ID: 1097823345

View in Genome Browser
Species Human (GRCh38)
Location 12:64149661-64149683
Sequence ATCTTAGAAAGGCAGAGCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097823340_1097823345 -7 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823345 12:64149661-64149683 ATCTTAGAAAGGCAGAGCAAGGG 0: 1
1: 0
2: 1
3: 35
4: 274
1097823339_1097823345 7 Left 1097823339 12:64149631-64149653 CCACAGTTCATATGCCTGCACCC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 1097823345 12:64149661-64149683 ATCTTAGAAAGGCAGAGCAAGGG 0: 1
1: 0
2: 1
3: 35
4: 274
1097823338_1097823345 8 Left 1097823338 12:64149630-64149652 CCCACAGTTCATATGCCTGCACC 0: 1
1: 0
2: 0
3: 5
4: 77
Right 1097823345 12:64149661-64149683 ATCTTAGAAAGGCAGAGCAAGGG 0: 1
1: 0
2: 1
3: 35
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097823345 Original CRISPR ATCTTAGAAAGGCAGAGCAA GGG Exonic
901907002 1:12421477-12421499 ATCTTTTAAAGGCAGAGAACTGG + Intronic
903682672 1:25107460-25107482 ATCTTTGCAAGTGAGAGCAAAGG + Intergenic
905353363 1:37363035-37363057 AACCTAGAAACTCAGAGCAATGG + Intergenic
907361787 1:53922604-53922626 ATCTTAGAAAGTAAGAAAAAAGG + Intronic
909224726 1:73004967-73004989 ATTTTATAAATGCAGAGCAGTGG - Intergenic
909302842 1:74036046-74036068 ATCTTTGTATGGCAGGGCAAGGG + Intronic
909833649 1:80225955-80225977 TTCTAAGAAAGACTGAGCAAGGG - Intergenic
910262941 1:85308893-85308915 AGTTCAGAAGGGCAGAGCAATGG + Intergenic
910284187 1:85535411-85535433 ATCATACTTAGGCAGAGCAAAGG - Intronic
910292487 1:85612942-85612964 ATCTGAAGAAGGCAAAGCAATGG + Intergenic
910598141 1:89001908-89001930 ATGTCAGAAAGTCAGAGGAAGGG + Intergenic
910650753 1:89564196-89564218 ATGATAGATAGCCAGAGCAAGGG - Intronic
912092140 1:106092425-106092447 ATTTTAGAAAGGCAGGGGATTGG - Intergenic
912184312 1:107256594-107256616 CTCTCAGAAAGGAAGAGCTAAGG + Intronic
912566441 1:110590928-110590950 GTCTTAGAAAAGCAGAGAAATGG - Intergenic
913942764 1:125123397-125123419 ACCTAAGAAAGCCAGGGCAATGG - Intergenic
914205836 1:145527574-145527596 ATCATACTTAGGCAGAGCAAAGG + Intergenic
915447595 1:155982989-155983011 CTATTAGAAACTCAGAGCAATGG - Intronic
915525062 1:156471006-156471028 TTATTAAAAAAGCAGAGCAAGGG + Intronic
915536463 1:156539086-156539108 ATCTCAAAAAGGAAAAGCAACGG - Intronic
916886413 1:169072872-169072894 GTCAGAGAAAGGCAGAGCAATGG + Intergenic
917299535 1:173559281-173559303 GTCTTGGAAAGGCAGGGCAGGGG - Intronic
917780968 1:178396630-178396652 ATGGTAGAAAGGCACACCAAGGG - Intronic
917841898 1:178986961-178986983 ATCTTATAAAGACAGACTAAAGG - Intergenic
918035049 1:180861702-180861724 CTCTTAGAAAGGCAGTGGTAGGG - Intronic
919529450 1:198698518-198698540 TTCTTAGAAATGCAGATTAAAGG - Intronic
919562411 1:199138170-199138192 ATTTTAGAAAGATAGAGCAAAGG + Intergenic
919575330 1:199301754-199301776 AACTTAGAAATGCAGAGATATGG - Intergenic
