ID: 1097823348

View in Genome Browser
Species Human (GRCh38)
Location 12:64149692-64149714
Sequence GGCTTCTGCCTTGAGTAGTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 211}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097823340_1097823348 24 Left 1097823340 12:64149645-64149667 CCTGCACCCTGTAAGAATCTTAG 0: 1
1: 0
2: 0
3: 6
4: 101
Right 1097823348 12:64149692-64149714 GGCTTCTGCCTTGAGTAGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 211
1097823342_1097823348 18 Left 1097823342 12:64149651-64149673 CCCTGTAAGAATCTTAGAAAGGC 0: 1
1: 0
2: 0
3: 18
4: 174
Right 1097823348 12:64149692-64149714 GGCTTCTGCCTTGAGTAGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 211
1097823343_1097823348 17 Left 1097823343 12:64149652-64149674 CCTGTAAGAATCTTAGAAAGGCA 0: 1
1: 0
2: 1
3: 18
4: 199
Right 1097823348 12:64149692-64149714 GGCTTCTGCCTTGAGTAGTTGGG 0: 1
1: 0
2: 0
3: 22
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097823348 Original CRISPR GGCTTCTGCCTTGAGTAGTT GGG Exonic
902266394 1:15269811-15269833 AGCTTTTGCCTTGTGTATTTTGG + Intronic
904031237 1:27534766-27534788 GGCTTCTGCGTGGAGGAGATGGG + Exonic
905188459 1:36214294-36214316 GGTTTCTGGCTTGAGCAGCTAGG - Intergenic
905230454 1:36511962-36511984 GGCCTCTGCCTTTAGAAGTCGGG - Intergenic
906236907 1:44217495-44217517 GGTTTCTGGCTTGAGCAGCTGGG + Intronic
906433385 1:45774385-45774407 AGCTTCTGCCTTAAGAAATTAGG + Intergenic
906631414 1:47371928-47371950 GATTTATGCCTTGAGTAGCTAGG - Intronic
909008936 1:70310751-70310773 GGGTTGTCCCTTGAGTATTTTGG - Intronic
910363419 1:86438066-86438088 GGTTTCTGGCTTAACTAGTTGGG - Intronic
912481051 1:109982524-109982546 GGGTTCTGCCTCGAGTCTTTGGG + Intergenic
913137527 1:115907052-115907074 GGCTTCTGTCTTGCCTTGTTAGG + Intergenic
915364148 1:155304642-155304664 GGAGTCTGGCTTGAGCAGTTGGG + Intergenic
918316017 1:183323312-183323334 GGCTTCTGGCTTCAGCAGCTGGG - Intronic
920193496 1:204210968-204210990 GGCTTCTGCGTTAAGTGGTGGGG - Intronic
923247215 1:232144305-232144327 TGCATCTGCCTTGAGTCATTCGG + Intergenic
924422317 1:243921185-243921207 GGCTTCTTCCCTGAGTACTCGGG - Intergenic
1064100849 10:12462809-12462831 AGCTCCTGCCCTGAGTAGCTGGG + Intronic
1064388832 10:14923552-14923574 TGCCTCAGCCTTGAGTAGCTGGG - Intronic
1064520922 10:16199881-16199903 GGCTTCTGTCTTGACTGGGTAGG + Intergenic
1065583048 10:27190889-27190911 AACTTCTGGCTTGAGCAGTTGGG + Intergenic
1066079890 10:31919996-31920018 TTCTCCTGCCTTGAGTAGCTGGG - Intronic
1066319253 10:34284364-34284386 GTCTTCTGCAGTCAGTAGTTTGG + Intronic
1069794032 10:71041119-71041141 GGCTTCTGGCTTGGAGAGTTTGG + Intergenic
1072073700 10:91946957-91946979 GGCTTCTTCCTGCAGTAGCTGGG + Intronic
1072506252 10:96070505-96070527 TTCTCCTGCCTTGAGTAGCTGGG - Intergenic
1073029941 10:100517823-100517845 GGCTTCTGGGTTGAGCAATTGGG - Intronic
1073771133 10:106736982-106737004 GGCTTCTGGCTTGGGGAGTAAGG - Intronic
