ID: 1097827979

View in Genome Browser
Species Human (GRCh38)
Location 12:64194126-64194148
Sequence GAGACACTACAGCTGGATAC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097827974_1097827979 6 Left 1097827974 12:64194097-64194119 CCAGTGCATGACTGGCCTGTCGC 0: 1
1: 0
2: 1
3: 2
4: 49
Right 1097827979 12:64194126-64194148 GAGACACTACAGCTGGATACTGG 0: 1
1: 0
2: 2
3: 7
4: 101
1097827977_1097827979 -9 Left 1097827977 12:64194112-64194134 CCTGTCGCTGGGCAGAGACACTA 0: 1
1: 0
2: 0
3: 4
4: 92
Right 1097827979 12:64194126-64194148 GAGACACTACAGCTGGATACTGG 0: 1
1: 0
2: 2
3: 7
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097827979 Original CRISPR GAGACACTACAGCTGGATAC TGG Exonic
901150562 1:7098546-7098568 CAGACACTCCATCAGGATACAGG - Intronic
905794983 1:40810688-40810710 GAGAGACCTCAGCTGGATCCAGG + Intronic
915535815 1:156534682-156534704 GAGCCACCACAGCTGGGTTCAGG + Exonic
918854560 1:189734166-189734188 CAGACACTACAACTGGATTTAGG - Intergenic
1063186706 10:3658485-3658507 GAGACACCACGGTTAGATACAGG - Intergenic
1065248196 10:23780963-23780985 GAGCCACCACACCTGGACACCGG + Intronic
1070168918 10:73917880-73917902 GAGCCACTACACCTGGCCACAGG - Intronic
1071491521 10:86139637-86139659 GAGTCACTCCAGCTGGAAACAGG - Intronic
1074162614 10:110846705-110846727 GAGACTCCACAGCTGGCTGCTGG + Intergenic
1076012609 10:127002701-127002723 GAGACACTACATCTGGTCCCTGG + Intronic
1076739550 10:132476571-132476593 GACACAGTCCAGCTGGAGACAGG - Intergenic
1080636449 11:34128069-34128091 GAGCCACTGCACCTGGCTACAGG - Intronic
1084664675 11:70569999-70570021 GAGACTCAACAGCTGGAGGCAGG - Intronic
1085137328 11:74103904-74103926 GAGCCTCTTCAGCTGGATTCTGG - Intronic
1085404442 11:76253597-76253619 GAGACCGTACAGCTGGCTGCAGG - Intergenic
1087205464 11:95389285-95389307 GAGACACTTCCTCTGGATTCAGG - Intergenic
1087961497 11:104355952-104355974 GAGAAATCAGAGCTGGATACAGG - Intergenic
1088458333 11:110056376-110056398 AAGACAGTACAACTGGACACGGG + Intergenic
1088562296 11:111127510-111127532 GAGACAACAGAACTGGATACTGG + Intergenic
1090439168 11:126712208-126712230 GTGACAGTACAGCTGGCTGCCGG + Intronic
1092389984 12:8068302-8068324 GAGAGACTACATCTGGAAAGTGG - Intergenic
1097695420 12:62770399-62770421 GAGAAACAAAAGCTGGATTCAGG - Intronic
1097827979 12:64194126-64194148 GAGACACTACAGCTGGATACTGG + Exonic
1099725138 12:86416491-86416513 TTGACACTACACCTGGATATTGG + Intronic
1103881839 12:124172307-124172329 GAGCCACTACATCTGGCTTCTGG + Intronic
1104272809 12:127297431-127297453 GAGCCTCTACAGCTGGATACAGG - Intergenic
1104307512 12:127622766-127622788 GAGACATCACAGCAGGATATAGG - Intergenic
1107247358 13:38311723-38311745 AAGACACTCCAGCTAGATAGAGG - Intergenic
1110748475 13:79084217-79084239 AAGAAAATACACCTGGATACAGG + Intergenic
1114477903 14:23010540-23010562 GAGACATTTCACCTGGAAACCGG - Intergenic
