ID: 1097826360

View in Genome Browser
Species Human (GRCh38)
Location 12:64178545-64178567
Sequence GAGACTATGCCTTTGTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097826360_1097826361 5 Left 1097826360 12:64178545-64178567 CCACTTCACAAAGGCATAGTCTC No data
Right 1097826361 12:64178573-64178595 GATAAACAAGATTTAAAGTATGG No data
1097826360_1097826362 6 Left 1097826360 12:64178545-64178567 CCACTTCACAAAGGCATAGTCTC No data
Right 1097826362 12:64178574-64178596 ATAAACAAGATTTAAAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097826360 Original CRISPR GAGACTATGCCTTTGTGAAG TGG (reversed) Intergenic
No off target data available for this crispr