919589434 1:199482017-199482039 ATCTTTGAAAGGCTGTGCAGTGG - Intergenic
919616798 1:199818268-199818290 ATCTGTGACAGGCAGAGCAGTGG + Intergenic
919764703 1:201119307-201119329 AGCTTAGAAAACCTGAGCAAAGG + Intronic
922231085 1:223687081-223687103 TTCTGGAAAAGGCAGAGCAATGG - Intergenic
922450973 1:225737084-225737106 ATTTTATAAAGGCAGAACATAGG - Intergenic
924043924 1:240009421-240009443 ATCTCTGAAAGGCAGAGGGAAGG + Intergenic
1063779519 10:9305198-9305220 ATCTTTTAAAGGCAAAGCAAAGG - Intergenic
1064320087 10:14296802-14296824 ATCTCAGGGAGGAAGAGCAAAGG + Intronic
1065074089 10:22059403-22059425 ATCTCAAAAAGGCAGAACTATGG - Intergenic
1065139395 10:22705695-22705717 ATGTTAGAAATGCAGAGCTTGGG - Intronic
1067654240 10:48178909-48178931 ATCTGAGACAGAAAGAGCAAAGG - Intronic
1068696643 10:59974880-59974902 TTCTGAGAAAGGCAGAACTATGG - Intergenic
1069401380 10:68050733-68050755 ATCCTAGAAAGTCATATCAATGG + Intronic
1069841515 10:71342360-71342382 TTCTTTGTAAGGCAGAGAAATGG + Intronic
1070075518 10:73131002-73131024 ACCTCAGAAGGGCAGAGCAAAGG + Exonic
1070961581 10:80503487-80503509 ATTTTACAAAAGCAGAGCACTGG - Intronic
1070962327 10:80507691-80507713 ATCTTAGCCAGGAAGGGCAAAGG - Intronic
1071286155 10:84147800-84147822 ATCTAAGATAGGCAAAGAAAAGG + Intronic
1073646788 10:105313194-105313216 ATATTAGAGTGGGAGAGCAAAGG + Intergenic
1074759470 10:116655597-116655619 ATCTTGGAAAGGCCCAGCCATGG - Intergenic
1075643689 10:124084065-124084087 ACCTTTGCAAGGCAGAGCTAGGG + Intronic
1076097727 10:127745598-127745620 ATCTAAGAAAGGAATTGCAAGGG + Intergenic
1080919244 11:36692360-36692382 TTCTTAGAATGGGAGAGCAGTGG - Intergenic
1080940525 11:36912973-36912995 AGCTGAAAAAGGCAGAGAAATGG - Intergenic
1087334696 11:96828974-96828996 ATCTTGGGAAGGCAGAAGAAAGG + Intergenic
1087768264 11:102179625-102179647 TTTTTAGAAAAGCAGATCAAGGG - Intronic
1088245755 11:107816585-107816607 ATGTTAGAAATGCAGGGTAAGGG - Intronic
1088458428 11:110057521-110057543 TTCTTAGTAAGTCAGTGCAAAGG - Intergenic
1089280501 11:117371040-117371062 ATGTTAGAAAGGAAGACAAAAGG - Intronic
1090212028 11:124927668-124927690 ATCATAGAATGTCAGAGCTAAGG - Intronic
1092521770 12:9282993-9283015 TTTTTAAAAAGGCACAGCAAGGG - Intergenic
1093121480 12:15276572-15276594 TTCTGAGAAAGGCTTAGCAAAGG - Intronic
1093421235 12:18977303-18977325 AGCTGAAAAAGGCAGAGGAATGG - Intergenic
1093735033 12:22611475-22611497 CACTTTGAAAGGCTGAGCAAGGG - Intergenic
1094000111 12:25685883-25685905 TTCTTAGCAAGTCAGAGCAGAGG - Intergenic
1096096622 12:48939777-48939799 ACCCTAGGAAGGCAGAGCATGGG + Exonic
1096815795 12:54201001-54201023 ATCTGAGGAAGGCTGAACAAAGG - Intergenic
1097823345 12:64149661-64149683 ATCTTAGAAAGGCAGAGCAAGGG + Exonic
1099067133 12:77995690-77995712 AACTTAGAAAGCCAAGGCAAGGG - Intronic
1099898601 12:88680270-88680292 ATCTTACATGGCCAGAGCAAGGG - Intergenic