1117714996 14:58571531-58571553 GAGCCACTACAACTGGCCACTGG + Intergenic
1122021896 14:98844884-98844906 GAGACCCTAGAGCTGGCTTCTGG - Intergenic
1123811051 15:23926643-23926665 GAGACACCACAGCTGGCCAAAGG - Intergenic
1141479758 16:84298658-84298680 GAGAGACTAGAGCAGGCTACAGG - Intronic
1146824419 17:36010450-36010472 GAGAGACTGAAGCTGGATAGGGG - Intergenic
1151673720 17:75587808-75587830 GAGACGCTACAGCTGCGGACAGG - Intergenic
1152358456 17:79818200-79818222 GAGACAGTTCAGCTGGATATGGG - Intergenic
1155044792 18:22094401-22094423 GAGACTCCACAGCTGTATAAAGG - Intronic
1157957407 18:52113735-52113757 GAGACACAACATCAGGATAGAGG - Intergenic
1159256128 18:65948586-65948608 GTTACACTAGGGCTGGATACTGG + Intergenic
1159385318 18:67717244-67717266 TAGAGACTACAGCTGGATGGAGG + Intergenic
1159580830 18:70232882-70232904 GAGCCACCACACCTGGATTCTGG - Intergenic
1159600294 18:70422878-70422900 GAGAAACTACAGCTGGCTACAGG + Intergenic
1161800107 19:6412699-6412721 GAGACCCTGCAGCTGCATGCGGG + Intergenic
1164314410 19:24074279-24074301 GAGTCACTTCAGCTCGATGCTGG - Intronic
1164725526 19:30463394-30463416 GAGAGGCCACAGCTGCATACTGG - Intronic
1165079224 19:33298260-33298282 AAGCCCCTACAGCTGGACACGGG + Intergenic
1166043084 19:40214822-40214844 GCCACACTACAGATGGAAACTGG + Intronic
1167690180 19:50980269-50980291 GAGACAGTACAGGTGGTTCCAGG + Exonic
928613866 2:33017330-33017352 GACACACAACATCTGGAAACAGG - Intronic
931200389 2:60092170-60092192 GAAACAATAAAGCTGGAGACAGG + Intergenic
946064422 2:216974477-216974499 GAGAGACTACAGGTGAATGCAGG - Intergenic
946453765 2:219803854-219803876 GAGAAGCAACAGCTGGATCCTGG + Intergenic
947154280 2:227145743-227145765 CAGACACTACAGATGTTTACAGG + Intronic
947670716 2:231933857-231933879 GGGACTCCACAGCTGGATCCTGG - Intergenic
1177190864 21:17849657-17849679 GAGCCACTACACCTGGCCACAGG + Intergenic
1179069709 21:38060108-38060130 GAGCCACTGCAGCTTGATCCTGG - Intronic
1185159080 22:49212037-49212059 GAGTCTCTGCAGATGGATACAGG - Intergenic
1185220645 22:49627615-49627637 GAGACAGGGCAGCTGGAGACAGG + Intronic
953566423 3:44035784-44035806 AAGACACAAAAGCTGGATACTGG - Intergenic
961056028 3:123789511-123789533 GAGAGAGAACAGCTGGATAAAGG + Intronic
962747203 3:138405743-138405765 GAGGCACTACCTCTTGATACTGG + Intergenic
964668519 3:159200244-159200266 GAGATAAGACATCTGGATACCGG - Intronic
965670534 3:171143226-171143248 GAGACACAGCAGCTGGAAATTGG - Intronic
969261046 4:6033988-6034010 GAGACAAAACAGCTGGATGAAGG - Intronic
971819125 4:31529758-31529780 GAGACAGCACAGCTGCAAACAGG - Intergenic
972361495 4:38329560-38329582 CAGACACTCAAGCTGGATAACGG - Intergenic
973871340 4:55169837-55169859 GTGACACTGCAGCTTGATGCGGG - Intergenic
981450710 4:144894634-144894656 GAGACTATACAGATGGATAGTGG + Intergenic
986314102 5:6574627-6574649 AAGCCACTGCAGCTGGAGACAGG + Intergenic
