ID: 1097827314

View in Genome Browser
Species Human (GRCh38)
Location 12:64187373-64187395
Sequence GAAAATGGAGAGATGCAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 0, 3: 51, 4: 472}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097827314_1097827318 7 Left 1097827314 12:64187373-64187395 CCCATTTGCATCTCTCCATTTTC 0: 1
1: 0
2: 0
3: 51
4: 472
Right 1097827318 12:64187403-64187425 GATATTTTACACATACCCTACGG 0: 1
1: 0
2: 0
3: 9
4: 145

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097827314 Original CRISPR GAAAATGGAGAGATGCAAAT GGG (reversed) Intronic
901250974 1:7779599-7779621 GAAGGAGGAGAGATGCAAAAAGG - Intronic
902543029 1:17167679-17167701 GAAAATGCAGAGAGGAAGATGGG + Intergenic
903348736 1:22704758-22704780 GAGAATGGAGAGAAGCAACCAGG - Intergenic
903368817 1:22821662-22821684 GACAAGGGAGAGAGGAAAATGGG - Intronic
903739596 1:25550990-25551012 GAGAATGGGGACATGAAAATGGG + Intronic
906295414 1:44646300-44646322 CAAAATGGAGGGAAACAAATGGG - Intronic
906457406 1:46009045-46009067 AAAAAAAGAGACATGCAAATGGG - Intronic
906463947 1:46059286-46059308 GAAAATGGACTAATACAAATGGG + Intronic
906779846 1:48563450-48563472 GAAAATGGAGAGAGGAAGAGAGG + Intronic
907328266 1:53654818-53654840 AAAAATGGAGAGAGAGAAATGGG + Intronic
907615613 1:55922130-55922152 CAAAATGGACAGATACAAACAGG - Intergenic
908427724 1:64024176-64024198 GAAAATGGACTAATACAAATGGG + Intronic
909067658 1:70954965-70954987 GAAAAAAGAGAGAAGCGAATAGG + Intronic
909210871 1:72821369-72821391 GAAATTGAAGAGTTGAAAATAGG + Intergenic
909879530 1:80856192-80856214 TAAAATGTAAAGATACAAATAGG + Intergenic
909893820 1:81040474-81040496 GAAAATGGACAGATTAAATTTGG + Intergenic
911263986 1:95721627-95721649 GAAAAAGGAGAAAGGCAACTGGG - Intergenic
911753502 1:101525943-101525965 CAAAATGCAGAGATGGAAAAGGG - Intergenic
912066509 1:105751318-105751340 GATAGTGTAGAGATGCAAAAGGG - Intergenic
912406693 1:109444736-109444758 GAAAATGGGGAAATGAATATTGG + Intergenic
913197137 1:116466491-116466513 AGAAAGGGAGAGACGCAAATTGG + Intergenic
915840302 1:159207771-159207793 GAAAATGGTAAGATGGTAATTGG - Intergenic
916180464 1:162078902-162078924 GACAATGTAGGGATGAAAATTGG - Intronic
916330396 1:163609956-163609978 GCATATGGAGAGGTGGAAATGGG + Intergenic
917775041 1:178324487-178324509 GAAAATGGAAAAAAACAAATGGG - Intronic
917864914 1:179185129-179185151 GAAAGTAGACAGATGCATATTGG - Intronic
918062905 1:181077565-181077587 GAAAAAGGAGAGAAGGAAACAGG + Intergenic
918900818 1:190414599-190414621 GAAAATAGAAAGAGGCAAATGGG + Intronic
920084912 1:203408433-203408455 GAGAAAGGAGAGAAGCAGATAGG + Intergenic
920132000 1:203739494-203739516 GAAAATAGAGAGGTGAGAATTGG - Intronic
920967607 1:210714109-210714131 GAGTATGGAGAGAGGCAACTGGG + Intronic
921295145 1:213694322-213694344 GAAAATAGAGAGAGGAAAAAAGG - Intergenic
921563632 1:216688955-216688977 TAAAATACAGAGATGCATATGGG + Intronic
921620630 1:217322476-217322498 GAAAATGAAAAGATGGAAAATGG + Intergenic
922172203 1:223165335-223165357 GATACTAGAGAGAAGCAAATGGG - Intergenic
922425924 1:225492744-225492766 GAAAATTGAGAAAGGGAAATAGG - Exonic
924387168 1:243509743-243509765 GAAAATAGGGTGATTCAAATTGG + Intronic
924830051 1:247584208-247584230 GAAAAGGAAGAAATACAAATAGG - Intergenic
1063099749 10:2939194-2939216 GAAAGTAGGGAGATGCACATAGG + Intergenic
1063279132 10:4605404-4605426 AAACATGGGGAGATGCAAACAGG - Intergenic
1063351447 10:5359918-5359940 GAAAAAGAGGAGATACAAATTGG + Intergenic
1064313148 10:14229977-14229999 AGAGATGGAGAGAAGCAAATTGG - Intronic
1064809690 10:19181557-19181579 GGAAATGGAGATATGTAGATCGG + Intronic
1065322657 10:24523646-24523668 TAAAATGGAGTGATGAAGATGGG - Intronic
1066407610 10:35133912-35133934 TAATATGGAGAGCTGGAAATTGG + Intronic
1066672561 10:37856201-37856223 GAAAATGGAAAAATAGAAATAGG - Intronic
1067572133 10:47379459-47379481 GAAAATGAGGAGATGAAACTAGG + Intronic
1068259018 10:54554173-54554195 GAAAATGGAGTAAGGCAAAAGGG - Intronic
1069225168 10:65934207-65934229 GGAAATAGAGAAATGAAAATGGG - Intronic
1069315041 10:67088118-67088140 AAAAATTGAGAGATGCCAAATGG + Intronic
1070557410 10:77539303-77539325 GATAATGCAGAGATGGAGATGGG + Intronic
1071056421 10:81515298-81515320 GATAATGCAGAGATAGAAATTGG + Intergenic
1071102531 10:82055557-82055579 GAAAATGGAAAAAGGCAAATTGG + Intronic
1071126118 10:82336811-82336833 GCAAATGGAGAGATAAGAATTGG + Intronic
1071599185 10:86948542-86948564 GCAAACAGAGAGATGAAAATTGG + Intronic
1071989878 10:91091434-91091456 GAAAAGGGAGAGAGACAGATGGG - Intergenic
1072205608 10:93202575-93202597 GAAATGGGAGAGAGGCAGATGGG + Intergenic
1072826526 10:98612144-98612166 GAAATTGGAGAGAAGAAAACAGG - Intronic
