergenic
1142021272 16:87784266-87784288 AATTCTCTCAGCCCTGAGGAAGG + Intergenic
1144161165 17:12559717-12559739 ACCTCTTTCAGTCCTGATACTGG + Intergenic
1144213287 17:13033091-13033113 CACGCATTCTGCCCTGATGCTGG + Intergenic
1147805118 17:43125736-43125758 CACTCTTTCCGCCCTAATGGAGG + Intergenic
1147811124 17:43170577-43170599 CACTCTTTCCGCCCTAATGGAGG + Exonic
1150414556 17:64976179-64976201 AACTAGCTCAGCCCTAATGCTGG - Intergenic
1151337817 17:73450421-73450443 AATCCTGTCAGCCCTGAAGCTGG - Intronic
1152522535 17:80866580-80866602 ACCTCTATCATTCCTGATGCTGG - Intronic
1152661591 17:81544806-81544828 AGCCCTTTCAGCCCTGATGCTGG - Intronic
1156232536 18:35168156-35168178 AACTCTTTCAGGACTGCAGCAGG - Intergenic
1159292479 18:66440238-66440260 AGCTCTCTCAGCCCTGACACTGG - Intergenic
1160526094 18:79538607-79538629 AACTCTTCCGGACCTGAGGCTGG - Intergenic
1160702565 19:515000-515022 AAGGCTGTCAGCCCTGCTGCCGG - Intronic
1161055655 19:2189560-2189582 CTCGCTTTCCGCCCTGATGCAGG - Intronic
1162026142 19:7895143-7895165 AACGCTTTCAGGCCTGGTGGCGG + Intronic
1164219412 19:23179839-23179861 AATTCTCTCAGCCCTGAAGAAGG + Intergenic
1165446458 19:35859532-35859554 ACCCCTTTCAGCCATGATGATGG + Exonic
1167888485 19:52521405-52521427 AATTCTCTCAGCCCTGAAGAAGG + Intergenic
925418154 2:3688100-3688122 CACTCTTCCAGCTTTGATGCTGG - Intronic
928736908 2:34301630-34301652 AACTCACTCAGCCCTGAGGGAGG - Intergenic
930935976 2:56951863-56951885 TACTCTTTCAGTTGTGATGCTGG + Intergenic
932577866 2:72972640-72972662 AACTCTCCCAGCCCCGCTGCAGG + Intronic
932645139 2:73492543-73492565 AACACTTCCAACCATGATGCTGG + Intronic
933766598 2:85713413-85713435 ACGTCTTTCAGCCCTGACACAGG + Intergenic
933919508 2:87030502-87030524 ATCTCTTTCTGCCCTCATGTTGG - Intergenic
934003486 2:87739400-87739422 ATCTCTTTCTGCCCTCATGTTGG + Intergenic
935697928 2:105786196-105786218 AATTTTTTCATCCCTGGTGCTGG - Intronic
937899239 2:127005000-127005022 TGCTCTTCCATCCCTGATGCTGG - Intergenic
937946873 2:127347373-127347395 AACACGTTCAGCACAGATGCAGG + Intronic
941320665 2:164050146-164050168 ACTTCTTTCAGCCCTGACACAGG - Intergenic
943080068 2:183248866-183248888 AAGTGTTTCTGCCCTGGTGCTGG - Intergenic
949016427 2:241714544-241714566 CCCTCTTTCAGTCCTGATACTGG + Intronic
1170858385 20:20078885-20078907 ACCTCTTTCATTCCTGATACTGG - Intronic
1171105103 20:22425911-22425933 CACTCTTTCATCCCTGGTGATGG - Intergenic
1171287989 20:23957981-23958003 ATATTGTTCAGCCCTGATGCTGG - Intergenic
1172167900 20:32910044-32910066 AACTCTTACAGCCTTGATGGTGG + Intronic
1173216981 20:41094254-41094276 AGTTCTTTCAGCCCTCACGCTGG + Intronic