989777054 5:45221922-45221944 AAGACAATAGAGCTGGGTACCGG - Intergenic
990185579 5:53206185-53206207 GAGCCACCACACCTGGCTACTGG + Intergenic
994624144 5:102196656-102196678 GTGACACTGCAGCTGGACACGGG - Intergenic
999188158 5:149728286-149728308 CAGACCCTGCATCTGGATACTGG - Intergenic
1002899022 6:1395321-1395343 CAGACACTACATTTGGATACAGG + Exonic
1006728494 6:36217398-36217420 GAGAGACTAGAGATGGATAAGGG - Intronic
1010029860 6:71262398-71262420 GTGACAGTCCAGCTGGAAACTGG + Intergenic
1019748169 7:2712329-2712351 GAGACTCTACACCTGGACTCAGG + Exonic
1020179086 7:5907414-5907436 GGGCCACTACTGCTGGATTCTGG - Intronic
1020303847 7:6817455-6817477 GGGCCACTACTGCTGGATTCTGG + Intronic
1021784806 7:24141144-24141166 GAGCCACCACACCTGGATCCTGG + Intergenic
1025785424 7:64639449-64639471 GAGTCACATCAGCTGGATTCTGG - Intergenic
1026880801 7:73905533-73905555 GCGACACTACCGCTGGGCACAGG - Intergenic
1026945462 7:74313273-74313295 GAGCCACTCCAGCTGGAGGCTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1034773899 7:153806302-153806324 GAGAAATTACATCTGGATAGGGG - Intergenic
1035774682 8:2179101-2179123 GAGAAACTTCGGCTGGATTCAGG + Intergenic
1036935930 8:13002907-13002929 GGGACACTACACCTGCAAACTGG - Intronic
1038619184 8:29123848-29123870 AAGATACGACAGCTGGATAAAGG + Intronic
1039965643 8:42281641-42281663 GTGAAACTGCAGCTGGATCCCGG + Intronic
1040934947 8:52772797-52772819 GAGAAACTATAGCTGGATATGGG + Intergenic
1046684169 8:117206036-117206058 GAGAGACCACAGCTGTATCCAGG + Intergenic
1048401868 8:134079057-134079079 GAGATACTATAGGTGGAGACAGG + Intergenic
1048511827 8:135069961-135069983 CAGAGACTACAGCTGGACATTGG + Intergenic
1049637909 8:143699127-143699149 GAGACACTGCAGCTGGAGGTGGG - Intronic
1055028808 9:71751034-71751056 CATACATTCCAGCTGGATACTGG - Intronic
1056499065 9:87190179-87190201 GAGTCACTGCACCTGGACACAGG - Intergenic
1058344872 9:103949113-103949135 GAGAAATCACAGCTGGATATAGG - Intergenic
1059395274 9:114030508-114030530 GAGACACTGAAGCTGGAGACCGG - Intronic
1186127110 X:6426123-6426145 GAGAGACTACAGTTGGACATTGG - Intergenic
1187469186 X:19553086-19553108 GACACACTGCAGCTGGAGCCAGG + Intronic
1188771261 X:34157531-34157553 GTGACAGTGCAGCAGGATACTGG + Intergenic
1189269717 X:39742546-39742568 GAGACACTAAAACTGGCCACTGG - Intergenic
1192941666 X:75919734-75919756 GAGACAGGACAGCTGCCTACCGG + Intergenic
1193369714 X:80679947-80679969 GAGACACTAAAGATGTAAACTGG + Intronic
1193734791 X:85144663-85144685 GAGACACTGCAGCTATATCCTGG + Intergenic
1200870573 Y:8093780-8093802 GACTCACATCAGCTGGATACTGG + Intergenic
1200889958 Y:8312966-8312988 GACTCACATCAGCTGGATACTGG - Intergenic
1202252213 Y:22885015-22885037 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202405202 Y:24518764-24518786 GAGTCACTTCACCTGGCTACTGG + Intergenic
1202465578 Y:25151318-25151340 GAGTCACTTCACCTGGCTACTGG - Intergenic