ID: 1097823340

View in Genome Browser
Species Human (GRCh38)
Location 12:64149645-64149667
Sequence CTAAGATTCTTACAGGGTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097823340_1097823348 24 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823348 12:64149692-64149714 GGCTTCTGCCTTGAGTAGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 211
1097823340_1097823346 3 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823346 12:64149671-64149693 GGCAGAGCAAGGGTGTTTGCTGG 0: 1
1: 0
2: 2
3: 16
4: 226
1097823340_1097823344 -8 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823344 12:64149660-64149682 AATCTTAGAAAGGCAGAGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 357
1097823340_1097823345 -7 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823345 12:64149661-64149683 ATCTTAGAAAGGCAGAGCAAGGG 0: 1
1: 0
2: 1
3: 35
4: 274
1097823340_1097823347 23 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823347 12:64149691-64149713 TGGCTTCTGCCTTGAGTAGTTGG 0: 1
1: 0
2: 0
3: 21
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097823340 Original CRISPR CTAAGATTCTTACAGGGTGC AGG (reversed) Exonic
908176001 1:61555649-61555671 CTAAGATTCTTACACAGCACAGG + Intergenic
911289214 1:96035969-96035991 CTATGATTCTTACAGTATGAAGG + Intergenic
911510056 1:98800456-98800478 CTAGGATTCTTACAGTTTGATGG + Intergenic
912969680 1:114269082-114269104 CCAAGTTTCTCCCAGGGTGCAGG - Intergenic
913552395 1:119928363-119928385 CTTAGATACTTAAAGGGGGCAGG - Intronic
917283107 1:173397826-173397848 CTAAGATACTTCAAGGATGCAGG + Intergenic
921079726 1:211729415-211729437 TTCAGTTTCTTACAGGCTGCTGG + Intergenic
924008231 1:239635809-239635831 CTAAGCCTCTTGCAGGGGGCAGG - Intronic
1063334449 10:5198504-5198526 CCAAGATTTTAACTGGGTGCTGG - Intronic
1068366163 10:56052832-56052854 CTAAGATTATTTAAGGGTTCAGG + Intergenic
1068913693 10:62406002-62406024 CCAAGATTCTTAAAGGGTAAGGG + Intronic
1070471408 10:76783858-76783880 CTCAGATTCTTGCTGGCTGCTGG - Intergenic
1072990410 10:100186947-100186969 ATTAGATTCTCACAGGGAGCCGG + Exonic
1077945951 11:6898845-6898867 GTAAGATTATTAGAGGGTGGGGG - Intergenic
1079480902 11:20878903-20878925 TTAAGGTGCTTACAGTGTGCTGG + Intronic
1081548371 11:44089161-44089183 CTAAGATTATTTAAGGGTTCAGG - Intergenic
1082658353 11:55878621-55878643 CTATGTTTTTTACAGGGTTCTGG + Intergenic
1085123956 11:73984824-73984846 CTTAAATTCTTTCAGGGTGGGGG + Intergenic
1085764116 11:79267808-79267830 CTATGATTCTTACAGAGCCCAGG + Intronic
1086098126 11:83071053-83071075 CGAAGGTTCTTTCAGGCTGCTGG - Intronic
1091842111 12:3628643-3628665 CAAACATTCTTACAGGATGCAGG - Intronic
1095309066 12:40674512-40674534 CTAAAATTTTTACAGAGTGGAGG + Intergenic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1099537466 12:83862278-83862300 CTAAGTTTCTTACAAGGTATAGG - Intergenic
1101022920 12:100572255-100572277 CTAAGAGTCTTGAAGGGTGATGG - Intergenic