1072883810 10:99255822-99255844 GAAAATGGACTAATGCAACTGGG - Intergenic
1073633024 10:105167641-105167663 AAAATAGGAGAGATGGAAATTGG + Intronic
1073800015 10:107031586-107031608 AAAAAAAGAGAGATACAAATTGG - Intronic
1074617626 10:115085607-115085629 GAAAATGAAGATGTGAAAATTGG - Intergenic
1074689007 10:115987145-115987167 GAAAATGGAGTAATACAAGTGGG - Intergenic
1075494543 10:122908615-122908637 GGAACAGGAGAGATGAAAATAGG - Intergenic
1077901134 11:6489872-6489894 GAAGATGGAGAGAAGGAAAATGG - Intronic
1078418056 11:11182154-11182176 GAAAATGGAGAAACAAAAATCGG - Intergenic
1078462430 11:11524555-11524577 GAAAATGGTGTGTTCCAAATAGG + Intronic
1079151968 11:17907986-17908008 AATAATGGAGAGAAGTAAATAGG - Intronic
1079197703 11:18344669-18344691 GATAATGAAGAGATTCACATAGG - Intronic
1079265590 11:18929065-18929087 GAATCTGGACAGATGGAAATTGG - Intergenic
1079790154 11:24727040-24727062 GAAAATAGAGAGATTTAAATTGG + Intronic
1081240656 11:40702423-40702445 GAAAATGGAAAGATGAAAGCAGG - Intronic
1081308935 11:41546918-41546940 CAAATTGGATAGAGGCAAATTGG + Intergenic
1082199663 11:49350025-49350047 GAAATAGGAGAGAAGCAAAAGGG - Intergenic
1083428093 11:62599649-62599671 GAAAAGGGAAAGATGTAAAATGG + Intronic
1086214217 11:84358429-84358451 GAAAATGAAGGCATGGAAATCGG - Intronic
1086498383 11:87426945-87426967 CAAAATGGAGAGTTGGTAATGGG + Intergenic
1086656003 11:89356205-89356227 GAAATAGGAGAGAAGCAAAAGGG + Intronic
1087070650 11:94076768-94076790 GCAGGTGGAGAGATGAAAATGGG + Intronic
1087170651 11:95046597-95046619 TAAACTGGAGAAAAGCAAATAGG + Intergenic
1087418929 11:97896250-97896272 GAAAATGAAAATATGCAAATAGG + Intergenic
1087501056 11:98954454-98954476 TAAAATGGAGAGATTCAACAAGG + Intergenic
1088489120 11:110369916-110369938 AAAAATGAAGAGAGGGAAATAGG - Intergenic
1088865923 11:113848013-113848035 GAAAATGGTGAAAGGCAGATGGG + Intronic
1090291242 11:125547004-125547026 CAAAATGGAGAAATACAATTCGG - Intergenic
1091023631 11:132123100-132123122 GAAAAGAGAGAGAAGCAAAGGGG - Intronic
1091814135 12:3423483-3423505 GAAATTGGAAAGATGAAAAATGG - Intronic
1091997437 12:5004946-5004968 GAAAGTGAAGAGATGGAAAAAGG + Intergenic
1092672660 12:10881922-10881944 GAAAATAGAGAGAGCCAAAGGGG + Intronic
1092952996 12:13525429-13525451 GGAAATGGAGGGATGGAAATGGG + Intergenic
1093147070 12:15579265-15579287 GGTAATGGAAAGAGGCAAATGGG + Intronic
1093573834 12:20701730-20701752 GGAAAGGGTGAGATGCTAATTGG + Intronic
1093601646 12:21033201-21033223 GAAAATGAAGAGTTGGAAAAAGG - Intronic
1093706430 12:22279614-22279636 CAGAATGCAGAGATGAAAATGGG - Intronic
1094660365 12:32464517-32464539 GAAAAAGGACAAATGCACATAGG + Intronic
1095442223 12:42248899-42248921 AAAAAGAGAGAGATGGAAATGGG - Intronic
1095511995 12:42961322-42961344 TAAAATAGAGGTATGCAAATTGG + Intergenic
1095602890 12:44034302-44034324 GAAAAAAGAGAGATGTAAACAGG + Intronic
1095702132 12:45201331-45201353 GCACATGGAGGGAGGCAAATTGG + Intergenic
1095985453 12:47996313-47996335 GAAGATGGGGAGATGCATATAGG - Intronic
1096447666 12:51708579-51708601 GGAAAGTGAGAGATGCAAGTGGG - Intronic
1096548085 12:52355041-52355063 GACAAAGGAGAAATGCAAAGGGG - Intergenic
1096977668 12:55708535-55708557 GCAAATGGAGAAATGGAAAAAGG + Intronic
1097269127 12:57763679-57763701 CAAAGGGAAGAGATGCAAATGGG + Exonic
1097728901 12:63105584-63105606 GAGAATGAAGAGATGAAAAAGGG - Intergenic
1097827314 12:64187373-64187395 GAAAATGGAGAGATGCAAATGGG - Intronic
1098946665 12:76597502-76597524 GAAAAGGGAAGGAGGCAAATAGG - Intergenic
1099019886 12:77390424-77390446 GAAGATTGAGAGATGGGAATGGG - Intergenic
1099077117 12:78123502-78123524 GAAAATGGGGAATTTCAAATTGG - Intronic
1099317240 12:81099802-81099824 GAAAAGGGAAGGATGGAAATTGG + Intronic
1100031916 12:90203025-90203047 AAAAATGGAGAAATGCTAATAGG + Intergenic
1100488820 12:95058065-95058087 AAAGAATGAGAGATGCAAATTGG - Intronic
1100584272 12:95964956-95964978 GCAAAGGGAGAGATGTGAATAGG + Intronic
1101147779 12:101857527-101857549 CAAAATGGAGAGATACATTTGGG - Intergenic
1101273235 12:103170705-103170727 GTAAATGGAGTGATGAAAAGGGG - Intergenic
1102752321 12:115306238-115306260 GAAAATGGAAACTTGAAAATGGG - Intergenic
1102910391 12:116709158-116709180 GAAGATGGAGAGATGGAAAGTGG - Intergenic
1103381042 12:120494796-120494818 GAAAATGTAGAAATGTAAATAGG + Intronic
1104516097 12:129428423-129428445 CAAAATAGAAAAATGCAAATTGG - Intronic
1104572098 12:129934459-129934481 GAAAATGGACTAATACAAATGGG + Intergenic
1105001183 12:132689844-132689866 AAAAATGGAGAAATCCGAATAGG - Intronic
1105285562 13:19000648-19000670 GAGAATTGAGAGATTCATATCGG - Intergenic
1105552608 13:21411442-21411464 TAAAATGGAGAGATTGAACTAGG - Intronic
1105698751 13:22917097-22917119 TATAATGAAGAGATGAAAATGGG - Intergenic
