ID: 1097814218

View in Genome Browser
Species Human (GRCh38)
Location 12:64054558-64054580
Sequence AACTCCTATTAGGAAGATTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097814211_1097814218 15 Left 1097814211 12:64054520-64054542 CCTGTCCCATTGTAGTACTGTAT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG 0: 1
1: 0
2: 1
3: 7
4: 150
1097814212_1097814218 10 Left 1097814212 12:64054525-64054547 CCCATTGTAGTACTGTATTCCCC 0: 1
1: 0
2: 0
3: 4
4: 105
Right 1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG 0: 1
1: 0
2: 1
3: 7
4: 150
1097814214_1097814218 -9 Left 1097814214 12:64054544-64054566 CCCCATTAGACATGAACTCCTAT 0: 1
1: 0
2: 0
3: 13
4: 186
Right 1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG 0: 1
1: 0
2: 1
3: 7
4: 150
1097814215_1097814218 -10 Left 1097814215 12:64054545-64054567 CCCATTAGACATGAACTCCTATT 0: 1
1: 0
2: 0
3: 26
4: 243
Right 1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG 0: 1
1: 0
2: 1
3: 7
4: 150
1097814210_1097814218 24 Left 1097814210 12:64054511-64054533 CCATGGAAACCTGTCCCATTGTA 0: 1
1: 0
2: 0
3: 14
4: 167
Right 1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG 0: 1
1: 0
2: 1
3: 7
4: 150
1097814213_1097814218 9 Left 1097814213 12:64054526-64054548 CCATTGTAGTACTGTATTCCCCA 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG 0: 1
1: 0
2: 1
3: 7
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097814218 Original CRISPR AACTCCTATTAGGAAGATTA TGG Intronic
903660556 1:24974864-24974886 ATCTCCTATTAAGAAGGTCATGG + Intergenic
908469099 1:64424642-64424664 AACTCCTATTAGGCATATGTTGG - Intergenic
910786517 1:91004085-91004107 AACTCCTATTAGGTATACAATGG - Intronic
912202834 1:107477651-107477673 AATTACTTTTGGGAAGATTAAGG - Intronic
916220954 1:162444780-162444802 ACCTCATATTAGGGAGATTGGGG + Intergenic
919034688 1:192291672-192291694 AACTTCTTGTAGGAAGATGATGG + Intergenic
919310471 1:195900495-195900517 AAATCCTATAAGCAATATTAAGG + Intergenic
921975714 1:221200757-221200779 ATCTCCTAATGGGAAGGTTAAGG - Intergenic
923915847 1:238503771-238503793 AAATCCTTTTTGGAAGAATACGG + Intergenic
924390346 1:243548761-243548783 AACTCCGCATAGGAAGATAAAGG + Intronic
1064596520 10:16951061-16951083 AGATCCTATTCTGAAGATTAGGG - Intronic
1064707692 10:18090204-18090226 AACTCCAATTAGCAAGAGCAAGG + Intergenic
1065777558 10:29135081-29135103 AAATCCCTTTAGGAAGAGTATGG - Intergenic
1068328399 10:55527449-55527471 AACTCCATTTATGTAGATTAGGG + Intronic
1068896879 10:62213626-62213648 AACTCCTATTAATAAAAATAGGG - Intronic
1070502543 10:77085070-77085092 AACTCCTGATAGGAAGAATTAGG - Intronic
1073140795 10:101246247-101246269 AACTTCTATTTGGGAGATTGAGG - Intergenic
1073568504 10:104556188-104556210 AACTCCTGTTATGAAGGTGAGGG + Intergenic
1074359425 10:112813187-112813209 AAGCCCAATTAGGAAGGTTAGGG + Intronic
1077950022 11:6946695-6946717 AACTGCTAAAAGGAAGAGTAAGG - Intronic
1089715137 11:120352333-120352355 AAGTCCTTTTAAGAAGTTTAAGG + Intronic
1091527180 12:1314754-1314776 ACCTTATATTAGGAAGATAATGG + Intronic
1094125749 12:27021025-27021047 AAGACCTATTAGGAAGATAATGG + Intergenic
1094217243 12:27956353-27956375 AAGTCCTATTTTGAAGACTATGG + Intergenic
