ID: 1097823344

View in Genome Browser
Species Human (GRCh38)
Location 12:64149660-64149682
Sequence AATCTTAGAAAGGCAGAGCA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 357}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097823339_1097823344 6 Left 1097823339 12:64149631-64149653 CCACAGTTCATATGCCTGCACCC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1097823344 12:64149660-64149682 AATCTTAGAAAGGCAGAGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 357
1097823340_1097823344 -8 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823344 12:64149660-64149682 AATCTTAGAAAGGCAGAGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 357
1097823338_1097823344 7 Left 1097823338 12:64149630-64149652 CCCACAGTTCATATGCCTGCACC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1097823344 12:64149660-64149682 AATCTTAGAAAGGCAGAGCAAGG 0: 1
1: 0
2: 2
3: 27
4: 357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097823344 Original CRISPR AATCTTAGAAAGGCAGAGCA AGG Exonic
903615389 1:24650493-24650515 CATCTAAGAAAAGCAGAACAGGG - Intronic
903665492 1:25004803-25004825 AATTCAAGAAAGGCAAAGCAGGG - Intergenic
903840608 1:26236423-26236445 AAGCTTAGAAAGGGAGTGAATGG - Intronic
904917248 1:33979144-33979166 AACCTCAGAAAGACAGAGAAGGG - Intronic
906001652 1:42431506-42431528 AGTTTTAGACAGGGAGAGCAGGG + Intronic
906127423 1:43435806-43435828 ACTCTTAGGAAGACAGATCATGG - Intronic
907163192 1:52386713-52386735 AAACTTAGAAAGGCCAAGAAGGG + Intronic
908162249 1:61421809-61421831 AATCACAGAAAGGCAGAAAAGGG - Intronic
908504168 1:64778427-64778449 AGTGTCAGAAAGGCAGAGAATGG + Intronic
908928596 1:69288322-69288344 AATCTTAGAATTGCAGATCTGGG - Intergenic
909089446 1:71207148-71207170 AATATGAGAAAGGCAGTGAATGG - Intergenic
910205231 1:84743000-84743022 AATTTCAGAAAGGAAGACCAGGG + Intergenic
910501636 1:87898739-87898761 AATCTTAGTAATGCAGAGCTTGG + Intergenic
910655566 1:89614850-89614872 AATTTTTAAAAGGCGGAGCAGGG - Intergenic
910830053 1:91451929-91451951 TATTTTAGAGAGGCAAAGCATGG + Intergenic
910836404 1:91517353-91517375 AGGGTTAGAAAGGCAGAGCTTGG + Intronic
911004342 1:93202630-93202652 AAAGGTAGAAAGGCAGAGGAAGG + Intronic
913026221 1:114843857-114843879 ATTCTTAGAATGGAAGATCAAGG - Intergenic
913354898 1:117909078-117909100 AAACTTTGAAAGGAAGAGCGTGG - Intronic
913699790 1:121363061-121363083 AATCATAGAATGGCAGAGGTTGG + Intronic
914137751 1:144916975-144916997 AATCATAGAATGGCAGAGGTTGG - Intronic
914171433 1:145228471-145228493 TATCTGAGAAAGGCCCAGCACGG + Intergenic
915135874 1:153731117-153731139 AAGCTTCGAAAGGCAGACCTTGG - Intronic
915548599 1:156618487-156618509 AATTTTAAAAAGGCCGGGCACGG + Intergenic
915732285 1:158062209-158062231 AAACTCAGTCAGGCAGAGCAGGG + Intronic
917299536 1:173559282-173559304 TGTCTTGGAAAGGCAGGGCAGGG - Intronic
918318297 1:183341385-183341407 AATATGAGAAAGGCCAAGCATGG + Intronic
918634477 1:186758983-186759005 ACTTCTAGAAAGGCAGAGCCAGG - Intergenic
919059597 1:192614762-192614784 AAACTTCTAAAGGCAGAGAATGG - Intergenic
920487203 1:206381770-206381792 AATCATAGAATGGCAGAGGTTGG + Intronic
921607766 1:217175441-217175463 AAACTTTGAAAGCCAGAGTAAGG - Intergenic
921647706 1:217637412-217637434 GATCTTAGAAAGGCAGGTTAGGG - Intronic
922413517 1:225398071-225398093 AATGTAAAAAAGGCAGAGGAGGG - Intronic
922881156 1:228982077-228982099 AATTTTATAAAGGCTCAGCATGG + Intergenic
923756314 1:236794422-236794444 AATCTCTGTAAGGCTGAGCATGG - Intergenic
1062814708 10:491004-491026 AATCTTACAAAAGCAGGGAAAGG + Intronic
