ID: 1097830589

View in Genome Browser
Species Human (GRCh38)
Location 12:64220937-64220959
Sequence GCTAATTTATTAGCAAAAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 550
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097830589 Original CRISPR GCTAATTTATTAGCAAAAAC TGG (reversed) Intronic
900735430 1:4296755-4296777 CCTAATTTATAAACAAAAAGAGG + Intergenic
900810633 1:4798959-4798981 GGTAATTTATAAGGAAAAAGAGG - Intergenic
901885732 1:12221693-12221715 GGTAATTTATAAGGAAAAAGAGG + Intergenic
902393604 1:16120158-16120180 CCTAATTAATTAGCAAATTCTGG - Intergenic
902587116 1:17446611-17446633 TCTAATTTTTCAGGAAAAACAGG + Intergenic
904073348 1:27819102-27819124 GCTAATTTTTTGGTAAAGACAGG - Intronic
904358376 1:29956290-29956312 GGTAATTTATAAGGAAAAAGAGG - Intergenic
904431561 1:30467853-30467875 GGTAATTTATTAAAAAAAAAGGG - Intergenic
906119375 1:43378371-43378393 GCTAATTTTTTAGTAGAGACAGG + Intergenic
906820707 1:48927199-48927221 GATAATTTATAAGGAAAAAGAGG + Intronic
908452832 1:64273130-64273152 GCTAAATTATTGGCCAAAACAGG + Intergenic
908872841 1:68634425-68634447 AATACTTTATTTGCAAAAACAGG + Intergenic
910047038 1:82930369-82930391 TCTTATTTATTAGCAAATCCTGG - Intergenic
910240049 1:85076494-85076516 GATAATTTATTTGAAAAAAGAGG + Intronic
910421080 1:87064101-87064123 GCCAATTTCATAGGAAAAACCGG - Intronic
911831198 1:102553248-102553270 GCTAATTTATAACGAAAAAGAGG + Intergenic
912070168 1:105799995-105800017 GGTAATTTATAAACAAAAAAGGG + Intergenic
912117842 1:106429281-106429303 GGTAATTTATAAAGAAAAACAGG + Intergenic
913019032 1:114767979-114768001 GCTAAAATTTAAGCAAAAACAGG - Intergenic
913490752 1:119377622-119377644 GATAATTTATAAAGAAAAACAGG + Intronic
913711509 1:121488644-121488666 TATAATTTATTAGCACATACAGG + Intergenic
916237252 1:162602761-162602783 GCTAATTTTTTAGTAGAGACGGG + Intergenic
916254864 1:162776540-162776562 GTTAATTTTTTAGCAGAAATAGG - Intronic
916805701 1:168258787-168258809 CCTAATTTTTTAGTAAAAACAGG - Intergenic
917240302 1:172941000-172941022 GCTAATTTTTTTGTAGAAACAGG - Intergenic
917652946 1:177096801-177096823 GGTAATTTATAAGGAAAAAGAGG - Intronic
917785772 1:178456082-178456104 GTTAATTTAACAGCAAAATCAGG - Intronic
919249876 1:195040445-195040467 GCTAATGTATGAGCAATAACTGG + Intergenic
919475879 1:198033466-198033488 GCTAATTTTACAGCAGAAACAGG - Intergenic
919908439 1:202094535-202094557 GCTAATTTTTTAGTAGAGACAGG - Intergenic
920717185 1:208351223-208351245 GTTAATTTATTATTAAAAGCAGG + Intergenic
920719282 1:208371944-208371966 GGTAATTTATAAGGAAAAAGAGG + Intergenic
922122791 1:222689733-222689755 GTTAATTTATTATTAAAGACAGG + Intronic
922281924 1:224133680-224133702 GCTAATTTTTTAGTAGAGACGGG + Intronic
922947061 1:229525665-229525687 GCTAATTTTTTAGTAGAGACAGG - Intronic
923772038 1:236946088-236946110 ACTAGTTTAATAGCAAAATCAGG + Intergenic
923823940 1:237478107-237478129 ACTATTTCATTATCAAAAACAGG + Intronic
923932647 1:238720503-238720525 GGTAATTTATAAGGAAAAAAAGG + Intergenic
924372494 1:243367482-243367504 GCCAATTTGTTAGCAAACACAGG + Intronic
924449496 1:244164741-244164763 GATGATTCATTAGCAAGAACAGG - Intergenic
924494178 1:244570215-244570237 TCTAATTTATTGGCAAAAGTAGG + Intronic
1063567605 10:7184483-7184505 GGTAATTTATAAGGAAAAAAAGG - Intronic
1063769598 10:9182795-9182817 TCTACTTTATTAGGAAAAAGAGG + Intergenic
1063868473 10:10392842-10392864 GGTAATTTATAAAGAAAAACAGG + Intergenic
1064479741 10:15727230-15727252 GGTAATTTATAAACAAAAAGAGG - Intergenic
1064564007 10:16621548-16621570 GGTAATTTATCAGGAAAAAGAGG + Intronic
1066223544 10:33359502-33359524 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1066225984 10:33384270-33384292 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1066424465 10:35293485-35293507 GCTAACTTCTTTGCAGAAACTGG - Intronic
1069125727 10:64630030-64630052 GTTAATTTATTATTAAAAAAAGG + Intergenic
1070250374 10:74767764-74767786 GCTATTTTATCAGGAGAAACTGG - Intergenic
1070269066 10:74934232-74934254 GCTAATTGCTTAGCAATTACTGG - Intronic
1071809272 10:89160912-89160934 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1071934288 10:90509564-90509586 TGTAATTTATTATCAAAAAGAGG + Intergenic