1095390380 12:41698963-41698985 AACACCTGTTATGAGGATTATGG + Intergenic
1097400354 12:59120964-59120986 AATTACTATTAGGAGGATCAAGG + Intergenic
1097814218 12:64054558-64054580 AACTCCTATTAGGAAGATTATGG + Intronic
1098235439 12:68413874-68413896 ATCAGCTATTAGGAAGATTTAGG - Intergenic
1100366479 12:93925770-93925792 AACTCCTATTAGTCAGATGTTGG + Intergenic
1101989231 12:109470788-109470810 AACTCCTATTAGCCAGGATAGGG - Intronic
1106552703 13:30785780-30785802 AACTCCTATTATGAATAAAATGG + Intergenic
1108745173 13:53386125-53386147 ACCTCCTGTTAGGAACATTGTGG + Intergenic
1109598091 13:64583947-64583969 AAAATCTATTAGGAAGTTTATGG - Intergenic
1110162125 13:72390974-72390996 AACTTCTGCTAGGTAGATTAAGG + Intergenic
1110341537 13:74397493-74397515 AAGTCCTAGTAGGAAAATTCAGG - Intergenic
1110958256 13:81584587-81584609 AGCTCCTATTTAGAAGTTTAGGG + Intergenic
1111717691 13:91900416-91900438 AACTCCTCTCAGTAAGATCAAGG - Intronic
1111755487 13:92389648-92389670 AACTACTAGTAGGGAGACTATGG + Intronic
1113261943 13:108574596-108574618 AAATCGTATTAGAAAGATTGAGG - Intergenic
1113831974 13:113302891-113302913 AACTCTTCATAGGGAGATTAAGG - Intronic
1116777093 14:49193622-49193644 AAATCCTATTAGGGAGATTCTGG - Intergenic
1117702675 14:58429633-58429655 AATACCTATTAGTAAGATAATGG + Intronic
1118022710 14:61735291-61735313 CACTCCTCTTAGGAAGACTTTGG + Intronic
1120607954 14:86603220-86603242 AAGGCCTATTAGGAAGATACAGG + Intergenic
1120734072 14:88034002-88034024 AACTTGTATTAGGAATATTTGGG - Intergenic
1121479108 14:94246969-94246991 AACTTATAGTAGGAAGCTTAAGG - Intronic
1122304812 14:100757238-100757260 AACTCTTATTAGGCACATAAAGG - Intergenic
1124406438 15:29396707-29396729 AACTCTTAGAAGGAAGCTTAGGG - Intronic
1125244957 15:37625106-37625128 GATTCCTATTAGAAAGATGATGG - Intergenic
1125314779 15:38419290-38419312 AACACCTATTAAAAAGATTCAGG - Intergenic
1135389737 16:22080717-22080739 AAATCCTATTGGAAATATTAGGG - Exonic
1136027804 16:27481222-27481244 ACCTCCCTTTAGGAAGAGTAAGG - Intronic
1136664245 16:31794145-31794167 AACTCCTCCTAGGAAGAAAATGG + Intronic
1137566883 16:49538781-49538803 AACTCCTTTTTGGAAAATTGTGG - Intronic
1138051063 16:53778959-53778981 ACCTCCTATTTGGGACATTAAGG + Intronic
1138938018 16:61754297-61754319 AACACCTATTAGAAATATCAAGG - Intronic
1139106527 16:63833584-63833606 ATATCCTATTAGGAAGATGGGGG + Intergenic
1140504373 16:75461573-75461595 AACTCCTGTTAAGCAGATTTTGG + Intronic
1140674487 16:77314167-77314189 ATCTCCAGTTAGGAAGATGATGG + Intronic
1140762946 16:78128097-78128119 GACTCCTAAAGGGAAGATTAGGG + Intronic
1143694041 17:8597222-8597244 AACTTCTATCAGGAAGATATGGG + Intronic
1146291528 17:31610947-31610969 AACTCCTATTAAGGAGAATGTGG + Intergenic
1148637926 17:49163453-49163475 AACTCCTAATATTAAGATGAAGG + Intronic
1152213655 17:79019402-79019424 AACTCCTAGAAGAAAGATTAGGG + Intergenic
1155638746 18:27986720-27986742 AACTTCTATGAGGAATATGATGG + Intronic
1155775332 18:29754080-29754102 TACTCCTATCAGAAAGATTTTGG - Intergenic
1156550501 18:38011485-38011507 AACTCATTTTAAGAAGATTATGG + Intergenic
1156948158 18:42860583-42860605 ATCTCCAATTAGGAAGAGGATGG + Intronic
1160128033 18:76196864-76196886 AACTCTTATAAGTAATATTATGG + Intergenic