1074916405 10:117960150-117960172 GGCTCCTGACTTGACTTGTTGGG - Intergenic
1076072980 10:127507184-127507206 GGATTCTGACTTAAGTGGTTTGG - Intergenic
1076691496 10:132225881-132225903 GGCCTCTGCCTCGAGTGGGTTGG - Intronic
1076694637 10:132241213-132241235 TGCTTCTGGCTGGAGGAGTTGGG - Intronic
1077056703 11:597461-597483 GGCTTCGGCCTCGAGCAGGTAGG + Exonic
1078468592 11:11569324-11569346 ATCTTCTGCCTTGAGTATCTGGG + Intronic
1081904500 11:46659070-46659092 TGCTTCAGCCTCGAGTAGCTGGG - Intronic
1083480499 11:62942133-62942155 TTCTCCTGCCTTGAGTAGCTGGG + Intronic
1083529405 11:63405302-63405324 GGCTTCTGGTTTGAGCAATTTGG + Intronic
1084055447 11:66629011-66629033 TCCTTCTGGCTTGAGCAGTTAGG - Intronic
1085281537 11:75334212-75334234 CTCTCCTGCCTTGAGTAGCTGGG - Intronic
1085389711 11:76176194-76176216 GGCCTCTGCCTGGAGAAGTCAGG + Intergenic
1085502893 11:77039201-77039223 GGCTTCTGGCTGGAGTAGTCAGG + Intronic
1085581011 11:77650483-77650505 GGCTTCTCCCTTTAGTAATATGG - Intergenic
1087663843 11:101019453-101019475 AGCTTCTGCCCTGTGGAGTTGGG - Intergenic
1088503911 11:110510784-110510806 GGCTTCTGCCTTGTTTTCTTGGG + Intergenic
1091180851 11:133603291-133603313 GGCTTCTGAATTGAGTGGTCTGG + Intergenic
1091543300 12:1482338-1482360 TGCTACTGCCTTCAGTAGTCTGG - Intronic
1094337327 12:29374656-29374678 TGTTTCTGGCTTGTGTAGTTGGG - Intronic
1094541260 12:31364875-31364897 GGTTTCTGGCTTGAGTAACTGGG + Intergenic
1095085698 12:38055851-38055873 TGCTTCAGCCTTCAGTAGCTGGG - Intergenic
1095572569 12:43699929-43699951 GGTTTCTGCCTTTAGCAGTTAGG + Intergenic
1096167898 12:49439588-49439610 GGCTTTTGGCTTGAGCAGTTGGG + Intronic
1097331651 12:58338259-58338281 GGCTTTTGACTTGAGCAGTCTGG - Intergenic
1097425025 12:59433782-59433804 GGCTGAGGCCTTGAGAAGTTAGG - Intergenic
1097823348 12:64149692-64149714 GGCTTCTGCCTTGAGTAGTTGGG + Exonic
1097981056 12:65738482-65738504 GGTTTCTGCCTTGATCAGTTGGG + Intergenic
1099082409 12:78202084-78202106 GGCTTCTGCTTGGGGTAGATTGG - Intronic
1099263652 12:80416440-80416462 GGCTTTTAACTTGAGTAATTTGG + Intronic
1100070077 12:90705128-90705150 GTCTAATGCCTTGAGTAGGTTGG - Intergenic
1100071517 12:90725578-90725600 GGCATTTGCCTTGAAAAGTTAGG - Intergenic
1101736551 12:107467513-107467535 GGCTTCTGCCTAGAGTCAATAGG - Intronic
1102400888 12:112628642-112628664 TCCTCCTGCCTTGAGTAGCTGGG - Intronic
1103498275 12:121380016-121380038 GCCTTCAGCATTGACTAGTTTGG - Intronic
1106251142 13:27982311-27982333 TTCTCCTGCCTTGAGTAGCTGGG - Intronic
1107356256 13:39570824-39570846 GGCTTTTGCCTTAAATATTTAGG - Intronic
1108162170 13:47652090-47652112 GCTTTCTTGCTTGAGTAGTTTGG - Intergenic
1114496920 14:23139290-23139312 GGTTTCTGCCCTGAGAACTTGGG + Intronic
1114716430 14:24830485-24830507 GGCTTCTGGTTTGAGCAATTGGG + Intronic
1117166475 14:53039354-53039376 GGCTTCTGCCCTATCTAGTTAGG + Intronic
1117964404 14:61191810-61191832 TGCTTTTTCCTTGAGTAATTTGG + Intronic