1102854897 12:116285279-116285301 CTAAGTTTCTTACACATTGCAGG + Intergenic
1106039053 13:26072403-26072425 CATAGATTCTTACACAGTGCAGG + Intergenic
1108552311 13:51558884-51558906 CTAAAAGTCTTTGAGGGTGCAGG - Intergenic
1108566378 13:51702484-51702506 ATAAGCTTCTTAAAGGGGGCTGG + Intronic
1110331738 13:74280704-74280726 CTATGATTTTCACAGGGTGGTGG - Intergenic
1110974777 13:81817164-81817186 CTAAGATTTTTACAGTTTGAGGG - Intergenic
1112617877 13:101023993-101024015 CTAAGATTCTTTCAGAGGGCAGG + Intergenic
1113360390 13:109625567-109625589 GTAAGATTCTTAGAAGCTGCTGG + Intergenic
1118983798 14:70736160-70736182 TTAAGATTCTTTCATGGTGTGGG - Intronic
1129940736 15:79494840-79494862 CGAAGATTGTGTCAGGGTGCAGG + Intergenic
1132267055 15:100483486-100483508 CTAAAATTCTTCCAGAGTTCAGG - Intronic
1133545273 16:6800273-6800295 CTAAGGTGTTTCCAGGGTGCTGG - Intronic
1138499039 16:57427228-57427250 CTCAGGATCTTACAAGGTGCCGG + Intergenic
1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG + Intronic
1148678137 17:49456969-49456991 CTTACATGCTTACAGGGTGGAGG - Intronic
1148986952 17:51631061-51631083 CTAGGATCCTTTGAGGGTGCTGG - Exonic
1151636767 17:75354531-75354553 ATTAGATTCTTACAAGGAGCGGG - Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1153108274 18:1553024-1553046 CTAAAATTCTTACACTGTGTAGG + Intergenic
1153477878 18:5517210-5517232 CTGAGAGTCTGACAGGGTGAGGG + Intronic
1154961204 18:21310629-21310651 CTGAGATCCTTTCAGGGTGTCGG - Intronic
1156105390 18:33653296-33653318 CTAAGAATCTTGCAGGGGGCAGG + Intronic
1156552221 18:38029574-38029596 CCAAGATTATTACAAGGTACTGG + Intergenic
1161887737 19:7010058-7010080 TTCAGATTCTTACAGGGGACTGG - Intergenic
1162959994 19:14119937-14119959 CTAAGAATCTTCCTGGGAGCAGG + Exonic
1164770768 19:30807094-30807116 CTATGCTTCTTACAGGATGGAGG - Intergenic
1168255020 19:55160392-55160414 AGAATATTCTCACAGGGTGCTGG - Intronic
940073102 2:149711432-149711454 TGAAGATTCTCACAGGGTTCTGG - Intergenic
942486731 2:176447614-176447636 CTTACATGCTTACAAGGTGCAGG - Intergenic
942962512 2:181849003-181849025 TTAAGATGCTTGCAGGGTGGAGG + Intergenic
948705582 2:239790273-239790295 ATAAGATGCTGGCAGGGTGCTGG - Intronic
1173471045 20:43323903-43323925 CCAGGCTTCATACAGGGTGCTGG + Intergenic
1175004022 20:55663234-55663256 ATAATATTCTTAGAGCGTGCTGG - Intergenic
1176661541 21:9639911-9639933 CTAACATTTTTGCAGGCTGCTGG - Intergenic
1179000321 21:37451820-37451842 CTCAGAATCTTACAGGGAACTGG - Intronic
952127974 3:30324432-30324454 CTAAGATTCTCAGAGGTAGCAGG + Intergenic
953098694 3:39805027-39805049 ATAACAATCTTACAGGGTGGTGG + Intergenic
953285157 3:41599411-41599433 CTAAGATACTCACAGGTTTCAGG + Intronic
953674559 3:44990689-44990711 CCAAGATTTTTACTGGGAGCTGG + Intronic
954956046 3:54518990-54519012 CTAAGAACCTCACAGGGTGTGGG + Intronic
957401996 3:79727735-79727757 CTGAGATTTTAAAAGGGTGCAGG - Intronic
967648119 3:191951664-191951686 TTAAAATTCTTAAAGGGTGAGGG - Intergenic