1161833930 19:6631917-6631939 AACTCTTATTAAGAAAATCATGG - Intergenic
1164809123 19:31142143-31142165 CACTCATATTAGGAAGTTGAGGG - Intergenic
1166109780 19:40614785-40614807 AACTTCTGTTAGGAAGAGAAGGG - Intronic
925837104 2:7956793-7956815 AACTGCTTTTAGGAAGTTGATGG + Intergenic
927330385 2:21855631-21855653 ACCTCCTGTCAGGAAGTTTAGGG - Intergenic
930957742 2:57224215-57224237 AACTCTTAATAGCAAGATAATGG + Intergenic
931648813 2:64450419-64450441 CACTCCCATTTGGAGGATTAAGG - Intergenic
932929700 2:76019849-76019871 AAGTCCTCTTAGGTTGATTAAGG + Intergenic
936809027 2:116373415-116373437 AAGTCCTATTACAAAGAATAAGG + Intergenic
938919719 2:135984686-135984708 AACTCCTTATAGAAAAATTAGGG + Intronic
941214356 2:162687082-162687104 AATTCCCATTAGGAAAAATACGG + Intronic
943042779 2:182823120-182823142 AAGTTCTATTAGGAATATTTAGG - Intergenic
943567757 2:189536292-189536314 GACTCCTATAGGGAAGATAATGG - Intergenic
1169232215 20:3898086-3898108 AATTCCAATTAGTAAGATGAAGG - Intronic
1171122952 20:22581839-22581861 AACTCCTCTTAAGAAGACGACGG - Exonic
1172516098 20:35534777-35534799 AACTCCTATTAGGCAAATGTTGG + Intergenic
1172842973 20:37913205-37913227 CACTCCTCTTAAGAAGCTTATGG + Intronic
1177171067 21:17656669-17656691 AACTCCTTTCTGGAAGATTTAGG + Intergenic
1180196089 21:46195129-46195151 AACCCTGAGTAGGAAGATTAGGG - Intronic
1182862444 22:33571702-33571724 AACTCCTCCTACCAAGATTAAGG + Intronic
951311557 3:21132595-21132617 TATACCTATTAGGAAGAATAGGG + Intergenic
951388364 3:22070948-22070970 AACCAATATTAGGAAGAATACGG + Intronic
952082019 3:29770765-29770787 GAGTCCTATTAGGAAGCTGAGGG + Intronic
952706566 3:36383244-36383266 ATCTTCTATTGTGAAGATTAAGG - Intronic
952803618 3:37322945-37322967 AACTTCTGGTAGGAAGATTGGGG - Intronic
953429750 3:42829484-42829506 ATCTCCTGGTAGGAACATTAGGG - Intronic
955010712 3:55011899-55011921 CACTCCTATTAGTAAAATTGTGG - Intronic
960701486 3:120443384-120443406 AGCTACTATTAGGAAGAGTGTGG - Intronic
961051881 3:123753702-123753724 AACTCATCTTTGGAGGATTAGGG + Intronic
961588311 3:127954328-127954350 GACTCCTATTAGTAAAATTTGGG + Intronic
966262508 3:177996368-177996390 AACTCCTATTAGATACATTTTGG + Intergenic
970989609 4:22197181-22197203 AACCACTACTAGGAAAATTAAGG + Intergenic
972249936 4:37288848-37288870 AAATCCTTTTAGGAACATAATGG + Intronic
974106800 4:57478717-57478739 ATCTCCTGTTTTGAAGATTAAGG - Intergenic
975926466 4:79460733-79460755 CACTCCTATTAGAAAGAAAACGG - Intergenic
975971806 4:80048555-80048577 AACTTCTATTTGTAAAATTACGG - Intronic
976853316 4:89574690-89574712 AACTCCTATTTGCAATAGTATGG - Intergenic
977309819 4:95372117-95372139 AATTCCTCTTAGGAAGCTCAAGG - Intronic
979144752 4:117230502-117230524 AACTCTGCTTAGGAAGCTTAAGG + Intergenic
979815363 4:125095711-125095733 AACTCATCTAAGGAAGAATATGG - Intergenic
980228853 4:130021970-130021992 ACATCTTCTTAGGAAGATTAAGG - Intergenic
982547493 4:156753043-156753065 ACTTCATACTAGGAAGATTATGG - Intergenic
983661992 4:170137818-170137840 AATTCCTCTTTGGAAAATTAGGG + Intergenic
984122863 4:175768071-175768093 AACTTCTATTAAGAACAATATGG + Intronic
985929616 5:3046960-3046982 AACTCACATTAGGAAGAGAAGGG + Intergenic