1100440928 12:94616400-94616422 ATGTGATGAAGGCAGAGCAAAGG + Intronic
1101371081 12:104131403-104131425 ATGGTAGAAAGACAGAGGAAAGG - Intronic
1103774923 12:123360277-123360299 ACTTTAGAAAGGCAAAGCATGGG + Intronic
1104464585 12:128980096-128980118 ATCTCAGCAAAGCAGAGCAGGGG - Intronic
1104615133 12:130261043-130261065 TCCTTTGGAAGGCAGAGCAAAGG + Intergenic
1104831587 12:131755995-131756017 AACTGAGAAGAGCAGAGCAAAGG - Intronic
1105793820 13:23831166-23831188 ACCTTAGAAATGCAAAGGAAAGG + Intronic
1107054039 13:36083796-36083818 AGCTTAGAATGGAAGACCAATGG - Intronic
1107922626 13:45225675-45225697 TGATTAGAAAGCCAGAGCAAAGG + Intronic
1107988464 13:45796513-45796535 GGCTTAGAAAGGCAGAGTCATGG + Intronic
1108013681 13:46050540-46050562 ATCTTAGAAATTCAGAGTATAGG - Intronic
1108904643 13:55453017-55453039 ATCAGAGAAATGCAAAGCAAGGG - Intergenic
1109744754 13:66610209-66610231 ATCTTAGAAAGAGAGAGAACAGG + Intronic
1110392297 13:74988616-74988638 ATCTCAGAAAACCAGAGCAGGGG + Intergenic
1110669289 13:78157491-78157513 TTCTTGGAAAGGCAAAACAAAGG - Intergenic
1111433774 13:88179904-88179926 ATCTGGGAAAGGCATAGAAAGGG - Intergenic
1112288408 13:98124171-98124193 ATCTTGCAAAGGCAGAGCCAGGG - Intergenic
1112570820 13:100591347-100591369 TTTGTAAAAAGGCAGAGCAAAGG - Intergenic
1113291197 13:108908565-108908587 TTCTTAGAAAGGCAAATAAATGG - Intronic
1115425310 14:33252231-33252253 ATCTTAGAAATGCAGTCCTATGG - Intronic
1115787357 14:36841513-36841535 ATGTTTGAAAGGAAGATCAATGG - Intronic
1116156716 14:41214894-41214916 ATCTAAGCAAGCCTGAGCAATGG + Intergenic
1116211460 14:41951226-41951248 ATAATAGAAAGGCAGACAAAAGG - Intergenic
1116626576 14:47272494-47272516 ATCCTAGAAGGGCAGAGGATAGG - Intronic
1117205321 14:53436718-53436740 ATCTGAGAGAAGCAGAGCCAGGG + Intergenic
1118356076 14:65015011-65015033 ATCTAAGGAAGGCTGAGCAGAGG - Intronic
1118741245 14:68740981-68741003 ATCTTAGAAAGCCAGAGCTGGGG + Intergenic
1120281956 14:82450365-82450387 ATCTCAGAAAAGCAAAGCAAAGG - Intergenic
1120951843 14:90048827-90048849 AGCTTAGAAAGGAACGGCAAAGG + Intergenic
1121670730 14:95709095-95709117 ATCGTGGAAAGTCAGAGCAGGGG - Intergenic
1121894854 14:97637295-97637317 TTCTTGGTAAGGCGGAGCAATGG + Intergenic
1125137497 15:36360602-36360624 ATCTTAGAGATGAAGAGGAAAGG - Intergenic
1128625764 15:69201278-69201300 CTCTTTGACAGGCAGAACAATGG - Intronic
1129545577 15:76391520-76391542 ATCTTAGCAAGGCATGCCAAAGG + Intronic
1129759780 15:78122738-78122760 ACCTTAGAGAGTCTGAGCAAGGG - Intronic
1129969542 15:79766095-79766117 ATCTCAGAAATTCAGTGCAAAGG - Intergenic
1130564047 15:84980099-84980121 CTCTTAAAATTGCAGAGCAAAGG + Intergenic
1130940614 15:88505452-88505474 TACTCAGAAAGGCAGAGCAGTGG - Intergenic
1133518335 16:6531665-6531687 CTCCTAGAAAGGCAGGACAAGGG - Intronic
1137083740 16:36097587-36097609 ACCTAAGAAAGCCAGGGCAATGG + Intergenic