1063160733 10:3416288-3416310 AGTCTAAGTAAGGAAGAGCAGGG + Intergenic
1063161419 10:3421536-3421558 AAGCTTAGAAAGGAAAAGGAAGG - Intergenic
1063729276 10:8677336-8677358 AATTTCAGAAAGGGATAGCAGGG - Intergenic
1064261949 10:13793107-13793129 CATTTTAGAAAGTCAGAGAATGG - Intronic
1065139396 10:22705696-22705718 CATGTTAGAAATGCAGAGCTTGG - Intronic
1065254279 10:23849858-23849880 ACTCTTAGAAGGACAGAGGAAGG - Intronic
1066704627 10:38164604-38164626 TTTCCTAGAAAGGCAGGGCAGGG - Intergenic
1067994276 10:51253114-51253136 AATATTAGTATGGCAAAGCAGGG + Intronic
1069454294 10:68541554-68541576 AATCTTGGAGAGACAGAACAAGG - Intergenic
1071124337 10:82316818-82316840 AATTTCAGAAAAGCAGAGCTGGG + Intronic
1071295738 10:84217976-84217998 ATCCTTAGAGAAGCAGAGCATGG - Intronic
1071581944 10:86779890-86779912 AAACAAAGAAGGGCAGAGCATGG - Intronic
1072248069 10:93560563-93560585 AATCTTACAAAGGCAGTTTAAGG + Intergenic
1072327238 10:94310625-94310647 GCTTTCAGAAAGGCAGAGCAGGG + Intronic
1072860575 10:99000093-99000115 ATTTATAAAAAGGCAGAGCAGGG + Intronic
1073010172 10:100352874-100352896 TATCTTAGGGAGGCAGAGCTGGG + Intronic
1078302199 11:10143455-10143477 AATCAAAGAAAGGTACAGCAGGG + Intronic
1078738504 11:14044136-14044158 AATAAAAGAAAGGCAGAACATGG - Intronic
1079533479 11:21483090-21483112 AATGTTGGAAAGGCAGTGCCAGG - Intronic
1080997134 11:37618024-37618046 AGTCTTACAATGGCAGAGGAGGG - Intergenic
1082244013 11:49899725-49899747 AATAGTAGAAGGGCAGAGTACGG - Intergenic
1082672757 11:56055676-56055698 AATCTAAGAAAGTCATACCATGG - Intergenic
1083619874 11:64043576-64043598 AATCGTGGAAAGGGAAAGCATGG + Intronic
1085798197 11:79563157-79563179 GATGTTTGAAAGGCTGAGCAGGG - Intergenic
1086098157 11:83071369-83071391 AATCTGAGGAAGGCAGAGGTGGG - Intronic
1086856389 11:91871301-91871323 AGGCTTAGAAAGGCAAGGCAAGG + Intergenic
1087856528 11:103098207-103098229 ATTCTTAGAAAGGCAGTTAATGG + Intergenic
1089136413 11:116252848-116252870 ACCCTTAGGATGGCAGAGCAGGG - Intergenic
1089392398 11:118111150-118111172 AGAATTGGAAAGGCAGAGCATGG + Intronic
1089702250 11:120252506-120252528 ACTCTGAGAAGGGCAGAACAAGG - Intronic
1092521771 12:9282994-9283016 ATTTTTAAAAAGGCACAGCAAGG - Intergenic
1093735034 12:22611476-22611498 ACACTTTGAAAGGCTGAGCAAGG - Intergenic
1093962895 12:25294594-25294616 AAGCTTATACAGGCAGAGGAAGG + Intergenic
1094691743 12:32776159-32776181 AGTCAGAGAAAGGCAGAGAAAGG + Intergenic
1095584397 12:43835003-43835025 AAACTTATGAAGGCAGAGCTAGG - Intergenic
1095756484 12:45772428-45772450 AATTTTAAAAAGGCAGAGACTGG + Intronic
1096096621 12:48939776-48939798 AACCCTAGGAAGGCAGAGCATGG + Exonic
1096302607 12:50444643-50444665 AACTTTAGAAATGAAGAGCATGG - Intronic
1096336816 12:50763340-50763362 AATCTGAGTAAGGCCGGGCACGG + Intergenic
1096853350 12:54458121-54458143 AATGTTATAAAGGCTGAGAATGG - Intronic
1097458786 12:59834245-59834267 CATCTTATCATGGCAGAGCAAGG + Intergenic
1097464943 12:59910563-59910585 AATCTGAGAAATTCAGAGAAAGG + Intergenic
1097823344 12:64149660-64149682 AATCTTAGAAAGGCAGAGCAAGG + Exonic
1098348195 12:69528181-69528203 AATGTTTAAAAGGCAGAGGAGGG + Intronic
1098516971 12:71388326-71388348 TATCTGAGAGAGGCTGAGCATGG - Intronic
1098600648 12:72327833-72327855 AATCTTTGAAAGTCAAAGCTGGG - Intronic
1100106953 12:91187008-91187030 TGTCTTAGAAAGTCAGAGAAGGG + Intergenic
1100562920 12:95767239-95767261 AATAATTGAAAGGTAGAGCAGGG - Intronic
1101086779 12:101244213-101244235 ATTCCTAAATAGGCAGAGCATGG + Intergenic
1102329455 12:112016315-112016337 AATCACTGAAAGGCAAAGCATGG - Intronic