987283280 5:16432187-16432209 AACTCCTATTAGGAAGAGAAAGG - Intergenic
987437161 5:17908739-17908761 GACTCCAATTAGGAATATCAAGG + Intergenic
987515032 5:18894831-18894853 GACTCATATTAGGAAGTATAGGG - Intergenic
987587498 5:19875102-19875124 ATCTACTATTAAGAGGATTATGG - Intronic
989413973 5:41152190-41152212 GACTCCAACTGGGAAGATTAGGG + Intronic
990108181 5:52290340-52290362 AACTCCTATTGGTCAGATTTTGG + Intergenic
991545410 5:67776492-67776514 AACTACTATTAAGAAGATTTTGG - Intergenic
992777549 5:80101886-80101908 GACTCCTATTAGGTAGATATTGG - Intergenic
996634338 5:125671963-125671985 CTCCCTTATTAGGAAGATTAAGG - Intergenic
997121872 5:131182806-131182828 AACTTCTACTAGGAGTATTAGGG - Intronic
999920553 5:156314854-156314876 AATTCATATTAGTAAGACTACGG + Intronic
1004944670 6:20597715-20597737 AACTACTATTAATAAAATTATGG - Intronic
1009683690 6:66929094-66929116 AACTGCTATTAGGAGGTTTCGGG - Intergenic
1013470147 6:110456860-110456882 AACTCCAATTAGAGTGATTATGG + Exonic
1014667118 6:124252966-124252988 AACTACAATTAGGAAGACAAAGG - Intronic
1014896693 6:126909616-126909638 AACTCTTATTCGGTAAATTATGG - Intergenic
1015029390 6:128575889-128575911 AACTCTTATTAGCAAGATCTTGG + Intergenic
1015200367 6:130572957-130572979 ATCTCCTATTAGAAAAAGTACGG + Intergenic
1017597585 6:156045661-156045683 AAATCCTATTTGGAGGATCATGG - Intergenic
1018354356 6:162996752-162996774 AACTCTTGTTAGTAACATTATGG + Intronic
1018683691 6:166285123-166285145 GACAGCTATTAGGAACATTATGG + Intergenic
1022838153 7:34136441-34136463 AACTCAGATTAGGGAAATTAGGG + Intronic
1030342447 7:108395597-108395619 AACTCCTATTGGGAAGTGGAAGG - Intronic
1030700625 7:112635500-112635522 AAATCATATTAGGTAAATTAGGG + Intergenic
1030887194 7:114952688-114952710 AACTCCGATTAGAAAATTTAAGG + Intronic
1031290921 7:119932532-119932554 CATTCCTATTGGGAAGATAAAGG + Intergenic
1031624370 7:123975175-123975197 CACTACTCTCAGGAAGATTAGGG + Intergenic
1033552792 7:142463019-142463041 CCCTCCTATTAGGAAAATCAAGG + Intergenic
1039235749 8:35500896-35500918 AACCCCTATTAGAAAGGTTTTGG - Intronic
1043262068 8:78214049-78214071 AATTGCTCTTAGGAAGATCATGG + Intergenic
1046100578 8:109609794-109609816 AAATCTCATTAGGAAAATTAGGG + Intronic
1046842582 8:118876271-118876293 AACTCCTTATATGAAGATTAGGG - Intergenic
1050194671 9:3068954-3068976 AAGTCCCATTAGGAATATTGAGG + Intergenic
1052757815 9:32558635-32558657 AACTCCCTTTAGGAAAATCAAGG + Intronic
1053108611 9:35437210-35437232 AAATCCTCTTAGGACAATTAAGG + Intergenic
1055101121 9:72466818-72466840 AACCCCAATTATGAACATTATGG + Intergenic
1057229613 9:93312305-93312327 AACTCTTAGTAGGAAACTTAAGG - Intronic
1058138212 9:101330673-101330695 AACTCCTATTAAGAGGATTTTGG - Intergenic
1058213536 9:102203369-102203391 AACCCCCTTTAGGAAGATAAAGG - Intergenic
1059704181 9:116804673-116804695 CACTACTATTAGTAAGATGATGG + Intronic
1060064269 9:120489460-120489482 AACTCCTATTAGTCATATTTTGG + Intronic
1061080264 9:128365564-128365586 AAATACTATTTGAAAGATTATGG + Intergenic
1189095524 X:38134628-38134650 AGCTCCTCTCAGGAAGAATATGG + Intronic
1194050170 X:89058385-89058407 ATCTACTTTTAGGAAGATAAGGG - Intergenic
1201145881 Y:11065395-11065417 AACTGCTTTCAGGAAGTTTATGG - Intergenic