1137561396 16:49504610-49504632 ATCTTAGAAGGTAAGAGAAAGGG + Intronic
1138176914 16:54908870-54908892 TTCTTAGAAAGGCAAAACTATGG + Intergenic
1139172618 16:64649600-64649622 ATCTCAGAAAGAAAGAGCAAGGG + Intergenic
1140456787 16:75110316-75110338 ATCCCAGAAAGGCAGAACAGGGG - Exonic
1141391267 16:83666685-83666707 ATCTGAAAGAGGAAGAGCAAAGG - Intronic
1141686156 16:85571140-85571162 TTGTTAGAAAGGCAGAGCCTAGG - Intergenic
1142644680 17:1304203-1304225 GTCCCAGAAAGGCAGAGCCACGG + Intergenic
1143893066 17:10117140-10117162 AGCTGAGAAAGGCAAAGAAATGG - Intronic
1145690691 17:26736165-26736187 ACCTAAGAAAGACAGGGCAATGG - Intergenic
1146272192 17:31491783-31491805 CTCTGAGAAGGGCAGAGCAATGG - Intronic
1153226357 18:2902978-2903000 ATCTTAAAATGGCAAAGCACAGG - Intronic
1155224759 18:23719545-23719567 AAATTAGAAAGGTAGAGTAATGG - Intronic
1158102977 18:53851721-53851743 ATCTTTGAAAGGGAAAGAAAGGG - Intergenic
1158683943 18:59595755-59595777 TTCTTTGGCAGGCAGAGCAAAGG + Intronic
1159681169 18:71354339-71354361 CCCTTAGAAAGGCAGCTCAAAGG + Intergenic
1159904171 18:74075470-74075492 ATCTTAGAGAGGCAGAGAGAGGG + Intronic
1167784600 19:51627067-51627089 ATCTCAGAAACACAGAGCTAAGG - Intronic
1168240947 19:55088680-55088702 ATCTGGGGAAGGCAGAGCCAGGG - Intergenic
1202670345 1_KI270709v1_random:44272-44294 ACCTAAGAAAGCCAGGGCAATGG - Intergenic
926324809 2:11775746-11775768 ATCTGATAATGGCAGAGCACCGG - Intronic
926513777 2:13815448-13815470 ATATTATAAAGAAAGAGCAATGG - Intergenic
926590889 2:14739219-14739241 ATCTTCCAATGGCAGAGCATGGG - Intergenic
928873035 2:36004349-36004371 ATCTTATAAAGGTACAGAAAGGG - Intergenic
929277695 2:40043553-40043575 GTCTTAGAAAGGGAGAGTGATGG + Intergenic
931691773 2:64839759-64839781 ATCTTAGAGCGGCAGAGCTGGGG - Intergenic
932895131 2:75631989-75632011 TTCTTAGGAAGGCAGAGGCAGGG - Intergenic
935916670 2:107959916-107959938 ATCTAAGAAAGGAAGAGAAAAGG + Intergenic
936799034 2:116243825-116243847 AACTTAAAAAGGCAAAGAAATGG + Intergenic
937240538 2:120459260-120459282 ATCTTAAACATGCATAGCAATGG + Intergenic
937621230 2:123990011-123990033 ATCTTAGAAAGGTAAAACTATGG + Intergenic
940511461 2:154620603-154620625 ATAATAAAAAGGCAGAGAAAGGG - Intergenic
941208679 2:162608440-162608462 AACTTAGAAAATCAGAGAAATGG - Intronic
941548126 2:166879394-166879416 GTCTTAGAAAGAGAGACCAAAGG + Intergenic
942325990 2:174777645-174777667 AGCTTAGAAAGTGAGAGCAAGGG + Intergenic
942345894 2:175002804-175002826 AACTTAGAACAGAAGAGCAATGG - Intronic
942586396 2:177483885-177483907 ATCATTCAAAGGCAGAGGAAAGG + Intronic
942753033 2:179309306-179309328 ATCTTACCATGGCAGAGCAGGGG + Intergenic
943869573 2:192976696-192976718 ATCCCAGAAATGCAGATCAAAGG - Intergenic
944214498 2:197240742-197240764 ATCTCAGAAAGCCAGATCCAAGG + Intronic
945136057 2:206628505-206628527 AGCATAGAAAGGGAAAGCAAGGG + Intergenic
948900683 2:240955555-240955577 ATTTTAGACAGGCAGAGGAAGGG + Intronic