1102946050 12:116989255-116989277 AATCCTAGAGAGGGAGAGCTTGG - Intronic
1103252414 12:119511628-119511650 ATTCTTAGACAGGCTGGGCATGG + Intronic
1103774922 12:123360276-123360298 AACTTTAGAAAGGCAAAGCATGG + Intronic
1104464586 12:128980097-128980119 CATCTCAGCAAAGCAGAGCAGGG - Intronic
1104797664 12:131530749-131530771 AAGCTAAGAAGAGCAGAGCAAGG - Intergenic
1104889547 12:132133696-132133718 ACTGTCAGGAAGGCAGAGCAAGG - Intergenic
1105807842 13:23967742-23967764 AATTTTAAAAAGGCCGGGCATGG - Intergenic
1105816268 13:24039104-24039126 AATTATAGAGAGGCAGATCAGGG - Intronic
1105896581 13:24721528-24721550 AATCTCAGAAAGGGAAAGAAAGG + Intergenic
1106118130 13:26834566-26834588 TGTCTTAGGGAGGCAGAGCAGGG + Intergenic
1106172439 13:27299542-27299564 AAACTTAGGAAGTCAGAGAAAGG - Intergenic
1106190632 13:27449808-27449830 AGTCTTAGAAAAGTAGAGGATGG - Intronic
1106849233 13:33771124-33771146 ATTCTTAGACAAGCACAGCATGG - Intergenic
1107176887 13:37409547-37409569 AATCTCAGAAATGTGGAGCAGGG - Intergenic
1107407326 13:40127063-40127085 AATCATAGAAAGCGAGAACATGG + Intergenic
1108209162 13:48120933-48120955 AATTTTAAAAAGGCAGGGGATGG + Intergenic
1108417422 13:50212400-50212422 GATCTTAGAAAAGCAGAGAGGGG + Intronic
1108714137 13:53062017-53062039 TTTCTTTGATAGGCAGAGCAAGG - Intergenic
1108902161 13:55424992-55425014 AAGGGCAGAAAGGCAGAGCAAGG + Intergenic
1110185091 13:72664602-72664624 AAGCTGAGAAAGGGAGAGCGAGG - Intergenic
1110392296 13:74988615-74988637 CATCTCAGAAAACCAGAGCAGGG + Intergenic
1111660852 13:91208814-91208836 CAGATAAGAAAGGCAGAGCAGGG + Intergenic
1112288409 13:98124172-98124194 TATCTTGCAAAGGCAGAGCCAGG - Intergenic
1112815924 13:103273125-103273147 AATTTTAAAAAGGCAGAGAGTGG + Intergenic
1113267950 13:108640158-108640180 AATTTTAGAAGGGCAGATAAAGG + Intronic
1113888073 13:113671426-113671448 AATCATGGAAAGACAGAGCTGGG - Intronic
1116047601 14:39763661-39763683 AATCTAGCAAAGGCAAAGCAAGG + Intergenic
1116422638 14:44750892-44750914 AGGCTTAGCAAGGCAGAGAAAGG - Intergenic
1116450435 14:45058875-45058897 AATCATAAAAAGGAAGAGAAAGG - Intronic
1117205320 14:53436717-53436739 AATCTGAGAGAAGCAGAGCCAGG + Intergenic
1117270481 14:54138411-54138433 ACTCTCAGAAAGGCTTAGCAGGG + Intergenic
1117835620 14:59802845-59802867 AATCTTACTAAGCCAGAGCCAGG + Intronic
1117853257 14:59998531-59998553 CATCTTTTAAAGGCAGAGAAAGG - Intronic
1118499038 14:66339640-66339662 AATCTTAGAATAGCAAACCATGG - Intergenic
1118741244 14:68740980-68741002 AATCTTAGAAAGCCAGAGCTGGG + Intergenic
1119774096 14:77237851-77237873 AACCTTTGAAAGGCTGAGGACGG - Intronic
1120320917 14:82959147-82959169 ATTCTTAATAATGCAGAGCATGG - Intergenic
1120372192 14:83650320-83650342 AAGCTTAGAAAGGCCGGGCATGG - Intergenic
1121567382 14:94920334-94920356 AATCTCAGAAACGCATAGAAGGG + Intergenic
1121670731 14:95709096-95709118 GATCGTGGAAAGTCAGAGCAGGG - Intergenic
1124873273 15:33565070-33565092 AATCTTACAACTGAAGAGCAGGG - Intronic
1125143583 15:36439429-36439451 CATCTTAGAGACCCAGAGCACGG - Intergenic
1127132355 15:55880672-55880694 AATCTCAGAAAGACAGGGAAAGG + Intronic
1127656615 15:61061770-61061792 AATGTTAGTAAGGCCGGGCACGG + Intronic
1127858900 15:62976696-62976718 CATCTTATAAAGGCAGAGAAGGG - Intergenic
1128120512 15:65142607-65142629 AGTCTTAAAAAGGCCGGGCATGG - Intergenic
1128635015 15:69297606-69297628 AGCCTTGGAAAGGCAAAGCAGGG + Intergenic
1129552634 15:76469863-76469885 AATATTTGAAAGGCAGCACAAGG - Intronic
1131069321 15:89455471-89455493 AATCTTGGAATGGCTGAGCTGGG + Intergenic
1131166269 15:90144247-90144269 AAGCATAGAAAGGCCGGGCACGG - Intergenic