1105716176 13:23067187-23067209 GAAAATGAAGAGGTGGAAAGAGG + Intergenic
1105818624 13:24059818-24059840 GAAAATGAAGGCATCCAAATAGG - Intronic
1105850449 13:24329644-24329666 TATAATGAAGAGATGAAAATGGG - Intergenic
1106966720 13:35079855-35079877 GAAAATGAATAGTTGCAAAAGGG - Intronic
1107091357 13:36484616-36484638 GAAAATGAAGGCATGAAAATAGG - Intergenic
1108255703 13:48608820-48608842 GAAAATAGAGGGATGAAAAAAGG - Intergenic
1108539948 13:51432106-51432128 GAAAATGCAGAGATTTAAACTGG - Intronic
1108845262 13:54670629-54670651 GAAAATGGATATATTCAACTTGG - Intergenic
1108975385 13:56437215-56437237 GAAAATGGAGAGATGTAGTTTGG + Intergenic
1109065972 13:57691481-57691503 GACCATGGAGAGATGAAAAGTGG + Intronic
1109136522 13:58658084-58658106 GCAAAAGGAGAGAAGGAAATGGG - Intergenic
1109231920 13:59767601-59767623 GAAAAGGGAGAGATTCAGAATGG + Intronic
1109523148 13:63538829-63538851 GGAGATGGAGAGATACAAAGTGG + Intergenic
1109935747 13:69281975-69281997 GCAGATGGAAATATGCAAATAGG + Intergenic
1111101887 13:83598515-83598537 GAGAATGGAGAAATGCAAGGTGG - Intergenic
1111128426 13:83942364-83942386 AAAAATGAAGATATTCAAATGGG + Intergenic
1111244173 13:85513159-85513181 GAAAGTAGAGAGAAGGAAATGGG - Intergenic
1111614472 13:90645149-90645171 GAAAATGGTAAGTTGCTAATAGG - Intergenic
1112859954 13:103818323-103818345 CAAAAGGGAGAGATGCAAAATGG + Intergenic
1114133859 14:19824288-19824310 GATAATTGAAAGATGGAAATGGG + Intronic
1114913923 14:27237590-27237612 GAAAATGCAGATAGGGAAATAGG - Intergenic
1115210086 14:30958598-30958620 GAAAATTGAGAGATACATAATGG - Intronic
1115274906 14:31596904-31596926 AAAAATGGGGAGATGCAATCAGG + Intronic
1115320023 14:32069696-32069718 GAAAATGCAGAAATGTGAATTGG + Intergenic
1115327574 14:32158952-32158974 AAAAATGGAGTCATGCAAATAGG - Exonic
1115344193 14:32324794-32324816 GAGAATGCAGAGATGGAAAAAGG + Intergenic
1115396764 14:32917810-32917832 GAAAATGGGAGGAAGCAAATTGG - Intergenic
1117621604 14:57592965-57592987 ACAAATGGAGAGAAACAAATGGG + Intronic
1117928256 14:60808368-60808390 GAAAATGGAGATATACCAAAAGG + Exonic
1118157399 14:63255314-63255336 GGAAATGCAGAGAGGCAACTGGG - Intronic
1119157228 14:72422261-72422283 GAAAATGGACTAATACAAATGGG + Intronic
1119375124 14:74184727-74184749 GAAAATTGACAGATGAAAAGAGG - Intronic
1119641688 14:76320006-76320028 GAAAATGGATATATGCTCATTGG + Intronic
1120267824 14:82274193-82274215 GAAAATATAGAGATACAACTAGG + Intergenic
1120731064 14:88002190-88002212 GAAAGTGGACACATGCAAAGAGG + Intergenic
1120982322 14:90301015-90301037 GAAAATGGTGAGATGTGGATAGG - Intronic
1121368297 14:93334287-93334309 GAAAATGAAGTAATACAAATTGG - Intronic
1121701937 14:95961348-95961370 GAAAAGAAAGAGATGGAAATTGG + Intergenic
1121786667 14:96666633-96666655 GAAAGTGGGGAAATCCAAATAGG - Intergenic
1123172762 14:106389961-106389983 GAAATAGGAGACATGCAAATAGG - Intergenic
1123952078 15:25288868-25288890 AAAAATGGAGATTTACAAATTGG + Intergenic
1124123917 15:26918802-26918824 GAAAATGAAGGGATGGAAAAGGG - Intronic
1124786487 15:32686121-32686143 GGAAATGGAATAATGCAAATTGG - Intronic
1124947736 15:34285932-34285954 GAAAATGGAGAGTTGTTCATTGG + Intronic
1125786487 15:42322857-42322879 GAAAATGGAGAGAGGAGAAGGGG + Intronic
1125859233 15:42982305-42982327 CAAAATAGTGATATGCAAATAGG + Intronic
1125975173 15:43944835-43944857 CAGAAAGGAGAGAGGCAAATGGG - Intronic
1126038494 15:44569276-44569298 GAAAATGGAGGGAAGGAATTAGG - Intronic
1126663808 15:51057238-51057260 GAAAAAGTATAGCTGCAAATTGG - Exonic
1127737808 15:61861262-61861284 GAAAATAAGGAGATGAAAATAGG - Intronic
1129650437 15:77483428-77483450 GAAAATGGAGATGTATAAATTGG - Exonic
1130416766 15:83701652-83701674 GAAAATGAAGGGATGCAAAGTGG - Intronic
1130431784 15:83855625-83855647 GAATGGGGAGAGATGGAAATAGG + Intronic
1131223955 15:90608345-90608367 GAAAAGGGAGAGAGGCAGACAGG - Intronic
1131837956 15:96409295-96409317 GAAAAAGGACAAGTGCAAATAGG + Intergenic
1132357415 15:101182582-101182604 GATAATGGGGAAATGGAAATTGG + Intronic
1133889663 16:9867289-9867311 GGAATGGGAGAGATGCAATTAGG - Intronic
1134326819 16:13215084-13215106 GAGGATGGAGAGAAGAAAATGGG + Intronic
1134540819 16:15063827-15063849 GAAAATGGAAAGATGAAAAACGG - Intronic
1135590741 16:23703450-23703472 GAAACTAGAGAGAGGAAAATAGG - Intronic
1135882682 16:26274112-26274134 GAGAATGGAGAGAAGAAGATGGG - Intergenic
1136263992 16:29103510-29103532 GAAAATGGAAAGATGAAAAATGG + Intergenic
1136680933 16:31961789-31961811 GTAATAGGAGACATGCAAATAGG + Intergenic
1136781252 16:32903302-32903324 GTAATAGGAGACATGCAAATAGG + Intergenic
1136888546 16:33950538-33950560 GTAATAGGAGACATGCAAATAGG - Intergenic
1139611095 16:68059287-68059309 AAAATTTGAGAGATTCAAATGGG - Intronic