949081296 2:242102252-242102274 TCATTAGAAAGGCAGAGCAACGG + Intergenic
1168912507 20:1460639-1460661 ATCACAGAGAGGCAGAGCTAGGG - Intronic
1170378014 20:15723492-15723514 TTCTTAGAAAGGCAAAACTATGG - Intronic
1172010653 20:31844126-31844148 TTCCTAGAAAGGGAGAGGAAGGG - Intergenic
1172342220 20:34167384-34167406 ATACTAGAAAGGCAGAACAAGGG - Intergenic
1172634276 20:36399387-36399409 ATGTGAGGCAGGCAGAGCAAGGG - Intronic
1174714233 20:52739801-52739823 ATCTGAAGAAGGCAAAGCAAAGG - Intergenic
1175669141 20:60886848-60886870 AATTTAAATAGGCAGAGCAAAGG - Intergenic
1179273534 21:39869882-39869904 ACCAAAGAAAGCCAGAGCAATGG + Intronic
1180122431 21:45762782-45762804 CTCTTAAAAAGGCAGAGCACAGG - Intronic
1184234328 22:43174969-43174991 ATCTCAGACAGGCACACCAAGGG + Intronic
1184331009 22:43827952-43827974 CTCTTATAAAGGCAGAGCAGTGG - Intronic
1184447767 22:44561022-44561044 ATCTCAGAAAAGAAAAGCAATGG + Intergenic
1184511862 22:44938575-44938597 CTCATAGAAAGGCAGGGCCAAGG + Intronic
1184534440 22:45077122-45077144 ATCTCAGAAATGCAGAGTGAGGG - Intergenic
1184544803 22:45160281-45160303 ATTTTTGAAAGGCAGAGTATAGG + Intergenic
1185007090 22:48286616-48286638 TTCCGAGAAAGGCAAAGCAATGG + Intergenic
950946246 3:16950085-16950107 ATCTTAGAAAAGAAGAGCAAAGG - Intronic
951631388 3:24725139-24725161 ATCTAATAAGGGCAGAGCAGAGG - Intergenic
951645059 3:24880546-24880568 ATCTTAGAAAAGTAGACCCATGG + Intergenic
952368594 3:32697364-32697386 ACCTTAGAAATACAGGGCAAAGG - Intronic
952519665 3:34144048-34144070 ATCTGGGAAAGGCATAGAAAAGG - Intergenic
952759444 3:36901070-36901092 ATCTGAGGAAGGCAAAGAAATGG - Intronic
952932615 3:38371869-38371891 AGGTCAGAAAGGCAGAGAAAGGG + Intronic
954452760 3:50580530-50580552 ATCCTAGAAATGCAGAGCATGGG - Exonic
954775226 3:53011220-53011242 ATCTTGGAAAGGTAGAGGAAAGG + Intronic
956788577 3:72662699-72662721 CTCTTAGGAAGGCAGAGAGAAGG - Intergenic
956826122 3:72997706-72997728 TTCTTAGAAAGGCAGATTTATGG + Intronic
959496248 3:107056075-107056097 ATGTTATAAAGGCATAGAAAAGG + Intergenic
959629674 3:108493726-108493748 AATTTAGAAAGTCAGAGAAAGGG + Intronic
960403382 3:117230705-117230727 ATCTTACAAAGGCACAGCATTGG + Intergenic
961924542 3:130463627-130463649 TCCTTAGAATGGCAGAGGAAGGG - Intronic
962263215 3:133927811-133927833 TTCTGAGAAAGCCAGAGGAAAGG + Intergenic
962325928 3:134432288-134432310 AGATAAGAAAGGCAGATCAAGGG - Intergenic
962364317 3:134767538-134767560 ATTTTAAAATGGCAGAGCATAGG - Intronic
962971307 3:140404359-140404381 ATCTCAGAGCGTCAGAGCAAGGG + Intronic
965382265 3:168004617-168004639 ATCATAGGAAGGCAGAACATGGG + Intergenic
965924921 3:173966230-173966252 AGCTTTGAAAGGCAGAGCTGTGG - Intronic
966130947 3:176638497-176638519 ACATTAAAAAGGAAGAGCAAGGG + Intergenic
966258476 3:177947111-177947133 AAATTAGAAAGTCAGGGCAAGGG + Intergenic