1131351423 15:91704118-91704140 AATAGTTGAAAGGCAGATCATGG - Intergenic
1131863119 15:96675867-96675889 CATATTAGAATGGAAGAGCAGGG - Intergenic
1133034578 16:3027751-3027773 ATTCATAGAAAGAAAGAGCATGG - Exonic
1133175357 16:4010310-4010332 AAGCTGAGAGAGGCTGAGCAGGG + Intronic
1136014458 16:27386501-27386523 ATTCTTAGAAAGACATAGGAGGG - Intergenic
1136576648 16:31129282-31129304 ATGCTCAGGAAGGCAGAGCAGGG - Intronic
1136686694 16:31999107-31999129 GAACTTAGCCAGGCAGAGCAGGG + Intergenic
1136787306 16:32942644-32942666 GAACTTAGCCAGGCAGAGCAGGG + Intergenic
1136882470 16:33911138-33911160 GAACTTAGCCAGGCAGAGCAGGG - Intergenic
1136946782 16:34661726-34661748 AATCTTCGAAAGGAATAGAATGG - Intergenic
1138132510 16:54492901-54492923 ACACTTCGAAAGGCCGAGCATGG - Intergenic
1139172617 16:64649599-64649621 CATCTCAGAAAGAAAGAGCAAGG + Intergenic
1139572961 16:67824852-67824874 CTCCGTAGAAAGGCAGAGCAGGG - Intronic
1139653435 16:68373910-68373932 AGTCTTAGAAAGGGTGAGCGAGG - Intronic
1139685014 16:68596774-68596796 ACTCTTAGAAAGGCTGTGCTGGG - Intergenic
1140456788 16:75110317-75110339 CATCCCAGAAAGGCAGAACAGGG - Exonic
1141629746 16:85280843-85280865 TTTCTTAGAAAGCCAGTGCAAGG + Intergenic
1203089540 16_KI270728v1_random:1204316-1204338 GAACTTAGCCAGGCAGAGCAGGG + Intergenic
1142608917 17:1097074-1097096 GCTGTTAGAAAGGCAGAGCAGGG + Intronic
1147147657 17:38494770-38494792 GAACTTAGCCAGGCAGAGCAGGG + Intronic
1148431025 17:47643723-47643745 ATTCTTAAAAGGGCGGAGCAAGG + Intergenic
1149033360 17:52107870-52107892 CATTTAAGAAAGTCAGAGCAAGG + Intronic
1150047595 17:61928462-61928484 AACCTTAGAGAGGCAATGCACGG + Intergenic
1150617794 17:66785492-66785514 AGCGTCAGAAAGGCAGAGCAAGG - Intronic
1155084600 18:22445835-22445857 AATCTTAGAAATAGAGGGCAAGG - Intergenic
1157050268 18:44155554-44155576 AATCTTGCAAGGGCAGAGGATGG - Intergenic
1159904170 18:74075469-74075491 CATCTTAGAGAGGCAGAGAGAGG + Intronic
1160158735 18:76454668-76454690 ATTTTTAGACAGGCAGTGCAGGG - Intronic
1160457185 18:79009735-79009757 AATCTTAAATAGGGAGAGAAAGG - Intergenic
1163500855 19:17675339-17675361 AATAATAAAAAGGCAGGGCACGG + Intronic
1163562236 19:18026455-18026477 ACTGTGAGAAAGGCAAAGCAAGG - Intergenic
1164997761 19:32735410-32735432 AATTGTATAAAGGCTGAGCAAGG + Intronic
1165280927 19:34796599-34796621 AAACTTGGAAAGGCTGGGCATGG - Intergenic
1165712931 19:38024981-38025003 AACCTGAGAAAGGCAGAGTCTGG - Intronic
1166295290 19:41886364-41886386 AATTTTAAAAAGGCAAAGGAGGG - Intronic
1167422216 19:49410776-49410798 AATTTTAAAAAGGCTGGGCATGG - Intronic
1168116324 19:54222935-54222957 AATCTCACCAAGGCAGAGCAGGG + Exonic
1168119307 19:54242710-54242732 AATCTCACCTAGGCAGAGCAGGG + Exonic
1168240948 19:55088681-55088703 AATCTGGGGAAGGCAGAGCCAGG - Intergenic
925085217 2:1102386-1102408 AATCCCAGAAGGGCAGGGCACGG - Intronic
926590890 2:14739220-14739242 AATCTTCCAATGGCAGAGCATGG - Intergenic
928261069 2:29767292-29767314 AACTTTTTAAAGGCAGAGCAGGG + Intronic
928801579 2:35100223-35100245 AATGTGAGATAAGCAGAGCAGGG - Intergenic
928873036 2:36004350-36004372 AATCTTATAAAGGTACAGAAAGG - Intergenic
929939141 2:46317926-46317948 AATTCTAGGAAGGCAGAGCAAGG - Intronic
930264848 2:49187335-49187357 AATTTTAGATAGGTAGGGCATGG - Intergenic
930513252 2:52372937-52372959 AATTTTAGAAAGGTAGATTAGGG + Intergenic
931691774 2:64839760-64839782 GATCTTAGAGCGGCAGAGCTGGG - Intergenic
932111163 2:69002050-69002072 AATCATAGAATGGGAGAACAAGG - Intergenic
932832900 2:75008077-75008099 CATCCTAGAAAGAGAGAGCAAGG + Intergenic