1140715789 16:77724231-77724253 AAACATGGAGAGATGCACACAGG - Intronic
1203083908 16_KI270728v1_random:1167284-1167306 GTAATAGGAGACATGCAAATAGG + Intergenic
1142989802 17:3722977-3722999 GGAAATGGAGAGAAGTGAATGGG + Intronic
1145092853 17:20000290-20000312 GAGAATGGAAAGAAACAAATAGG + Intergenic
1145353598 17:22114075-22114097 GAAGTTGGAGAGATGCACATTGG + Intergenic
1146165445 17:30584836-30584858 GAGAATGGAAAGAAACAAATAGG + Intergenic
1146250855 17:31342603-31342625 GCAAATGGAGCATTGCAAATGGG + Intronic
1146604244 17:34244667-34244689 GAAAAAGGAGAACTGCAAAGAGG + Intergenic
1147352123 17:39857660-39857682 GAAAATAGAGACATTGAAATTGG - Intronic
1149295498 17:55258462-55258484 GAAAATGGTGAGAAGAAAAAAGG + Intergenic
1149821593 17:59784324-59784346 GAAAAAGTAGACATGCAGATGGG - Intronic
1149900819 17:60476132-60476154 GAAAATGAATAAATGGAAATAGG + Intronic
1150006358 17:61471367-61471389 TAAAATGTTAAGATGCAAATAGG - Intronic
1150122338 17:62614582-62614604 GAAGATGGAGTGTTTCAAATTGG + Intronic
1150236839 17:63600255-63600277 GAAGATGGAGAGAAACAAAGCGG - Intergenic
1150580831 17:66472466-66472488 AAAATTGGAGAAATGCTAATAGG - Intronic
1150856123 17:68754586-68754608 GAAAAAGGAGAGAATCAAACAGG - Intergenic
1150915740 17:69435162-69435184 GAAAATGGAAAAATGCATTTTGG - Intronic
1150928238 17:69556685-69556707 GAAAATGGAGAAAGGAAATTGGG + Intergenic
1151152305 17:72098576-72098598 GAAAATGCTGAGATCCAAAGAGG - Intergenic
1152055236 17:78019774-78019796 GAAAATGCTGATATGCAAAAGGG + Intronic
1152204731 17:78968436-78968458 GAACAAGGAGAAATGCAGATGGG - Intergenic
1153235793 18:2985977-2985999 GAAAATGCAGAAATGCACTTAGG - Intronic
1153733534 18:8040862-8040884 AAAAATGGAGAGATTCTGATTGG - Intronic
1155724701 18:29066070-29066092 GAGAATGTGGAGATGAAAATAGG - Intergenic
1155845603 18:30702093-30702115 GAGAATGGATAGATGTGAATAGG + Intergenic
1156528632 18:37793724-37793746 GAAAATAAAGAAATGCAAATAGG - Intergenic
1156652300 18:39238634-39238656 GAAAATGGAGGTATTAAAATAGG + Intergenic
1157004489 18:43565694-43565716 GACACTGGACAGATGCAATTAGG + Intergenic
1157712106 18:49857292-49857314 GCACAGGGAGAGATGCAAAAGGG + Intronic
1157799503 18:50607712-50607734 GAGAATGGAAAGATGACAATTGG - Intronic
1158371479 18:56810922-56810944 GAACATGGAGTAATGCTAATGGG - Intronic
1159553119 18:69917517-69917539 GTAAATGAAGAGGTGCATATAGG - Intronic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159701424 18:71632747-71632769 GAAAATTGAGAAAGGAAAATAGG + Intergenic
1159734124 18:72073313-72073335 GAAAATGGAGTGATGCATTTTGG + Intergenic
1160315061 18:77835774-77835796 GTGTATGGAGAGATACAAATAGG + Intergenic
1160693414 19:470758-470780 GAAAATGGAGGGATGGAATTTGG + Intronic
1160871653 19:1280503-1280525 GCAGATGGAGAGATGCAAACGGG - Intergenic
1160953386 19:1678352-1678374 GAAGATGGAGAGAGACAAAAAGG - Intergenic
1163807899 19:19411126-19411148 GAACATGGAGAGAGGGGAATAGG - Intronic
1164299018 19:23942815-23942837 AAAAGTGGAGAGATGGAAAAAGG - Intronic
1164392527 19:27838017-27838039 AAAAATGAAGAGGTGAAAATGGG - Intergenic
1165222097 19:34324770-34324792 GAAAGTGGAGAGGTACAAAAGGG - Intronic
1165406535 19:35634225-35634247 GAAAGGGGAGAGGTGCAAAGGGG - Intronic
1167720237 19:51174472-51174494 GAGAATGGTGAGCTGCAAAGAGG + Intergenic
1167841682 19:52126803-52126825 GAAAATGAAGAGAGTCTAATGGG + Intronic
925435097 2:3830202-3830224 GAAACTGCAGAGATGCATTTAGG - Intronic
925663851 2:6232025-6232047 ACAAATGGAGGGATGCAATTTGG + Intergenic
927027836 2:19088272-19088294 AAAAATGGACAGATGTGAATAGG - Intergenic
928124955 2:28608883-28608905 TAGAATGGAGACATGAAAATTGG - Intronic
930276745 2:49319889-49319911 GAAAGGTGAGAGATGCAAAAAGG + Intergenic
930722592 2:54652021-54652043 GAATATGGAGAAATGCTAAGTGG - Intronic
933346288 2:81089785-81089807 GAAAATTAAGAGATTCAAGTTGG + Intergenic
933710488 2:85322177-85322199 GAAGATGGGGAAATGCCAATGGG - Exonic
933860881 2:86466315-86466337 GATAATGGAGAGATAAAAAGAGG + Intronic
935474392 2:103500307-103500329 GAAGATAGTGAGATGGAAATGGG - Intergenic
935840459 2:107103796-107103818 GAAATTGAAGACATCCAAATGGG - Intergenic
936146129 2:109981600-109981622 GGAAGGGGAGAGATGCAAAGAGG - Intergenic
936198561 2:110389879-110389901 GGAAGGGGAGAGATGCAAAGAGG + Intergenic
937188280 2:120067277-120067299 GAGAATGGAGAGAAGCAGCTAGG + Intronic
939083862 2:137693906-137693928 GCAAATGGAGAGCAGGAAATTGG + Intergenic
939104447 2:137932922-137932944 GAAAATGGAGACATAAAAGTTGG - Intergenic
939641594 2:144646165-144646187 GATAATGGAGAGTTGAGAATGGG + Intergenic
939650837 2:144759778-144759800 GATGATGGAGAGATACAGATGGG - Intergenic
939681587 2:145141622-145141644 GACAATGGAGAGGTTCAACTAGG + Intergenic