1118068857 14:62223504-62223526 TGCTCCAGCCTTGAGGAGTTTGG + Intergenic
1118797206 14:69153622-69153644 GGCCTCTGCCTTGGGCAGTCCGG + Intergenic
1120549373 14:85850387-85850409 TTCTGCTGCCTTGAGTAGCTGGG - Intergenic
1121043678 14:90772579-90772601 AGCAACTGCCTTGAGTAGATGGG + Intronic
1125905161 15:43385023-43385045 GGTTTCTGCCTTCAGCAGCTGGG + Intronic
1126030047 15:44488000-44488022 TTCTCCTGCCTTGAGTAGCTGGG - Intronic
1126350614 15:47741598-47741620 TGCCTCAGCCTTGAGTAGCTGGG - Intronic
1127281805 15:57499351-57499373 TTCTCCTGCCTTGAGTAGCTGGG + Intronic
1127322879 15:57864602-57864624 AGCTTCTACCTTAACTAGTTTGG - Intergenic
1129481652 15:75831212-75831234 GACTTCTGCATTGAGGAGGTGGG + Intergenic
1130443340 15:83976871-83976893 GGTTTCTGGCTTGAGTAAATTGG + Intronic
1131802295 15:96083916-96083938 GACTTCTGCCTTGAGGAGAGAGG - Intergenic
1133878845 16:9761966-9761988 GGCTTTTGATTTGAGGAGTTTGG + Exonic
1135046089 16:19157013-19157035 GGGTTCTGACTTGAGTAACTTGG + Intronic
1136641123 16:31566158-31566180 GGCTTCTGAGTTGAGGAATTTGG - Intergenic
1138160675 16:54750414-54750436 TGCTTCTGCCTTGCGTAATGAGG + Intergenic
1139494350 16:67305536-67305558 GGCTTCAGGCTTGCCTAGTTGGG - Intronic
1141638063 16:85325862-85325884 TTCTCCTGCCTTGAGTAGCTGGG + Intergenic
1142420586 16:89967149-89967171 GCCTTCTGCCTTGGGCAGTGGGG + Exonic
1143047591 17:4094678-4094700 GGCTTTTGGCTTGAGCAGGTGGG - Intronic
1143421008 17:6792323-6792345 GGTTTCTGCCTTGAGTAGCAGGG - Intronic
1144090651 17:11853098-11853120 GGCTACTGGCTTGAGTCATTTGG + Intronic
1145166278 17:20615196-20615218 GCCTTCTGCCTTGGGCAGTGGGG + Intergenic
1146213544 17:30960451-30960473 GAGTTCAGCCTTGAGTAGCTGGG - Intergenic
1146968575 17:37054087-37054109 GGCTCCTGCCCTGAGCAGCTGGG - Intronic
1148020731 17:44551643-44551665 TTCTCCTTCCTTGAGTAGTTGGG - Intergenic
1148971345 17:51485317-51485339 GGCTTCTGAGTGGAGTAGCTAGG + Intergenic
1149521282 17:57320101-57320123 GGCTGCTGCCTTGAGTTTTCTGG + Intronic
1150589174 17:66547053-66547075 GCCTTTTGTCTTGAGTAGTCTGG + Intronic
1151204265 17:72494067-72494089 GGATTCTGCCTTGAGAAATGAGG - Intergenic
1152704164 17:81834215-81834237 TGCCTCAGCCTTGAGTAGCTGGG + Intronic
1155380509 18:25217432-25217454 GGTTTCTTGCTTGAGTAATTGGG + Intronic
1155920813 18:31601192-31601214 TGCCTCAGCCTTGAGTAGCTGGG - Intergenic
1156149932 18:34228846-34228868 GGTTTCTGGCTTTAGTAGTGAGG + Intergenic
1156438687 18:37161950-37161972 GGCTTCTGGCTTCTGTAGCTAGG - Intronic
1160032069 18:75270693-75270715 GGCTACTGTCGTGAGTATTTAGG + Intronic
1162519577 19:11171784-11171806 TTCTCCTGCCTTGAGTAGCTGGG + Intronic
1164270163 19:23665607-23665629 TGCCTCAGCCTTGAGTAGCTGGG + Intronic
1164677970 19:30115003-30115025 GGCTCCTGCCTTCAGTGGTATGG + Intergenic
1167061070 19:47146806-47146828 GGCTTCTGGCTTGAGTGACTGGG + Intronic
927468140 2:23351953-23351975 GCCTTCTGCCTTGATTAGGCCGG + Intergenic