933786466 2:85846704-85846726 AATCCTAGAAAGACAGAGCTGGG - Intronic
934561709 2:95317044-95317066 CATTTTAGAGAGGCACAGCAGGG + Intronic
935584141 2:104785412-104785434 AATCTTGGGAAGGCTGAGGATGG + Intergenic
935752805 2:106252433-106252455 AATATTAGCAAGGCTGGGCATGG - Intergenic
935795721 2:106640021-106640043 AATCGTTGAAAGGAAGAGAAGGG - Intergenic
935913224 2:107919974-107919996 AATATTAGCAAGGCCGGGCACGG - Intergenic
936903934 2:117514961-117514983 AATAGTAGAATGTCAGAGCAGGG + Intergenic
938764297 2:134450119-134450141 ACTTATACAAAGGCAGAGCATGG - Exonic
939186406 2:138866273-138866295 AATCTGAGAAAGGGAAGGCAAGG - Intergenic
940511462 2:154620604-154620626 AATAATAAAAAGGCAGAGAAAGG - Intergenic
940987855 2:160066196-160066218 AATCTTTTGAAGGCCGAGCATGG + Intergenic
941595575 2:167472673-167472695 ACTCTGACAAAGGAAGAGCACGG - Intergenic
941737412 2:168994178-168994200 AAGCTTTGCAAGACAGAGCAAGG - Intronic
941795107 2:169590343-169590365 AACCTTAGAAAGTCAGGGCCTGG + Intronic
942325989 2:174777644-174777666 AAGCTTAGAAAGTGAGAGCAAGG + Intergenic
942611672 2:177748039-177748061 AATCTAAGAAAGATTGAGCAGGG - Intronic
942753032 2:179309305-179309327 CATCTTACCATGGCAGAGCAGGG + Intergenic
943341150 2:186683700-186683722 AGGCTTAGAAAGGAAGAGAACGG + Intergenic
943580337 2:189676225-189676247 ATTCTTTGAAAAGCAGAACATGG + Intronic
946283731 2:218686227-218686249 AATTTTAAAAAGGCTGGGCACGG - Intronic
946450814 2:219777528-219777550 ACTCTGACAAGGGCAGAGCAAGG - Intergenic
946803862 2:223450419-223450441 ATTTTCAGAAAAGCAGAGCAGGG - Intergenic
946974604 2:225134245-225134267 AATATTGGAAAAGCAGATCAAGG + Intergenic
947867227 2:233407473-233407495 AATCTTGTCATGGCAGAGCACGG + Intronic
948900682 2:240955554-240955576 GATTTTAGACAGGCAGAGGAAGG + Intronic
1170662855 20:18359800-18359822 AAGCACAGAAAGGCAGAACAGGG + Intergenic
1172029924 20:31974831-31974853 AACCCTACAAAGGCAGAGCAGGG - Intronic
1172127951 20:32636402-32636424 AATCAACGAAAGGGAGAGCAAGG + Intergenic
1172342221 20:34167385-34167407 TATACTAGAAAGGCAGAACAAGG - Intergenic
1172352020 20:34250505-34250527 AAAATTAAAAAGGCCGAGCACGG + Intronic
1172634277 20:36399388-36399410 AATGTGAGGCAGGCAGAGCAAGG - Intronic
1172701054 20:36853994-36854016 AATCTCAAAAACTCAGAGCAGGG + Intronic
1173402065 20:42734503-42734525 CATTATAGAAGGGCAGAGCATGG + Intronic
1174288012 20:49485610-49485632 AATTTTAGAAAGGAAGAAAAGGG - Intergenic
1174761982 20:53215574-53215596 AATGTAAGAAAGGCTGGGCACGG + Intronic
1175378040 20:58542724-58542746 GACCTTGGGAAGGCAGAGCATGG + Intergenic
1176518121 21:7801912-7801934 AATCCTAGAAAGCCTGGGCATGG + Intergenic
1176974788 21:15308170-15308192 AATTTGAGGAAGGCAGAGAAGGG + Intergenic
1178652149 21:34431925-34431947 AATCCTAGAAAGCCTGGGCATGG + Intergenic
1182011166 22:27001846-27001868 TATCTTAGAAAAGAAGACCAAGG + Intergenic
1183552654 22:38500350-38500372 AATGTAAGAAAGGCTGGGCATGG + Intronic
1184234327 22:43174968-43174990 AATCTCAGACAGGCACACCAAGG + Intronic
1184252663 22:43269580-43269602 AAGCTGGGAACGGCAGAGCAGGG + Intronic
1203328154 22_KI270738v1_random:49175-49197 AATCTTCGAAAGGAATAGAATGG + Intergenic
949261026 3:2103032-2103054 AATATTAGAAGGGCAAAGTAGGG - Intronic
951053742 3:18123645-18123667 AAGATTAGAAAGGCTGAACATGG - Intronic
951427371 3:22563356-22563378 AAGCTAGGAAAGGCAAAGCAAGG + Intergenic
951975325 3:28500860-28500882 AATCTCAGAAAAGAATAGCAAGG + Intronic
952034036 3:29178142-29178164 AAAATTAAACAGGCAGAGCATGG - Intergenic
953267695 3:41408657-41408679 AACATTACAAAGGAAGAGCATGG + Intronic