1174542226 20:51298570-51298592 ATCTCTCTCCGCCCTGGTGCTGG - Intergenic
1176621765 21:9066079-9066101 AAGTATTTCATCTCTGATGCCGG - Intergenic
1177115743 21:17083737-17083759 AACTCCTTCATCCCTGAGGAAGG - Intergenic
1178364527 21:31978071-31978093 AACACTTGCAGCCTGGATGCTGG - Intronic
1183643974 22:39111712-39111734 AATTCTTTCAGCCCTGAGGAAGG - Intergenic
1183752160 22:39727708-39727730 CACTCCTTCAGCCCGGATCCCGG + Intergenic
950201758 3:11049521-11049543 AACTCCTTTAGCTCTTATGCAGG - Intergenic
950880815 3:16321421-16321443 AGCTCTTGCAGCCCGGATGTTGG - Intronic
951170069 3:19531544-19531566 AACTATTTCTGCCCTACTGCTGG - Intronic
955760807 3:62280104-62280126 AAGTCTTTCAGCCTTGAATCAGG - Intronic
957251762 3:77780593-77780615 AAATCTTTCAACCTTGAAGCTGG - Intergenic
958164608 3:89863381-89863403 AAATCTTTTAGCTCTGATCCAGG + Intergenic
962927539 3:140008647-140008669 AACTCTGGAAGCCCTGATGGAGG - Intronic
963161557 3:142155975-142155997 AAGTCTTTAATCCCTGAGGCAGG + Intergenic
963524878 3:146405101-146405123 AATTCTCTCAGCCCTGAAGAAGG + Intronic
963602141 3:147387967-147387989 AAATCTTTCACTCCTGATCCTGG + Exonic
964214099 3:154259865-154259887 AAGTCCTTCAGTCCTGATGGGGG + Intergenic
969919854 4:10527489-10527511 AACTCTTTGGGCTGTGATGCAGG + Intronic
970303705 4:14708156-14708178 AACTCAGTCATCTCTGATGCTGG + Intergenic
971808533 4:31393582-31393604 AACTCTTTCATACCAGAAGCAGG + Intergenic
975703892 4:77092739-77092761 AGCTATTTCAACCTTGATGCTGG + Intergenic
981825656 4:148938040-148938062 AACTGATTCAGCCCTTATGAAGG - Intergenic
981923827 4:150116631-150116653 ACCTCTATCAGCGCTGGTGCTGG - Intronic
987871327 5:23621631-23621653 AAGTCATTCGGCCCTGATGGGGG + Intergenic
988127167 5:27055249-27055271 AACTCATTCACCCCTGAGGGAGG - Intronic
991674293 5:69076025-69076047 CTCTCTTCCAGCCCTGAGGCTGG - Intergenic
992002449 5:72449229-72449251 AAACCTTTCAGCCATGATGGTGG - Intronic
993500595 5:88661578-88661600 AACTCTCGCAGCCCTGATTGAGG + Intergenic
995644971 5:114301467-114301489 ATCTATTTCTGCCCTAATGCTGG + Intergenic
996871495 5:128198298-128198320 AACTCTTTCATACCAGAAGCAGG + Intergenic
998341286 5:141420008-141420030 CAGTCTTTCAGCCCTACTGCAGG + Exonic
999871509 5:155756384-155756406 AAATCTTTCTGCCTTGTTGCTGG + Intergenic
1001541228 5:172541156-172541178 AACTCACTCGGCCCTGGTGCGGG - Intergenic
1001649414 5:173304802-173304824 TACTCTTTCAGCCCTGCAGAAGG + Intergenic
1003159687 6:3624490-3624512 AACACTTTCAGCTCTCATGAGGG - Intergenic
1003886336 6:10524500-10524522 TACTATTTAAGCCCTGTTGCTGG + Intronic
1006431149 6:33996867-33996889 AACTTTTCCATCCATGATGCTGG + Intergenic
1007304974 6:40896761-40896783 AAATCTCTAAGCCCTGATGTGGG - Intergenic