928145878 2:28775221-28775243 AACCTCTGCCTTGAGTAGCTGGG + Intronic
928223496 2:29425390-29425412 AGCCTCTGCCTTGTGTAGCTGGG - Intronic
928351345 2:30558482-30558504 AGCCTCAGCCTCGAGTAGTTGGG - Intronic
929971288 2:46579543-46579565 GGCTTCTGACCTGAGTAACTGGG - Intronic
930805936 2:55490611-55490633 GGCTTCTGTGTGGAGTAGTATGG + Intergenic
931258338 2:60594843-60594865 TGCTTTTGCCTTGAGTTGTTTGG - Intergenic
931640035 2:64373983-64374005 GGCTTCTGGCTTGAGCAAATGGG + Intergenic
933669070 2:84989678-84989700 GGTTTCTGGCTTGATTAATTGGG + Intronic
934727669 2:96634889-96634911 GATTTCTGGCTTGAGCAGTTGGG - Intronic
934754570 2:96816380-96816402 GGCTTCTGCCTGGAGGAGGATGG + Exonic
934977710 2:98816436-98816458 GGTTTCTGGCTTGAGTATCTGGG + Intronic
938086223 2:128403919-128403941 GCCTTCTGCCTTCAGCAGTATGG - Intergenic
942142454 2:172991114-172991136 GGGTGCTGCCTAGAGTAATTCGG + Intronic
944508319 2:200438650-200438672 CGCTTCTGCCTTCATTAATTCGG + Intronic
944901559 2:204221722-204221744 GGCTTCTGGCTTGGGCAGCTGGG - Intergenic
946293594 2:218765191-218765213 TGCCTCAGCCTGGAGTAGTTGGG + Intergenic
947633655 2:231669142-231669164 GATTTCTGCTTTGGGTAGTTGGG - Intergenic
947795311 2:232890616-232890638 GGCTTTTACCTTGAGCAGTTTGG - Intronic
948328849 2:237149635-237149657 GGCTTCTGCAGTGAGCAGTAGGG + Intergenic
948605669 2:239133219-239133241 GGCCTCTGGCTTGACTAGTCTGG - Intronic
948789645 2:240370606-240370628 GGTCTCTGCCTTGTGTAGGTGGG - Intergenic
1169050855 20:2576806-2576828 AGCATTTGCCTTGAGTACTTTGG - Intronic
1171406661 20:24916242-24916264 GGCTTCTGTCTTGTGGAGTTGGG - Intergenic
1173787895 20:45808228-45808250 TGCTTCAGCCTTGAATAGCTGGG - Intronic
1174045373 20:47729307-47729329 GGCCTCTACCCTGAGTAGGTGGG + Intronic
1174621624 20:51879407-51879429 TTCTCCTGCCTTGAGTAGCTGGG + Intergenic
1175533336 20:59689735-59689757 GGTTTCTGGCTTCAGTAGCTAGG - Intronic
1175674691 20:60936615-60936637 GGCTTCAGCCTGGAGTTGTGGGG + Intergenic
1178869808 21:36363741-36363763 TGCTTCTTGCTTGAGAAGTTTGG + Intronic
1181654559 22:24285755-24285777 TGCCTCAGCCTTGAGTAGCTGGG + Intronic
1184349783 22:43936063-43936085 GGCTTCTGGCTTTAGCAGTTGGG + Intronic
1184967192 22:47988114-47988136 GGCATCTGGCTTGAGTCTTTTGG - Intergenic
949953272 3:9247229-9247251 GGCTTTTGTATTGAGCAGTTGGG + Intronic
952324338 3:32307422-32307444 GGTTTCTGTCTTGGGTAGGTGGG + Intronic
952504161 3:33992560-33992582 GGTTTTTGGCTTGAGTAGTTGGG - Intergenic
952689316 3:36185641-36185663 GGCTTTGGCCTGGAGTAGGTGGG - Intergenic
952718157 3:36503323-36503345 GACTTCTGCCTTATCTAGTTTGG - Intronic
955089103 3:55731856-55731878 GGGTTCTGCCTGGAGTCCTTAGG - Intronic
957435532 3:80170465-80170487 GGTTTCTGCTTAGAGTAATTAGG + Intergenic
958264795 3:91425435-91425457 GTCTTCTGCCTTGGGTGCTTGGG - Intergenic
958788842 3:98628430-98628452 TGCTGCTGCCTTCAGAAGTTAGG - Intergenic
961829974 3:129618414-129618436 GGGTTCTGCCTTGGGCAGCTGGG - Intergenic