939820751 2:146954459-146954481 GAAAATGGATGAATGCTAATAGG + Intergenic
940116011 2:150209154-150209176 GATAATGGACAGGTGTAAATAGG + Intergenic
940160964 2:150713179-150713201 GAAAATGGCAAATTGCAAATGGG - Intergenic
940524131 2:154790723-154790745 GAAAATGTAGACATTCTAATAGG - Intronic
942436141 2:175979118-175979140 GAAAATGGAGAGATACATTTGGG + Intronic
943081827 2:183265480-183265502 TAAAGTAGAGAGATGCAACTGGG + Intergenic
943428376 2:187765626-187765648 GAAAAAGGAAAGTAGCAAATGGG + Intergenic
943431380 2:187806578-187806600 ATAAATGGAGAGACGCAAACAGG + Intergenic
943490611 2:188550925-188550947 TGAAATGGAGACATGAAAATTGG - Intronic
943524385 2:188998065-188998087 GAACAGAGAGAGATGAAAATGGG + Intronic
945272197 2:207952298-207952320 GAAAATGGAGGGATGGAAGGAGG - Intronic
946500674 2:220244253-220244275 GAAAATGGAGAAAAGGAAAGAGG + Intergenic
1169036922 20:2461490-2461512 GAGGATGTACAGATGCAAATGGG + Intergenic
1170084787 20:12516585-12516607 TAAAATAGAGATATACAAATAGG - Intergenic
1170114174 20:12839000-12839022 GAAAATGGAGAGATACTCAATGG - Intergenic
1171754025 20:29084100-29084122 GAAAATGGATTAATGCAAAAAGG - Intergenic
1173365539 20:42381358-42381380 GAAAATAGAAAGCGGCAAATTGG - Intronic
1175492999 20:59391539-59391561 AAAAAGGGAGAGCTTCAAATTGG - Intergenic
1176905755 21:14498665-14498687 GAAAGTATAGAGATGCACATGGG + Intronic
1177548803 21:22594568-22594590 CAAAATGGACACAGGCAAATAGG - Intergenic
1177944891 21:27455822-27455844 GAAAAAGGAGATAAGAAAATGGG - Intergenic
1179177491 21:39019625-39019647 GAAAATGGAGAGCTGGCACTTGG + Intergenic
1179963152 21:44782981-44783003 CAAAATGGAGAGTTGCAGATTGG + Intronic
1180753628 22:18144505-18144527 CAAAATGCAGAGAAGAAAATAGG + Intronic
1181135194 22:20760658-20760680 TAAAAAGGAGAGATGGAAACTGG - Intronic
1182330000 22:29544979-29545001 GAAAATGGACTAATGCAGATGGG - Intronic
1182580820 22:31309727-31309749 GGGAATGGAGAGTTGGAAATTGG - Intergenic
1182898712 22:33880073-33880095 AAAAATGGAGAGGTGACAATTGG - Intronic
1183064098 22:35351816-35351838 GAACATAGAGAGATGCAGAGGGG - Intergenic
1183154426 22:36064109-36064131 GGATAAAGAGAGATGCAAATAGG - Intergenic
1183903627 22:41023601-41023623 GAGAATGGAGAGATCAAAATAGG + Intergenic
1185131109 22:49039350-49039372 GACAATGGAGAGTCCCAAATGGG - Intergenic
951584446 3:24201144-24201166 GAAAATGAAGAGAAGCAGGTAGG + Intronic
952564947 3:34644058-34644080 GGAAATAAAGAGATGCAAATTGG + Intergenic
952720880 3:36531484-36531506 ACAAATGGAGAGATGCAGACAGG + Intronic
953439753 3:42907225-42907247 GAAAATGGGGACATGGAGATTGG + Intronic
953478219 3:43224660-43224682 GGAAATGGGGAGATGAAAGTAGG - Intergenic
956262839 3:67363981-67364003 GAAACTGGAGAAATGCCAATGGG + Intronic
956405122 3:68920577-68920599 GAGAAGGGAGAGATAGAAATGGG + Intronic
957080785 3:75633997-75634019 GGAAATTTAGAGATGCAAAGTGG + Intergenic
958204562 3:90373076-90373098 TCACATGCAGAGATGCAAATAGG + Intergenic
958270975 3:91499356-91499378 GAGAATGGACAGTTGCAATTAGG - Intergenic
959031288 3:101301714-101301736 GAAACTTGAGAGATGTAAATAGG - Intronic
959173934 3:102880713-102880735 GAAAATGGTGAGAAACAAGTAGG - Intergenic
959479254 3:106851443-106851465 GAAAATGGAGATATACATGTAGG + Intergenic
960814441 3:121658476-121658498 GAAAATGAAGCAAAGCAAATGGG + Intronic
960850829 3:122052300-122052322 GGAAATGGGGAGATGCCCATAGG - Intergenic
961864900 3:129946536-129946558 GAAACTGGTGAGATGCAAGACGG - Intergenic
962457318 3:135576693-135576715 GAAAAGGGAGAAAGGAAAATCGG - Intergenic
962472967 3:135730191-135730213 GCAAATGGAGAAAAGCAAAAAGG - Intergenic
963127683 3:141830353-141830375 GAAAAAGTATAGATCCAAATTGG - Intergenic
963268048 3:143258648-143258670 GAAAATGGAGACAAGGAAGTCGG - Intergenic
963763072 3:149304978-149305000 GAAAATAAAGAGATGGAAAGAGG - Intergenic
964683015 3:159363015-159363037 GAGAAGGGAGAGAGGGAAATGGG - Intronic
964736623 3:159924841-159924863 GGATATGGAGAGAAGCAAATGGG + Intergenic
964858354 3:161171982-161172004 GAAAATAGAGACATAAAAATAGG - Intronic
965087237 3:164114155-164114177 GAAGATGGAGAGATGATAAGAGG + Intergenic
965376733 3:167933870-167933892 GAAAAAGGCCATATGCAAATTGG + Intergenic
966319392 3:178684350-178684372 GGAAATGGGGAGATGTAGATTGG + Intronic
966674563 3:182571645-182571667 TAAAATGGAGAAAGGCAAATAGG - Intergenic
969911815 4:10454432-10454454 GAAGATGGAGATAAGTAAATGGG + Intronic
970051035 4:11915508-11915530 GAAAATTGAGAGATGAAGATTGG + Intergenic
970156517 4:13147524-13147546 GAAGCTGGAGAGAGACAAATGGG + Intergenic
970826972 4:20287657-20287679 GACAATGGAGAGATGCTTCTAGG - Intronic
971026750 4:22596399-22596421 GACAATTGAGAGATAGAAATGGG + Intergenic
972160014 4:36213168-36213190 AAAAATGAAGAGGTACAAATAGG + Intronic