953854700 3:46492316-46492338 ATTCTGTGAAAGGAAGAGCAAGG + Intergenic
954452761 3:50580531-50580553 TATCCTAGAAATGCAGAGCATGG - Exonic
955521418 3:59779022-59779044 ACTGTTAGAAAGGAAGAGAATGG + Intronic
956331913 3:68120029-68120051 AATCCTTAAAAGTCAGAGCAGGG + Intronic
956712743 3:72052399-72052421 AATCCTAAAAGGGGAGAGCAAGG - Intergenic
959360611 3:105386240-105386262 AATATTAGAAAAGCAGAGTTAGG + Intronic
959930095 3:111971084-111971106 AGCCTTAGAGAGGCAAAGCAGGG - Intronic
960092053 3:113650669-113650691 AATGTTAGAAGGCAAGAGCAAGG + Exonic
960629919 3:119719810-119719832 AAACTTAGAAAGGCTGGGCGTGG + Intronic
961094229 3:124140929-124140951 AATCTTAAAAATGCATAGAATGG + Intronic
962325929 3:134432289-134432311 AAGATAAGAAAGGCAGATCAAGG - Intergenic
963600790 3:147377512-147377534 AATGTTTGAACGGCAGAGGAAGG - Intergenic
964361048 3:155896709-155896731 AATCTCAGTAAGGCTGGGCATGG - Intronic
964965821 3:162492103-162492125 AGTCTCAGAAGGGGAGAGCAGGG + Intergenic
965382264 3:168004616-168004638 AATCATAGGAAGGCAGAACATGG + Intergenic
966628508 3:182046303-182046325 AATCTTAAAAAGAGAGAGAAAGG + Intergenic
966777855 3:183558770-183558792 AATCTTAAAAAGGGCGAGAAAGG - Intergenic
967683779 3:192396510-192396532 CAACTATGAAAGGCAGAGCAAGG - Intronic
971501155 4:27319130-27319152 TACCTTAGAAAGGCAGATGAGGG + Intergenic
971722073 4:30257266-30257288 AATCCTTGAAAGGAAGAGCAGGG + Intergenic
974578301 4:63759058-63759080 AGTTTTAGAAAAGCAGAGGATGG - Intergenic
975203839 4:71622314-71622336 AACCTTACAAAAGCAGAGAAAGG - Intergenic
975339670 4:73225396-73225418 AATCCTAGAATGGAAGAGAAGGG - Intronic
979128694 4:117010885-117010907 TATCTCAGAAAGGCAAGGCAAGG + Intergenic
980607838 4:135115896-135115918 AATCTTAGAGAGAAAGAGAAAGG - Intergenic
981330893 4:143508395-143508417 AAACTAAAAAAAGCAGAGCAAGG - Intergenic
981458945 4:144989922-144989944 AATGTTAGAAAGGCTGAGAGAGG + Intronic
981793869 4:148572497-148572519 AATTTTAAAAAGAAAGAGCAAGG + Intergenic
981939263 4:150264280-150264302 AATCTTACAAATGCCTAGCAAGG - Intergenic
982663522 4:158233304-158233326 AACTTTAGAAAGTCAGAGGAAGG + Intronic
985262233 4:188125705-188125727 AGTCTTAGACATGCAGGGCACGG - Intergenic
987068119 5:14309211-14309233 AAACTTAGAAAGGGAAAGGATGG - Intronic
987471489 5:18334975-18334997 CATATTACAAAGGCAGAACAAGG - Intergenic
988318167 5:29658848-29658870 AATCTGAGGAAGGCTGGGCATGG + Intergenic
988573610 5:32397090-32397112 AATCTTAGAATGGGACATCATGG + Intronic
988581942 5:32476024-32476046 AAGCTCAAAAATGCAGAGCAAGG - Intergenic
988851176 5:35182739-35182761 AATCTAAGAAGGGCAGAGGCAGG + Intronic
990331244 5:54728059-54728081 GATCTTGGAAAGGCAGACCTTGG - Intergenic
990870558 5:60427004-60427026 AATCTTAGAAAGGAAGAGTGGGG + Intronic
990894686 5:60686049-60686071 CTGCTGAGAAAGGCAGAGCAGGG - Intronic
991043688 5:62201143-62201165 AATCTCAGGAAGGCTCAGCAGGG + Intergenic
991313692 5:65275052-65275074 AATATTAGAAAAGAAGAGCATGG + Intronic
992009035 5:72509074-72509096 AATCTGAGAAAGCCAGGGAAGGG + Intergenic
992870251 5:80998724-80998746 CAACTTATACAGGCAGAGCAGGG - Intronic
993294745 5:86121888-86121910 CATCTTACCATGGCAGAGCAGGG - Intergenic
993313134 5:86363144-86363166 AAACTTAGAGATGCAGAGTATGG - Intergenic
993811951 5:92491006-92491028 AATTGTAGAAAGCAAGAGCAAGG - Intergenic
994190753 5:96866991-96867013 AATATCAGAAAGGTAAAGCAGGG - Intronic
994272198 5:97791607-97791629 CATCTTAGCATGGCAGAGTAGGG - Intergenic
994929435 5:106163137-106163159 AAGCTGAGAAAAGAAGAGCATGG + Intergenic
995305439 5:110641759-110641781 AATGTAAAAAAGGCAAAGCAAGG + Intronic