962266012 3:133944821-133944843 GGTTTCTGCTCTGAGCAGTTAGG + Intronic
962829513 3:139127809-139127831 TGCCTCAGCCTTGAGTAGCTGGG - Intronic
967984807 3:195086856-195086878 GGCTTCTGTCTTGAGCATTCTGG + Intronic
968260908 3:197323444-197323466 GGCTTCTGCCTTGAAGAAATAGG - Intergenic
969092351 4:4704237-4704259 CCCTTCTGACTTGAGTAGTGTGG + Intergenic
971196000 4:24472050-24472072 TGGTTCTGCCTGGAGTTGTTCGG + Intergenic
972792761 4:42388742-42388764 GGCTGCTGCCTGTAGTTGTTGGG - Intergenic
973171673 4:47152747-47152769 GGTTTCTGACCTGAGTAGGTAGG - Intronic
973286203 4:48419512-48419534 TGCTTCAGTTTTGAGTAGTTGGG + Intronic
975800314 4:78054829-78054851 GCCTTCTCCCTTGACTACTTAGG + Intergenic
976443566 4:85104673-85104695 TGCTTCTACCTTGAGAAGTACGG + Intergenic
976544592 4:86319866-86319888 GGTTTCTGCCTTGGGCAGTAGGG - Intronic
977138883 4:93341436-93341458 GGCATCAGCCTTGAGTAGCTGGG + Intronic
978469101 4:109042250-109042272 GTCTTCTGTATTGAGTGGTTTGG - Intronic
986186730 5:5449059-5449081 GGGTTCTGCTTTGAATAGTAAGG - Intronic
988963556 5:36392933-36392955 GGCTTCTGCTGTGAGTGGGTGGG - Intergenic
989162278 5:38402994-38403016 GGCTTTTGTCTTCAGTAGTTTGG - Intronic
989278197 5:39612492-39612514 GGGTGCAGCCTTGAGCAGTTAGG - Intergenic
990303932 5:54476697-54476719 GCCTTCTGCACTGAGGAGTTTGG + Intergenic
990489151 5:56287218-56287240 GGCTTCTGTTTTGAACAGTTTGG + Intergenic
990974874 5:61550740-61550762 TGCTTCTGCCTTGAGTAGGAAGG - Intergenic
1000559701 5:162770692-162770714 TGATTCTGCCTTGAGTAGATTGG - Intergenic
1001163853 5:169345609-169345631 GCCTTCTGCTTGGAGAAGTTAGG + Intergenic
1001474805 5:172043000-172043022 CGCTTCAACCTTGAGTAGCTGGG - Exonic
1002815109 6:672562-672584 GGCTTCTGCACTAAGAAGTTGGG + Intronic
1003208352 6:4035849-4035871 CGCCTCAGCCTTGAGTAGCTGGG - Intronic
1005681168 6:28210019-28210041 TGCTTCTCGCTTGAGTAGTGGGG - Intergenic
1005909716 6:30297888-30297910 TTCTCCTGCCTTGAGTAGCTGGG + Intergenic
1007658567 6:43468018-43468040 GGCTGCTGACTTGAGGAGTGAGG - Intergenic
1007885633 6:45226645-45226667 TTCTCCTGCCTTGAGTAGCTGGG + Intronic
1008990591 6:57597225-57597247 GTCTTCTGCCTTGGGTGCTTGGG + Intronic
1009179166 6:60495771-60495793 GTCTTCTGCCTTGGGTGCTTGGG + Intergenic
1010094558 6:72025998-72026020 AGCTTCTGCCTTGATTTCTTGGG - Intronic
1010843166 6:80672483-80672505 GACTTCTACCTTGAGTTCTTGGG - Intergenic
1013550635 6:111204287-111204309 AGTTTCTGCCATGGGTAGTTGGG + Intronic
1014249433 6:119100301-119100323 GGTTACTGCCATGAGTAATTGGG + Intronic
1014815688 6:125933284-125933306 TGCCTCTGCCCTGAGTAGCTGGG - Intergenic
1016571883 6:145522434-145522456 GGTTTCTGCCTTAAGTGGATTGG - Intronic
1017622360 6:156311867-156311889 GGCTTCAGGCTTGAGCAGCTAGG + Intergenic
1019120855 6:169802233-169802255 GGCCTCTCCCTCCAGTAGTTCGG + Intergenic
1020334496 7:7052261-7052283 AGTTTCTGCCTTGTGGAGTTGGG - Intergenic
1023778085 7:43629325-43629347 GGCTTCTTCTGGGAGTAGTTTGG - Intronic