967195569 3:187022622-187022644 ATCTGGGAAAGGCCTAGCAAGGG + Intronic
967379108 3:188837849-188837871 ATCTTATAAAACCAAAGCAAGGG - Intronic
967809479 3:193744840-193744862 ATGTTTAAAATGCAGAGCAAAGG - Intergenic
969086062 4:4657387-4657409 ATCTTAGAGAGGCCAAGCAAAGG - Intergenic
971878173 4:32331115-32331137 AACTGAAAAAGGCAGAGAAATGG - Intergenic
973169601 4:47123095-47123117 ATGTCAAAAAGGCAGAGCACTGG - Intronic
974233756 4:59153014-59153036 ATGTTACAGAGGTAGAGCAATGG + Intergenic
974373548 4:61047461-61047483 ATCTTAGAAAGTAAGAAGAATGG + Intergenic
976080907 4:81353645-81353667 ATCTTGTCATGGCAGAGCAAGGG - Intergenic
976478780 4:85514667-85514689 TTCTTGGAAAGTCAGAACAAAGG - Intronic
980607837 4:135115895-135115917 ATCTTAGAGAGAAAGAGAAAGGG - Intergenic
980846844 4:138334104-138334126 ATCTTCAAAATGCAGAGCACAGG - Intergenic
980950871 4:139375095-139375117 ATCAGAGAAAGGCAGAGAACTGG - Intronic
981042967 4:140239946-140239968 ATGGTAGAATGGCAGAGAAATGG - Intergenic
981995271 4:150967405-150967427 ATTTTAGGGAGGGAGAGCAAAGG - Intronic
982091065 4:151880466-151880488 AGCTGGGAAAGGCAGAGGAAAGG - Intergenic
985002573 4:185500458-185500480 ATCTTAAAAAGGCATGGCAATGG - Intergenic
987830442 5:23088310-23088332 ATCTAAGAAATGCAGAGCAGAGG - Intergenic
988087712 5:26493112-26493134 AGCTTACAAAAGCAGAACAAAGG - Intergenic
988310968 5:29556657-29556679 ATTTCAGAAAAACAGAGCAATGG - Intergenic
988973082 5:36489015-36489037 ATATTAGATATGCAGAGCAATGG - Intergenic
991313693 5:65275053-65275075 ATATTAGAAAAGAAGAGCATGGG + Intronic
992178849 5:74177279-74177301 AGAATAGAAAGGCAGAGGAAGGG - Intergenic
992212781 5:74496906-74496928 ATTATAGAAAGCCAGAGAAAGGG + Intergenic
992782379 5:80140027-80140049 ATCTTAAAAAGGCAGAGGGTAGG + Exonic
993152771 5:84181893-84181915 ATATTAGAAAAGGAAAGCAAGGG + Intronic
993294744 5:86121887-86121909 ATCTTACCATGGCAGAGCAGGGG - Intergenic
994695064 5:103063641-103063663 ATCATGGGAAGCCAGAGCAAGGG - Intergenic
995683983 5:114750901-114750923 ATCTTAGGAAGAAAGAGAAAGGG - Intergenic
998836757 5:146209903-146209925 ATCTTTAAAAGGCAGACCAAAGG - Intronic
999783909 5:154874134-154874156 CTCTTTAACAGGCAGAGCAATGG - Intronic
1001635993 5:173210947-173210969 TTGTTGGGAAGGCAGAGCAATGG + Intergenic
1002540661 5:179904523-179904545 ATCTTAGAAAGGCAGCTCCGTGG - Intronic
1002838466 6:885415-885437 ACCTTAGAAGGGCAAAGAAAAGG + Intergenic
1002862605 6:1093558-1093580 ATGTTAGCTAGGCAAAGCAAAGG - Intergenic
1004425244 6:15502602-15502624 ATCTTAGAAATACGGAGGAAGGG + Intronic
1004698185 6:18053678-18053700 TTCTAAGCAAGGCAGTGCAAGGG - Intergenic
1009873449 6:69475811-69475833 ATATTTTAAAGGCAGAGCCAAGG - Intergenic
1011125997 6:84008531-84008553 ATCCTACAAAGGCAGATCAAAGG - Intergenic
1012032679 6:94092683-94092705 TTATTAGAAAGGAAGAGAAATGG + Intergenic
1012533656 6:100269110-100269132 ATTTTAGAAAAGAAAAGCAATGG - Intergenic