973026363 4:45277269-45277291 GAAATTGGAGAGAAGCTAATAGG - Intergenic
973824681 4:54693326-54693348 GAAAAGGGAGAGAGGCTAAGTGG - Intronic
973867222 4:55125737-55125759 GGAAATGGGGAGATGTAAATGGG - Intergenic
973925502 4:55733309-55733331 GAGAATGGTGACATGCAATTTGG + Intergenic
974321264 4:60353370-60353392 GAAGATGGAGTGTTTCAAATTGG - Intergenic
974670191 4:65020347-65020369 GACAATGGAGATTTGCAGATGGG + Intergenic
975271776 4:72443731-72443753 GAAAAAGGAGTGGTTCAAATGGG - Intronic
975854837 4:78613161-78613183 GAAATTGGGGAAATGGAAATAGG - Intergenic
976151071 4:82092375-82092397 GAGAATGGAGAGCTACATATTGG + Intergenic
977171352 4:93766554-93766576 CAATATGGTGTGATGCAAATAGG + Intronic
977337573 4:95717985-95718007 GGAAATGGAGATATTCAATTTGG - Intergenic
977697227 4:99980289-99980311 ACAAATGGAGAAATGTAAATGGG - Intergenic
978128452 4:105163702-105163724 GACAATGGAGATTTGCAAATAGG - Intronic
979005768 4:115295276-115295298 GAAAATGGTGAGAAGCAGAAAGG + Intergenic
979666799 4:123320149-123320171 GAAAATTGCGACAAGCAAATAGG + Intergenic
979863074 4:125718600-125718622 AAATATGGAGAGATGCACAGAGG - Intergenic
979999785 4:127473657-127473679 GATGATGGAGACATGCAGATGGG - Intergenic
980317565 4:131222314-131222336 GAAAATGGAGTGATGAGAGTGGG - Intergenic
980851881 4:138393149-138393171 GAAAAAGCAGAGATGCCCATGGG + Intergenic
981072354 4:140557121-140557143 GCAAATGGAGGGAAGCAAGTTGG - Intergenic
981088334 4:140706620-140706642 GTTAATGGAGAGAGGGAAATGGG - Intronic
981136461 4:141216093-141216115 GGAAATGGAGAGGGGCTAATCGG - Intergenic
981214794 4:142151533-142151555 GAATATGGAGAGGTCAAAATTGG - Intronic
982153532 4:152492034-152492056 GAAAATGGTGATATTCAACTGGG - Intronic
982910055 4:161128966-161128988 GAAAATTGAAAGATGAACATAGG - Intergenic
983875240 4:172867483-172867505 GAAAAATGAGAGAGGAAAATAGG + Intronic
985384986 4:189435933-189435955 GAAAATAGTGAGGTGGAAATAGG - Intergenic
985407845 4:189654077-189654099 GAAAAAGCAGACATTCAAATGGG + Intergenic
985724278 5:1507561-1507583 GGAAATGCAGAGATGAAGATGGG + Intronic
986292975 5:6415200-6415222 GAAGATGCAGAGATGCAGAGGGG - Intergenic
986736884 5:10674621-10674643 GAGAATGCAGAGGTGCAATTGGG + Intergenic
986849364 5:11793241-11793263 GAAAATGGAGAGGAGCAAGTAGG - Intronic
987274392 5:16346656-16346678 GAAGATGGAGAGCTGCATAAAGG + Intergenic
987845918 5:23285643-23285665 GAAAAAAGAGAGATGGAAAAAGG - Intergenic
988904561 5:35772938-35772960 GAAAATAGAGCTATGTAAATGGG + Intronic
989303525 5:39923716-39923738 GATATTGGAGAGATGTAACTAGG - Intergenic
990132701 5:52607091-52607113 GAAAATTCAGAGATGAAAAGAGG - Intergenic
990625398 5:57605016-57605038 GAAAATGGTGAGGTGTAAAGTGG + Intergenic
991117180 5:62968072-62968094 AAAAATGGGAAGAAGCAAATGGG - Intergenic
993622371 5:90183828-90183850 GAAAATGTAGAGATGTAGATTGG - Intergenic
994554798 5:101285239-101285261 TAAAAGGGCCAGATGCAAATGGG + Intergenic
994654162 5:102568906-102568928 GAAAATGAAGGGATGCAAAAGGG - Intergenic
995376040 5:111475361-111475383 GAACTTGGAGAGATGGAAGTAGG + Intronic
995401376 5:111745909-111745931 ACAAATGGAAAGATGCAGATGGG + Intronic
995432763 5:112100083-112100105 GAAAATGAGAAGATACAAATGGG - Intergenic
995542925 5:113201972-113201994 GAAAGAGGAGCGATGAAAATGGG - Intronic
996031707 5:118712286-118712308 TAAAATGGAGATATGTAAACTGG + Intergenic
996055711 5:118980027-118980049 GAAAATGAAGAAATGAACATTGG - Intronic
996316689 5:122168387-122168409 CATATTGGAGAAATGCAAATTGG - Intronic
996588243 5:125115835-125115857 GAAACTGGAGAAGTGCAGATGGG + Intergenic
997230831 5:132241620-132241642 GAAAATGCAGAAATCCCAATAGG - Intronic
997761121 5:136448281-136448303 GAAAATACAGAGCTGCAAAATGG + Intergenic
997884637 5:137619314-137619336 GTAGATGGAGAGATGCCATTGGG + Exonic
998127831 5:139636137-139636159 GGAAATGGAGAAATGGAAAGGGG + Intergenic
998394758 5:141811593-141811615 GGAAAGGGAGAGATGGAGATGGG - Intergenic
999040756 5:148408456-148408478 CAAAATGGAAAGATGCCTATTGG + Intronic
999701464 5:154232342-154232364 GATAATGGTCAAATGCAAATAGG + Intronic
1000126040 5:158245070-158245092 GAAAATGGAGAGAGAAAAATGGG - Intergenic
1000168980 5:158682969-158682991 GAACAAGAAGAGATGCAAAGAGG + Intergenic
1000485902 5:161843866-161843888 GAAAAAAGAGAGAGGAAAATTGG + Intergenic
1000500103 5:162037206-162037228 GAACATGGAGAGAAGGAGATGGG + Intergenic
1000582925 5:163055967-163055989 GAAGATGGAGAAATGCCAAAAGG + Intergenic
1000679555 5:164166236-164166258 GAAAATGGAGACAGGCAAGGTGG - Intergenic
1001916189 5:175562216-175562238 TAAACTGGATAAATGCAAATGGG + Intergenic
1002211481 5:177602044-177602066 GAGACTGGAGAGATGGATATGGG - Intronic
1002333515 5:178461850-178461872 GAAAATATAGGGGTGCAAATTGG + Intronic