996325205 5:122265282-122265304 AATGATAAAGAGGCAGAGCACGG - Intergenic
996886394 5:128360055-128360077 AAACTTAGAAAGCAAGAGCAGGG - Intronic
998263603 5:140649971-140649993 AATCTCAGAAACACTGAGCAGGG - Intronic
998856878 5:146402165-146402187 AATCTTTGAAAGGCCGAGGCAGG - Intergenic
998938445 5:147255572-147255594 AGTATTAGAAAGGCACTGCATGG - Intronic
1000160021 5:158588083-158588105 AGTCAGAGAAAGGCAGAGCTGGG + Intergenic
1001234471 5:170018125-170018147 AAACATATAAAGGCAGTGCAAGG + Intronic
1002060674 5:176623988-176624010 AGTCTCAGAAATGCAGACCATGG + Intronic
1003449575 6:6218568-6218590 AACCTCAGAAGGGCAGAGCAGGG - Intronic
1004698186 6:18053679-18053701 ATTCTAAGCAAGGCAGTGCAAGG - Intergenic
1005349632 6:24921476-24921498 AATGTGAGCAAGGCAGAGAATGG - Intronic
1005628087 6:27682316-27682338 AATCTTAGGGAGGCAGAGGCAGG + Intergenic
1005988150 6:30886707-30886729 GGTCTCAGGAAGGCAGAGCAGGG + Intronic
1007540702 6:42641017-42641039 AATCATAGACTGGCTGAGCATGG - Intronic
1007555494 6:42762270-42762292 AATCCTAGAAAGACAGAGCTGGG + Intronic
1008070133 6:47091196-47091218 TATCTTGGAAAGGTAGGGCAGGG - Intergenic
1008192520 6:48476683-48476705 AATCCTGGAAAGACAGAGCTAGG + Intergenic
1010130385 6:72485938-72485960 GATCTGAGAAAGGCACACCAGGG - Intergenic
1010163131 6:72882366-72882388 ATTGTTAGTAATGCAGAGCAGGG + Intronic
1010471749 6:76236150-76236172 AAACATAGGAAGGTAGAGCAAGG + Intergenic
1011109370 6:83820277-83820299 AATCATAGATAGGCCGGGCATGG + Intergenic
1013530573 6:111016300-111016322 AATCTTAAGCAGGCCGAGCATGG + Intronic
1015340213 6:132090454-132090476 AAACTCAGAAAGGCAAAACAAGG + Intergenic
1016024017 6:139266637-139266659 AATCTTAGAAGGGAAGAAGATGG + Intronic
1017601211 6:156083589-156083611 ACTCTTAGAAGGTCAGAACAGGG + Intergenic
1018367471 6:163136232-163136254 CATCAGAGAGAGGCAGAGCAGGG - Intronic
1020183143 7:5937708-5937730 AATCTTAGAATTACAGAGCAAGG - Intronic
1020299770 7:6787049-6787071 AATCTTAGAATTACAGAGCAAGG + Intronic
1020524696 7:9244291-9244313 AGTATAAGAAAGGGAGAGCAGGG - Intergenic
1021508071 7:21407149-21407171 TATTATATAAAGGCAGAGCAAGG + Intergenic
1022656125 7:32320770-32320792 AAACTTAGAAAAGCAGAGCAAGG + Intergenic
1023071379 7:36438077-36438099 ACTCTTAGAAAGGCTGGGCGCGG - Intronic
1023183314 7:37508312-37508334 GAGCTGAGTAAGGCAGAGCAGGG - Intergenic
1023793078 7:43769318-43769340 TATCTCAGAAAGGCCGGGCACGG - Intronic
1023952443 7:44857341-44857363 AATCTTAGAAACCTAGAGAAAGG - Intergenic
1024556706 7:50610003-50610025 AACCATGGAAAGGCAGAGCTGGG - Intronic
1024905386 7:54373553-54373575 AATGTTTGAAAGGTAAAGCAGGG - Intergenic
1025555273 7:62299794-62299816 AATCTTAGAATGGCATCGAATGG + Intergenic
1025848370 7:65220424-65220446 AATCTTAAAATGGCTGGGCATGG + Intergenic
1026771326 7:73201868-73201890 AAAAATAGAAACGCAGAGCAGGG - Intergenic
1027012192 7:74755265-74755287 AAAAATAGAAACGCAGAGCAGGG - Intronic
1027075848 7:75190789-75190811 AAAAATAGAAACGCAGAGCAGGG + Intergenic
1028362685 7:89987942-89987964 TACCTTAGAAAGGGAGATCAGGG + Intergenic
1031491051 7:122388908-122388930 ATTCTTAATAAGGCAGGGCAAGG + Intronic
1032730345 7:134635937-134635959 AATTTTATAAAGGCTGAGAAAGG - Intergenic
1032779731 7:135155460-135155482 AATCATACAAAGGAAGAGAAAGG - Intronic
1033046577 7:137967752-137967774 GATCTTAGGAATGCAGTGCAGGG - Intronic
1033862481 7:145644791-145644813 AGTCTGAGCAAGGAAGAGCAGGG + Intergenic
1033973296 7:147069218-147069240 AATGTTAGAATGGCAGGGTAGGG + Intronic
1036080558 8:5550871-5550893 AATATTAAAAATGAAGAGCATGG - Intergenic