1007314067 6:40970371-40970393 AAATCTTTCAGCCCAGAGGCAGG - Intergenic
1009919602 6:70041049-70041071 AACACTTTCAGCCCAGAAGGTGG + Intronic
1011791914 6:90907703-90907725 CACTCCTTCAGCCCTCAAGCTGG + Intergenic
1012100865 6:95084287-95084309 ACCTCATTCCCCCCTGATGCGGG + Intergenic
1013603331 6:111725621-111725643 AACACTTTCAGCACTGATGCTGG + Intronic
1015143365 6:129959289-129959311 ACCTCATTCTTCCCTGATGCAGG + Intergenic
1017969651 6:159300970-159300992 AACTCTCTCGGCACTGATGTTGG + Intergenic
1018127274 6:160693559-160693581 ATCTCTTTCTGCCCTCATGTTGG + Intergenic
1019695626 7:2444570-2444592 GGCTCTTTCAGCCTTGGTGCTGG - Intergenic
1019753716 7:2751659-2751681 AACTTTTTCATTCCTGATACTGG - Intronic
1025967074 7:66283385-66283407 AACTTTGTCAACCCTGATGTAGG - Intronic
1026118314 7:67514930-67514952 AACTTTTTCAAACCTGAAGCAGG - Intergenic
1026281127 7:68922558-68922580 GACTCTGTCAGCCTTGCTGCAGG - Intergenic
1027954787 7:84864323-84864345 ACCTCTTTCACCAATGATGCTGG + Intergenic
1030359754 7:108582512-108582534 GTCTCTCACAGCCCTGATGCTGG + Intergenic
1032536058 7:132665357-132665379 AAGTCTTTCATCTCTGATCCAGG + Intronic
1032728866 7:134617813-134617835 AACTCTTGGAGACCTGAAGCTGG + Intergenic
1034123699 7:148651971-148651993 AATTCTCTCAGCCCTGAAGAAGG + Intergenic
1034220988 7:149446018-149446040 AAGTTTTTCAGCCCTGAAGCAGG - Intronic
1035968603 8:4222736-4222758 CACTCTTTCTGCCCAGATGGAGG + Intronic
1038051124 8:23812767-23812789 AACTCTTTCACACCTGATATTGG - Intergenic
1039813286 8:41069066-41069088 AAAACTTTCAGCCATGAGGCTGG - Intergenic
1041876302 8:62691214-62691236 AGTGCTTTCAGCCCTGAAGCAGG + Intronic
1048957717 8:139550525-139550547 TACTGTTTCAGCCCAGATCCTGG + Intergenic
1053203587 9:36168752-36168774 AACTCCTTCATCCCTGCTCCAGG + Intergenic
1053308734 9:37002143-37002165 AAGGCCTTCAGCCCTGATGATGG - Intronic
1058583157 9:106480541-106480563 AAAGCTTTCAGCCCTGTTCCTGG - Intergenic
1061774145 9:132949378-132949400 AAGGTTTTCAGCCCTGATCCAGG - Intronic
1185663430 X:1745117-1745139 AACTCACTCAGCCCTGAGGGAGG - Intergenic
1189293556 X:39902841-39902863 AACCCATTCTTCCCTGATGCTGG - Intergenic
1190404908 X:50077470-50077492 AAATCTTTCAGCTCTGCTCCCGG + Intronic
1191890964 X:65940118-65940140 AACTCTTTCAGGCTAGATGTGGG - Intergenic
1194174141 X:90626153-90626175 TACTCATTCAGCACTAATGCAGG + Intergenic
1196687046 X:118519951-118519973 AACTCCTTCAGACCTGAAGAAGG + Intronic
1198499031 X:137224208-137224230 AAATCTGTCAGCCTTGATCCTGG + Intergenic
1200162914 X:154018489-154018511 AACTCCTTCAGCCCTCATTCTGG - Intronic
1201912385 Y:19146036-19146058 AATTCTCTCAGCCCTGAGGAAGG + Intergenic