1002622193 5:180495390-180495412 CAAAAAGGAGGGATGCAATTTGG - Intronic
1002988886 6:2219193-2219215 TAAAATATAAAGATGCAAATGGG - Intronic
1003329003 6:5113965-5113987 GAAAATGGAGAGATGGATGCTGG - Intronic
1003818327 6:9866507-9866529 GAAAATGGACTAATACAAATGGG + Intronic
1003957170 6:11174622-11174644 GGAGATGGGGAGATGCAGATAGG - Intergenic
1003969986 6:11290139-11290161 GGAAATGGACACAGGCAAATAGG - Intronic
1004761936 6:18677025-18677047 GAAAATGGAGAGGAACCAATAGG + Intergenic
1005565028 6:27082894-27082916 GAAAATGGAGACATTCAGGTTGG + Intergenic
1005861136 6:29902144-29902166 ATAAATGGAGAGATGCGAGTTGG + Intergenic
1006979751 6:38137674-38137696 GGAAAGGGGGAGCTGCAAATAGG + Intronic
1008314951 6:50028422-50028444 GAAAATGGAGACATTGCAATTGG + Intergenic
1010346609 6:74817869-74817891 GAAAATGAAGAGTTGGAAAAAGG + Intergenic
1010434211 6:75811404-75811426 GAGGATGGAGAGAAGCAAAAAGG - Intronic
1010502636 6:76619977-76619999 GAAAATGCAGACAAGCAAAGAGG - Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011645879 6:89457393-89457415 GAAGATGGAGACTTGCAAACAGG - Intronic
1011793364 6:90924766-90924788 GAAAATGGAGACATGGAAGGTGG + Intergenic
1012392104 6:98753574-98753596 TAAAATGTAAACATGCAAATAGG - Intergenic
1012963656 6:105649169-105649191 GAAAATGGAGAAATGGTCATGGG - Intergenic
1012980095 6:105820108-105820130 GAAGGTGGAGAGAAGTAAATAGG + Intergenic
1013026996 6:106285103-106285125 GAGAATAGAGAGATGGAAATTGG - Intronic
1014219752 6:118788035-118788057 TAAAAAGAAGAGATGCTAATGGG - Intergenic
1015259232 6:131215592-131215614 AAAAATGGAGTTATGCAAAGAGG + Intronic
1015334904 6:132025770-132025792 TAAAATGAAGAAATGCAAAGAGG - Intergenic
1015686033 6:135861884-135861906 GAAATTGAAGAGATGCCAGTTGG - Intronic
1016137092 6:140557202-140557224 GAAAGTGGAGAGAAGAAAAAAGG + Intergenic
1016376478 6:143426100-143426122 GAAAGTGGTGAGATACAAAAAGG - Intronic
1016700704 6:147050710-147050732 GAAAATTGAGAGATGACAATTGG - Intergenic
1017170623 6:151451250-151451272 AACAATGGAGAAATGCAAAGTGG - Intronic
1017296861 6:152807587-152807609 GAATATGAAAAGATGCAGATGGG + Intergenic
1020004309 7:4774224-4774246 GAGAATGAAGAGATGGGAATCGG - Intronic
1020515839 7:9117939-9117961 GAAAATGGAAAGAGACACATGGG - Intergenic
1020572455 7:9883150-9883172 GAAAATGCGGAGATGGAGATTGG + Intergenic
1020597902 7:10232986-10233008 GTAAATGTACAGAAGCAAATCGG - Intergenic
1020718593 7:11711915-11711937 CAAAATGGAGAAATCCAAATAGG - Intronic
1021137432 7:16982694-16982716 GAAAAAGGAGAGAGGCAGAAAGG - Intergenic
1021206769 7:17789870-17789892 GAAAAGGGAAAGATGGAAAAAGG - Intergenic
1022189497 7:28003656-28003678 GGAAATGGAGAGGAACAAATGGG - Intronic
1022315016 7:29237755-29237777 GATAAATGAGAGATGCATATAGG + Intronic
1022342002 7:29477587-29477609 AAAGATGGAGAGAAGCAAAAAGG - Intronic
1022393309 7:29961925-29961947 GAAGATGGAGAGAGGCTAAGTGG + Intronic
1022484614 7:30768868-30768890 GAATGGGGAAAGATGCAAATGGG - Intronic
1022742652 7:33137669-33137691 GAAACTGGAGAGACGCACTTGGG + Intronic
1023646123 7:42317999-42318021 GAAAATGGAGAGGGGCAAGATGG + Intergenic
1023674490 7:42616001-42616023 GAAAATGGAGAGATTCATTTTGG - Intergenic
1023689813 7:42774095-42774117 GCAGATGGAGAGATGAAATTGGG - Intergenic
1025813852 7:64891839-64891861 AAAAATGGAGAAATGCACATGGG - Intronic
1025818866 7:64945096-64945118 AAAAATGGAGAAATGCACATGGG + Intergenic
1026496862 7:70911066-70911088 GAAAAAGGAGAGATGGAAGAGGG + Intergenic
1027916791 7:84334746-84334768 GAAGATGGAGGGATGAAAAGTGG - Intronic
1028341397 7:89724429-89724451 GAAAAGGGAGAGATTAAAAAAGG + Intergenic
1028378206 7:90169967-90169989 GAAAAAGGAGAGAGAAAAATGGG - Intronic
1028705655 7:93842058-93842080 GAAAATTAAGAGAGGCTAATAGG - Intronic
1028910070 7:96197899-96197921 AAAAATGGAGAGATGCTATAGGG + Intronic
1029931054 7:104371269-104371291 AGAAGTGGAGAGATGAAAATGGG - Intronic
1030454541 7:109756782-109756804 GAAAATAAAGACATTCAAATAGG - Intergenic
1030535647 7:110763092-110763114 GAAAATGAAGAAATCCACATTGG + Intronic
1030742713 7:113128726-113128748 GGAAAGGGGTAGATGCAAATGGG - Intergenic
1030828712 7:114193924-114193946 GAAAATTGAGAGATGCAATGTGG + Intronic
1031230376 7:119098011-119098033 GAAAATGTATATATACAAATTGG - Intergenic
1031634673 7:124087330-124087352 GAAAAAGTAGAGAAGCAAATAGG - Intergenic
1032812419 7:135434066-135434088 GAAACTTGGGAGATGCAAGTAGG - Intronic
1033496059 7:141897447-141897469 GAAAAAGAATAGATACAAATAGG + Intergenic
1037981065 8:23254771-23254793 GAAAATGGAGAGACTACAATTGG + Intronic
1038087574 8:24216827-24216849 GAAACTGGAGAGTTAAAAATGGG + Intergenic
1038387246 8:27160073-27160095 GAGAATGGAGAGAAGAGAATTGG - Intergenic
1038641660 8:29333883-29333905 GAAGATGGAGAGAGGGACATAGG - Exonic