969957045 4:10901610-10901632 AAAAGATTCTTACAGGCAGCAGG + Intergenic
971599351 4:28572417-28572439 CTTAGATTCTTCCAGGGAGCAGG - Intergenic
973121938 4:46531952-46531974 CTCTGATTCTTAGTGGGTGCTGG - Intergenic
974304619 4:60117638-60117660 CTGAAATTCTTACAAGGTGATGG - Intergenic
981942862 4:150303874-150303896 CAAAGATTCTTAAAGGGTGAGGG - Intronic
985413854 4:189716636-189716658 CTAACATTTTTGCAGGCTGCTGG + Intergenic
986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG + Intronic
988962221 5:36381648-36381670 TTATGTTTCTTACAGGCTGCTGG + Intergenic
994728311 5:103462407-103462429 CTAAGATTCTTGCAAGAGGCTGG - Intergenic
995392924 5:111659427-111659449 CTAAGTTTCTTACAGGTTATTGG - Intergenic
999138853 5:149343624-149343646 CTAAGAAACTAAAAGGGTGCTGG + Intergenic
999501434 5:152150480-152150502 CTCAAATGCTTACAGGGTCCAGG - Intergenic
1000141761 5:158411658-158411680 TTCCTATTCTTACAGGGTGCCGG + Intergenic
1000267877 5:159655625-159655647 CTAAGAGTTTTACTGAGTGCGGG + Intergenic
1006016714 6:31087081-31087103 CTAAGATCCTGATAGGGAGCAGG + Intergenic
1008027480 6:46653934-46653956 CTGACCTTCTTACAGGCTGCTGG + Intronic
1008755102 6:54785567-54785589 TAAAAATTCTTACTGGGTGCCGG - Intergenic
1010700150 6:79034892-79034914 CTAATATTCTTTGAGTGTGCGGG + Intronic
1010799807 6:80162358-80162380 CTTACATTCTTTCAGAGTGCAGG - Intronic
1018993621 6:168693394-168693416 CTAAGATCCTTAAAGGGATCTGG + Intergenic
1018993726 6:168694637-168694659 CTAAGATCCTTAAAGGGATCTGG - Intergenic
1023282671 7:38587560-38587582 CTAAGATATTCACAGGGGGCTGG + Intronic
1025974573 7:66359486-66359508 CTAAGGTTCTTAAAGTGTCCAGG - Intronic
1037486805 8:19355727-19355749 CTAAGACACTAACATGGTGCCGG + Intronic
1040433727 8:47369138-47369160 CTAAGATTCTCACATTGTGCAGG + Intronic
1043963104 8:86440524-86440546 ATAAGGTTCTTACAAGGGGCTGG - Intronic
1045933957 8:107657632-107657654 CTGATATTCCTACTGGGTGCAGG - Intergenic
1046384771 8:113495082-113495104 CTAGGATTCTTCCAAGGTGAAGG + Intergenic
1046728209 8:117697099-117697121 ATAAGTTTTTTACAGAGTGCTGG - Intergenic
1050057044 9:1666571-1666593 ATTAGATTCTCACAGGGAGCAGG - Intergenic
1051700816 9:19821728-19821750 CTAACTTTCTTACAAGGGGCAGG + Intergenic
1052695503 9:31872176-31872198 CTGACATTATTACAGGGTTCTGG + Intergenic
1056874847 9:90318408-90318430 CTAAGGTCCTTACTGGCTGCTGG + Intergenic
1058454801 9:105129124-105129146 CTGGGATTCTTGCAGAGTGCAGG - Intergenic
1059071494 9:111142048-111142070 CCAAGATTTTTACTGGGGGCTGG + Intergenic
1059502407 9:114766505-114766527 CTAAGACTCTGACAGGGGACAGG + Intergenic
1061258163 9:129464879-129464901 CTAAGATTCCCACAGGGACCAGG + Intergenic
1203639104 Un_KI270750v1:141754-141776 CTAACATTTTTGCAGGCTGCTGG - Intergenic
1193742895 X:85240323-85240345 ATAAAATTATTACAGGGTTCAGG + Intergenic
1194789773 X:98132735-98132757 AGAAGATGCTTACAGGGTCCTGG - Intergenic
1195308867 X:103610571-103610593 TTAAGTGTCTGACAGGGTGCTGG - Intronic