1024575849 7:50763657-50763679 TGTTTCTGCCTTGTGCAGTTTGG - Intronic
1025932529 7:66007809-66007831 GTCCTCTGCCTTCCGTAGTTGGG - Intergenic
1026150427 7:67783726-67783748 GGCGTCTGCCCTGAGATGTTTGG + Intergenic
1027620114 7:80474012-80474034 TGCTTCTGGCTTGAGCAGGTGGG - Intronic
1027953892 7:84855611-84855633 GGTTTCTCCCTTGAGAAGTGGGG + Intergenic
1030206861 7:106959703-106959725 GTCCTCTGCCTTGAGGAGTTGGG + Intergenic
1030761528 7:113358045-113358067 GGCTTTTACCTTGAGTAATATGG + Intergenic
1032174153 7:129610500-129610522 GGTTTCTGGCTTGAGCACTTGGG + Intergenic
1032183796 7:129705825-129705847 TGTTTCAGCCTTCAGTAGTTGGG - Intronic
1032903246 7:136335114-136335136 GGCAGCTGTCTTGAGTTGTTTGG - Intergenic
1034747105 7:153532467-153532489 GGTTTCTGGCTTGAGCAGTGGGG - Intergenic
1037760891 8:21740836-21740858 GGCTTCTGGCTTGAGCAGCTTGG - Intronic
1038189626 8:25308125-25308147 TGCTTCTGCCTTCAGTAGAATGG + Intronic
1039562325 8:38522572-38522594 TTCTCCTGCCTTGAGTAGCTGGG - Intronic
1041234892 8:55790630-55790652 TCCTTCTGCCTTGAGTAGCTGGG + Intronic
1041480131 8:58310875-58310897 GGATTCTGCCTTGAGGGCTTAGG + Intergenic
1041708270 8:60869544-60869566 GCCATCTGCCTTGAAAAGTTGGG + Intergenic
1042266601 8:66914930-66914952 TGTTTCTGCCTTGAGTAGCTGGG + Intronic
1044708999 8:95037342-95037364 AGCTTCAGCCTTGAGTAAATAGG + Intronic
1045891786 8:107166292-107166314 GACTTCTGCCTGGGGAAGTTGGG + Intergenic
1047725214 8:127678632-127678654 TGCTTCAGCCTCGAGTAGCTGGG - Intergenic
1052045784 9:23792675-23792697 GGGTTTTGGCTTGAGAAGTTGGG - Intronic
1052285907 9:26785636-26785658 GGCTTCTGCTTTAAGTAACTGGG - Intergenic
1055745347 9:79438206-79438228 GGCATCTTCCTTGTGTAGGTCGG + Intergenic
1055760058 9:79597633-79597655 GGTTTCTGGCTTGAGAAATTGGG - Intronic
1057495509 9:95557539-95557561 GGCTTCTCTGGTGAGTAGTTAGG + Intergenic
1057495842 9:95560296-95560318 GGCTTCTGGCTTGAGTAACTGGG + Intergenic
1057924752 9:99135245-99135267 GGCTTCTGCCTGGATAGGTTTGG - Intronic
1058807408 9:108605686-108605708 GGCTTCTGTCTGGATTTGTTTGG - Intergenic
1059758237 9:117313668-117313690 GGCTCCTGGCTTGGGGAGTTTGG - Intronic
1059827155 9:118043986-118044008 AACTTCTGGCTTGAGTAGTTGGG - Intergenic
1060043543 9:120322569-120322591 GGCTTCTGGCTTGAGCAGCTGGG - Intergenic
1060537555 9:124403015-124403037 AACTGCTGCCTTGAGTAGTTTGG - Intronic
1060897719 9:127228935-127228957 TGCCTCAGCCTTGAGTAGCTGGG + Intronic
1060909032 9:127334099-127334121 GGTTTCTGCCCTGGGTAGCTGGG + Intronic
1191188418 X:57638766-57638788 GGCTTGTGTCTTGATTGGTTGGG - Intergenic
1192879997 X:75273873-75273895 GGCTTCTGCATTCAGAACTTTGG - Intergenic
1195011902 X:100740996-100741018 GGCTTCTGCCTTCAGATTTTAGG - Intergenic
1198048598 X:132927099-132927121 GGATTCTGCCTTGAGAAGACTGG - Intronic
1201773911 Y:17644214-17644236 TGCTTCAGCCTTCAGTAGCTGGG + Intergenic
1201827646 Y:18261775-18261797 TGCTTCAGCCTTCAGTAGCTGGG - Intergenic