1012995838 6:105973117-105973139 TTTTTAAAAAGGCAGAGGAAAGG + Intergenic
1015323295 6:131899895-131899917 ATCTTTGAAATTCAGGGCAATGG + Intergenic
1015610655 6:135014622-135014644 ATCTTAGGAAGGCAAAACATAGG + Intronic
1016307494 6:142699003-142699025 ATCTAAGAGATGCAGAACAAAGG - Intergenic
1016639092 6:146328131-146328153 ATATTAGAAATGCATAGAAAAGG - Intronic
1016753908 6:147662434-147662456 ATCTTAGAAATGAAGAAAAATGG + Intronic
1017068754 6:150553109-150553131 TTCTGAGAAAGGCAAAGCAATGG - Intergenic
1017382823 6:153849945-153849967 CTCTGAGAAAGGCAAAACAATGG + Intergenic
1020789944 7:12615078-12615100 ATCTTAAACATACAGAGCAAGGG + Intronic
1023052548 7:36265794-36265816 ATTCTAGAAAGGGAGAGCAGTGG + Intronic
1023519980 7:41040162-41040184 ATCCAAGAACAGCAGAGCAAAGG - Intergenic
1023747408 7:43333987-43334009 ATGTTAGAAAAGCAGTGGAAAGG + Intronic
1023952442 7:44857340-44857362 ATCTTAGAAACCTAGAGAAAGGG - Intergenic
1024044673 7:45578554-45578576 GTATTAGGAAGGCAGAGAAAGGG + Intronic
1025320862 7:58091905-58091927 ACCTAAGAAAGCCAGGGCAATGG - Intergenic
1025479169 7:60960928-60960950 ACCTAAGAAAGCCAGGGCAATGG - Intergenic
1025552882 7:62271886-62271908 ACCTAAGAAAGCCAGGGCAATGG + Intergenic
1026490391 7:70858022-70858044 ATCTAAAAAAGGCATAGAAAGGG + Intergenic
1028362686 7:89987943-89987965 ACCTTAGAAAGGGAGATCAGGGG + Intergenic
1028924781 7:96346121-96346143 ATCTCACAAAGGCTGAGCAATGG + Intergenic
1029359637 7:100079244-100079266 CTCCTAGAAAGGCAGGTCAAAGG + Intronic
1033921314 7:146395907-146395929 ATCTCAGAAAGGCAGATTTAGGG + Intronic
1035539205 8:419057-419079 TCATTAGAAAGTCAGAGCAACGG + Intronic
1035567444 8:650789-650811 ACCTGATAAAGCCAGAGCAAGGG + Intronic
1036748297 8:11425942-11425964 ATCTTGGAAAGGCCTAGAAAGGG - Intronic
1038411773 8:27364525-27364547 GTCTTAGATAGGCAGAGATATGG + Intronic
1038669644 8:29572241-29572263 TTCTTAGAAAGGCTGGGCCAGGG + Intergenic
1038732346 8:30138787-30138809 GACTTAGAACGGCACAGCAAAGG + Intronic
1038908221 8:31931718-31931740 ATCCCAGAAAGGCAGTGCAGAGG + Intronic
1039547765 8:38421989-38422011 CTCTAAGAGACGCAGAGCAAGGG + Intronic
1039786170 8:40835991-40836013 ATGTTGCAAAGGCAGAGGAAGGG + Intronic
1040622836 8:49108759-49108781 ATCTCAGAAAGGCCTAGAAAGGG - Intergenic
1042481650 8:69310743-69310765 ATCTGAGAAAGAGAGAGCAAGGG - Intergenic
1043233091 8:77827166-77827188 ATCTTAAAAAAGCAGACAAATGG - Intergenic
1043928979 8:86069281-86069303 ATCTCAAAAGGGCAGAGAAAGGG + Intronic
1045101685 8:98850850-98850872 ATTTTAGAAAGGCAGCTCCAGGG + Intronic
1045154657 8:99454063-99454085 TTCTTAAAAAGGCAAAGCTATGG - Intronic
1045894457 8:107197346-107197368 AGAATAGAAAGGCAGAGGAAAGG - Intergenic
1046017027 8:108617499-108617521 ATCTTAGACAGGCTGACAAATGG - Intronic
1046307898 8:112394500-112394522 AGTTTAGAGAGGCAGAGCAGAGG - Intronic
1047405315 8:124580739-124580761 ATATTAGTAAGGCAGAGAAGGGG - Intronic