1039786169 8:40835990-40836012 AATGTTGCAAAGGCAGAGGAAGG + Intronic
1039846714 8:41330618-41330640 AAACATGCAAAGGCAGAGCAGGG + Intergenic
1040839322 8:51768309-51768331 ACTTTTGGAATGGCAGAGCAAGG - Intronic
1041753141 8:61283151-61283173 GATATTAGAAAGGCTGAGGAAGG - Intronic
1042048479 8:64681799-64681821 AATCTGGGAAAGGCTGAGCTGGG - Intronic
1042481651 8:69310744-69310766 TATCTGAGAAAGAGAGAGCAAGG - Intergenic
1044233562 8:89805936-89805958 CATTTGTGAAAGGCAGAGCAAGG - Intergenic
1044552777 8:93530471-93530493 AAATTTAAAAAGTCAGAGCAAGG - Intergenic
1045160377 8:99535460-99535482 AATGTTAGAAATGATGAGCAAGG - Intronic
1045630759 8:104118858-104118880 AATCAGAGAAAGGGAAAGCAAGG + Intronic
1046531237 8:115448312-115448334 AATCTTACAAAGATACAGCATGG + Intronic
1047405316 8:124580740-124580762 GATATTAGTAAGGCAGAGAAGGG - Intronic
1048080868 8:131124947-131124969 AATCAGAGAATGTCAGAGCAAGG + Intergenic
1048341815 8:133545973-133545995 CATCCTAAAAAGGCAGAGGATGG - Intronic
1049209909 8:141381130-141381152 AATCTTAGAGAGGCACAGCTGGG + Intergenic
1050009008 9:1166012-1166034 AATCAGAAAATGGCAGAGCAAGG + Intergenic
1050666827 9:7947574-7947596 AATCTTAGAAACTCAGAGGAAGG + Intergenic
1050833625 9:10048236-10048258 AAGGTTAGCAAGGCAGAACAAGG - Intronic
1050918286 9:11165077-11165099 AATGCTAGGAAGGCAAAGCAAGG + Intergenic
1051521892 9:17998675-17998697 AGTCTTAGAAAGTCAGACCATGG + Intergenic
1051721123 9:20038576-20038598 TATCGTAGAAAGGGAGAGGATGG - Intergenic
1051984760 9:23070700-23070722 GATCTCATAAAGGTAGAGCATGG + Intergenic
1053140589 9:35680259-35680281 AATATTAGAGAGGCAGATCATGG + Intronic
1055097311 9:72426626-72426648 AATCTTATAATGGAAGAGTAGGG - Intergenic
1058696427 9:107562992-107563014 AAGTTTAGAAATGCAAAGCAGGG + Intergenic
1058724545 9:107789439-107789461 GTTCCTTGAAAGGCAGAGCAGGG + Intergenic
1058747776 9:108008468-108008490 ATTCTCAGAGAGGCAGAGGAAGG + Intergenic
1059713045 9:116887275-116887297 CATCGTATAAAGTCAGAGCAGGG + Intronic
1060290873 9:122301296-122301318 AAGCTGGGTAAGGCAGAGCAGGG + Intronic
1062237291 9:135516369-135516391 AATCTTAGAAAGGTGGAAGAGGG - Intergenic
1062335465 9:136063591-136063613 TCTCTTAAAAAGGCCGAGCACGG + Intronic
1186177820 X:6943869-6943891 AATCCTTGAACGGCAGAGAATGG - Intergenic
1187209856 X:17218434-17218456 AATATTTTAAAGGCTGAGCATGG - Intergenic
1188886551 X:35558118-35558140 AATATTGGTAAGGCAGACCATGG + Intergenic
1189229225 X:39439131-39439153 CATCTTAGAAAGGCAGTGGGGGG + Intergenic
1190215841 X:48478912-48478934 AGTCTTAGAGAGGCAAAGCCTGG + Intronic
1190486645 X:50932909-50932931 AATTTTAGGAAGGCTGAGAAAGG + Intergenic
1192819442 X:74628668-74628690 AATCTTTGAAAAACAGAGCTGGG - Intergenic
1193008232 X:76644632-76644654 ACTGTTGGAAAGGCAGAGGATGG + Intergenic
1194601833 X:95930905-95930927 ATTTTAAGAAAGTCAGAGCAGGG - Intergenic
1194967017 X:100299588-100299610 AATCTTGGAAGACCAGAGCAGGG + Intronic
1194985839 X:100488705-100488727 AAGATTAGAAAGAAAGAGCAAGG - Intergenic
1195752528 X:108172777-108172799 AATCTTAGAAAGTCACAGTGTGG + Intronic
1197804123 X:130383153-130383175 AAACTCAGAAAGGCAGAGAGTGG + Intergenic
1198845234 X:140903118-140903140 AACCATAGAGTGGCAGAGCAGGG - Intergenic
1198946543 X:142021915-142021937 AATCTGAGCAGGACAGAGCAGGG - Intergenic
1199890259 X:152072036-152072058 AATCTTACAAAGGGAGAACTTGG + Intergenic
1200167099 X:154044070-154044092 AATCTTAGGAAGGCAGAGGCAGG + Intronic
1201339579 Y:12918998-12919020 AATATTAGAATGGCCGACCATGG + Intronic
1201458027 Y:14192470-14192492 CATCTTAGGAAAGCAGAGCTGGG - Intergenic