1038845588 8:31226485-31226507 GAAAAGGGAGAGAGGAAAAAAGG - Intergenic
1040727093 8:50394362-50394384 GAAAATGGAGAGAGGAGGATGGG + Intronic
1040986929 8:53305701-53305723 AAAAATGAAGAGGTGAAAATGGG + Intergenic
1041657021 8:60362909-60362931 GCAAATGGAAAGAGGAAAATGGG + Intergenic
1041774558 8:61509780-61509802 GAAAAAGGAGAGATGTGAGTAGG + Intronic
1041897763 8:62946065-62946087 GAAATTGAAGAGAAGCACATGGG - Intronic
1042118487 8:65458436-65458458 GAAAATCGAGAGAAGAAAAAGGG + Intergenic
1042126553 8:65543243-65543265 GAAAATGGAGAGATGTTCAATGG + Intergenic
1042813799 8:72855522-72855544 GAATATGGAGAGATGATACTGGG - Intronic
1043503206 8:80876192-80876214 GAAAATGGTGTGATCTAAATGGG - Intergenic
1043601759 8:81948348-81948370 AATAATGTAGATATGCAAATAGG + Intergenic
1044758669 8:95493609-95493631 GAAAAAGGAGAAAGGCAAAGGGG + Intergenic
1045019062 8:98025771-98025793 AAAAATGGACAGATCCAAAATGG - Intronic
1045837033 8:106534827-106534849 GAAAATGGAAAGAGGTTAATAGG + Intronic
1046171887 8:110519827-110519849 GAAATTGAAGAGATGGAAAAAGG + Intergenic
1046845003 8:118905774-118905796 GAAAAACAAGAGATGCAAAAGGG - Intergenic
1047283775 8:123468364-123468386 GGATATGGAGAGAGGAAAATGGG - Intergenic
1047397857 8:124518685-124518707 GAAAATGGACTGATTTAAATGGG - Intronic
1047423039 8:124722952-124722974 GAAAAAGCCGAGATGCAAATTGG + Intronic
1049946802 9:604946-604968 GAAAATGGACTAATGCAATTGGG + Intronic
1051406210 9:16740312-16740334 GAAAATGGGGAAAGGCAGATAGG + Intronic
1051907598 9:22114431-22114453 GAAAATGGAGAGGTACATAGAGG + Intergenic
1052439555 9:28477478-28477500 GAAAATGGAGAATTTCAATTTGG - Intronic
1052581021 9:30354126-30354148 GAATAAGGGGAGATGCAACTTGG - Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1052887026 9:33659398-33659420 GAAAAAGAAGACATGCAAAGGGG + Intergenic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1054878037 9:70116889-70116911 GAAAATAGAGAGAGGGAGATGGG - Intronic
1055537076 9:77259498-77259520 GAAAATGCAGGGATAAAAATGGG + Intronic
1055792705 9:79940011-79940033 AAAAATGGAGAGATGCGATTAGG - Intergenic
1056060240 9:82877827-82877849 GAAAAAGGAGGGATGGAAAGAGG + Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057963094 9:99476087-99476109 GAACATGAAAAGATACAAATTGG + Intergenic
1058082067 9:100711390-100711412 GAAAATGGACTGATGCAAGGAGG - Intergenic
1058194780 9:101958951-101958973 AGAAATGTAGAAATGCAAATTGG + Intergenic
1059751807 9:117254496-117254518 GACAATGGTGAGACACAAATGGG + Intronic
1060272567 9:122157152-122157174 GAAAATGCAGAGAGTCAAAAAGG - Intronic
1061171626 9:128960391-128960413 TATAATCGATAGATGCAAATTGG - Intronic
1061323267 9:129845781-129845803 GAAAATGCAGAAAAGCAAAAAGG + Intronic
1061528646 9:131191586-131191608 TAATATGGAGACATGCAAAAAGG - Intronic
1203658933 Un_KI270753v1:23502-23524 GAAAAAGCAGACATTCAAATGGG + Intergenic
1186118867 X:6335961-6335983 CATAACGGAGAGATGCAAGTTGG + Intergenic
1186281286 X:7995600-7995622 GAAAAGGAGGAGATGGAAATAGG - Intergenic
1186533376 X:10320324-10320346 TAAAAGGGAGAGATGGAATTTGG - Intergenic
1186639508 X:11440541-11440563 GAAAATCCAGAGAGGCTAATGGG - Intronic
1186668173 X:11740454-11740476 GAAAATGGAGAAATGAAATTTGG - Intergenic
1187031394 X:15492136-15492158 GAAAATGGAGAAAAACAAAGAGG + Intronic
1187289015 X:17934001-17934023 GAAATCAGAGAGAGGCAAATAGG + Intergenic
1188545425 X:31300851-31300873 GGAGATGGAGAGCTGCAAAGAGG + Intronic
1188885930 X:35548488-35548510 GAAAATGGAAATATTCACATTGG - Intergenic
1189106480 X:38241047-38241069 GAAAACGTAGAGAAGCACATAGG - Intronic
1189594734 X:42552064-42552086 GAAAATATAGAAATGCAACTTGG + Intergenic
1191070300 X:56393888-56393910 GATAATGGTGACATTCAAATGGG + Intergenic
1191895335 X:65986805-65986827 GAAAAGGGAGAGATGGAATGAGG - Intergenic
1192278791 X:69662106-69662128 GAAAATGGAGAGATGTATGTAGG - Intronic
1192550990 X:72053300-72053322 GAGAATGGAGACAGGCAAACTGG - Intergenic
1192565565 X:72160703-72160725 GAAAGTGGACACATGCAAAGAGG + Intergenic
1192861546 X:75078297-75078319 GAAAATGGAGAGTGCCAAATTGG - Intronic
1193153737 X:78151312-78151334 GACAATAGAGAGATGGAAAAAGG - Intergenic
1193491014 X:82147319-82147341 AAAAAAGAAGACATGCAAATAGG + Intergenic
1194935456 X:99942222-99942244 GAAAATGCAGACAAGCAAAAAGG - Intergenic
1196479716 X:116133526-116133548 GAAAATATAGACATCCAAATTGG - Intergenic
1196999736 X:121426049-121426071 GAACATGTAGACAGGCAAATGGG + Intergenic
1197367448 X:125581455-125581477 GAAAACAGAGAGACGCAAATGGG + Intergenic
1198875009 X:141215132-141215154 GAAAATGGAGAGATTACACTGGG + Intergenic
1201331607 Y:12828655-12828677 GAAAATGGAAATATTCTAATTGG + Intronic
1201542679 Y:15125012-15125034 GGAAATGGAGAAATCCAAACTGG - Intergenic