1047703930 8:127478620-127478642 ATCAAAGAAAGGCAGAAAAATGG + Intergenic
1047964633 8:130036838-130036860 ATCTTAAAAAGTCAGAGAAATGG + Intergenic
1048789830 8:138090640-138090662 ATCTCAAAAATGGAGAGCAAAGG + Intergenic
1049233222 8:141494936-141494958 ATCTGTGGATGGCAGAGCAATGG + Intergenic
1050542662 9:6683304-6683326 ATTTTAGAAAGACTGACCAAAGG - Intergenic
1051203040 9:14651172-14651194 ATCTTATAAAGGCATCGCAGTGG - Intronic
1051464886 9:17366386-17366408 ATTTTAGAAAGCCAAGGCAAGGG - Intronic
1051721122 9:20038575-20038597 ATCGTAGAAAGGGAGAGGATGGG - Intergenic
1052230228 9:26141817-26141839 ATGTTAGAAAGCTGGAGCAATGG - Intergenic
1052423241 9:28271128-28271150 TTCTTATAAATACAGAGCAAGGG - Intronic
1053602767 9:39627399-39627421 AACTGTGAAAGGCAGAGGAATGG + Intergenic
1053860411 9:42381146-42381168 AACTGAGAAAGGCAGAGGAATGG + Intergenic
1054250770 9:62715037-62715059 AACTGTGAAAGGCAGAGGAATGG - Intergenic
1054564879 9:66749549-66749571 AACTGTGAAAGGCAGAGGAATGG - Intergenic
1055326699 9:75137733-75137755 ATGATACACAGGCAGAGCAAAGG - Intronic
1056423938 9:86457373-86457395 ATCTTCAAAAGCCAAAGCAAGGG + Intergenic
1058038476 9:100278912-100278934 ATTTTAAAAAGAAAGAGCAAAGG + Intronic
1058263728 9:102872126-102872148 AGCATATAAAGGCAGAGGAAGGG + Intergenic
1059225061 9:112664764-112664786 CTCTTAGAAAGGGAGGGCAGCGG - Exonic
1059588979 9:115637052-115637074 ATGTTAGAAAGGCTGAGTACAGG - Intergenic
1059951627 9:119469452-119469474 ATCTCAGAATGGCAGAGAGAGGG - Intergenic
1060425817 9:123504626-123504648 ATCTGAGGGAGGCAGAGCCATGG + Intronic
1061330220 9:129887732-129887754 TTCTTAGAAACGCAGTGAAAGGG - Exonic
1186653724 X:11590136-11590158 ATCTTAAAAATACACAGCAATGG + Intronic
1186656723 X:11619979-11620001 GTCCTACAAAGTCAGAGCAAAGG - Intronic
1186811547 X:13194166-13194188 ATATGACAAAGGCAGGGCAATGG - Intergenic
1188367241 X:29331320-29331342 ACCTGAGAGAGGCAGAGCAATGG - Intronic
1188815464 X:34707030-34707052 GAGTTAGAAAGGCAGAGAAAAGG + Intergenic
1190785779 X:53647146-53647168 ATCTTGAAAAGGCAAAGCAAAGG + Intronic
1191663672 X:63676075-63676097 ACCAAAGAAAGGCAGAGGAAAGG + Intronic
1193497986 X:82237643-82237665 AGCTTACAAAAGCAGAACAAAGG + Intergenic
1194685545 X:96909463-96909485 ATGTCTGAAAGGCAGAGAAATGG + Intronic
1195734907 X:108001742-108001764 ACCCTAGAAAGGCGGAGAAAGGG + Intergenic
1195989176 X:110665779-110665801 TTCTTAGAATTGCAGAGCAAAGG + Intergenic
1197619378 X:128730430-128730452 ATCTTAGAAGGCTAGAACAATGG - Intergenic
1198822501 X:140663837-140663859 ATGTTAGAAAGGCTGATGAATGG - Intergenic
1199457620 X:148046538-148046560 ACCTAAGAAAAGAAGAGCAAGGG - Intergenic
1199803943 X:151279353-151279375 ATCAGAGAAAGGCAAAGGAATGG - Intergenic
1201458026 Y:14192469-14192491 ATCTTAGGAAAGCAGAGCTGGGG - Intergenic
1202054680 Y:20817705-20817727 ATCTTACACAGGAAGTGCAAGGG + Intergenic