1072097811 10:92199517-92199539 GCTAATTTTTTAGTATAGACGGG - Intronic
1072322017 10:94259790-94259812 GGTAATTTATAAGGAAAAAGAGG + Intronic
1073790712 10:106937618-106937640 GGTAATTTATAAAGAAAAACAGG - Intronic
1074900190 10:117809807-117809829 GCTAATTTATAAAGAAAAAGGGG - Intergenic
1075076116 10:119351578-119351600 GGTAATTTATAAGGAAAAAGAGG - Intronic
1075197609 10:120374785-120374807 GGTAATTTATAAAGAAAAACAGG + Intergenic
1075350476 10:121720244-121720266 GGTAATTTATAAATAAAAACAGG + Intergenic
1076673374 10:132135310-132135332 TGAACTTTATTAGCAAAAACAGG + Intronic
1077097946 11:807312-807334 GCTAATTTTTTAGTAGAGACAGG - Intronic
1078851133 11:15164979-15165001 GGTAATTTATAAGGAAAAAGAGG - Intronic
1079766467 11:24399543-24399565 GATAATTTTTTAGCACAAATAGG + Intergenic
1079771972 11:24474048-24474070 GGTAATTTATAAACAAAAAAGGG + Intergenic
1079863942 11:25711632-25711654 GGTAATTTATTAACAAAAAGAGG + Intergenic
1082572516 11:54760564-54760586 GCCACTTTCTAAGCAAAAACTGG + Intergenic
1083316602 11:61818511-61818533 GCCAATTTAATAGCAAAAACTGG + Intronic
1083956254 11:65984544-65984566 GCTAATTTTTTTGCAAAGACAGG + Intergenic
1084235045 11:67782330-67782352 GGTAATTTATTAAGAAAAAGAGG - Intergenic
1085381765 11:76126112-76126134 GCTAATTTTTTAGTAGAGACGGG + Intronic
1085673368 11:78490633-78490655 GCTAATTTTTTGGTAGAAACGGG - Intronic
1086320856 11:85646363-85646385 GCTTATTTTTTAGTAAAGACAGG - Intergenic
1086409776 11:86532886-86532908 GCTAATTTTTTAGTAGAGACGGG - Intronic
1087606846 11:100387268-100387290 GGTAATTTATAGGGAAAAACAGG - Intergenic
1088022472 11:105136369-105136391 GCTCATTCATTGGCAAGAACTGG + Intergenic
1088127806 11:106449558-106449580 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1088143806 11:106650205-106650227 GGTAATTTATTAATAAAAAGGGG + Intergenic
1088522911 11:110718361-110718383 GATAATTTATAAAGAAAAACAGG - Intergenic
1088644367 11:111904903-111904925 GGTAATTTATAAACAAAAAGAGG - Intergenic
1088865074 11:113839715-113839737 GCTAATTTTTTAGTAGAGACAGG - Intronic
1090904007 11:131057937-131057959 GTTAATTTATAAGGAAAAAGAGG + Intergenic
1091882941 12:3994269-3994291 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1092593552 12:9975107-9975129 GGTAATTTATAAGTAAAAAGAGG - Intronic
1094212688 12:27909187-27909209 GCTAATTCAGTAGCAGAAGCGGG + Intergenic
1094767088 12:33609258-33609280 GGTAATTTATTAAGAAAAAGAGG - Intergenic
1095566649 12:43632088-43632110 GCAAATTTATTTGTAAAAATTGG - Intergenic
1095833040 12:46608004-46608026 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1096065208 12:48734280-48734302 GCTAATTTTTTTGTAAAGACGGG + Intergenic
1097063981 12:56306688-56306710 GCTAATTTTTTTGCATAGACAGG + Intronic
1097765776 12:63525145-63525167 GCTAATTTTTTAGTAGAGACAGG - Intergenic
1097803132 12:63937244-63937266 TCTCATTTAGTAGGAAAAACTGG + Intronic
1097830589 12:64220937-64220959 GCTAATTTATTAGCAAAAACTGG - Intronic
1098531091 12:71542617-71542639 GCCAATTCATTACCAAACACTGG - Intronic
1098953965 12:76669539-76669561 GGTAATTTATAAACAAAAAGAGG - Intergenic
1099048855 12:77758763-77758785 TCTCATTTATTTCCAAAAACAGG - Intergenic
1099294517 12:80813398-80813420 GCTAATAACTTAACAAAAACTGG + Intronic
1099684909 12:85872371-85872393 CCTAATTAATTAGAAAAAAGGGG - Intergenic
1099963006 12:89414690-89414712 GCAAATTTAATAATAAAAACAGG - Intergenic
1100020404 12:90062500-90062522 GCTAATTTATTAGTAGAGACAGG - Intergenic
1100021188 12:90071238-90071260 GGTAATTTATAAGAAAAAAGAGG - Intergenic
1100285138 12:93158121-93158143 GCTAATTTATAAAGAAAAAGAGG + Intergenic
1100657814 12:96666442-96666464 GATAATTTATAAACAAAAAGAGG + Intronic
1100800651 12:98226886-98226908 GCTAATTTATAAAGAAAAAGAGG - Intergenic
1102670986 12:114618778-114618800 GCTAATGTTTTAGCAGAAATGGG - Intergenic
1103033445 12:117636966-117636988 GGTAATTTAATAGGAAAAAATGG + Intronic
1103169481 12:118802909-118802931 TCTAATTTATTGGCATAAAATGG + Intergenic
1103260338 12:119582719-119582741 GCTGATTTATAAAGAAAAACAGG - Intergenic
1103389047 12:120556977-120556999 GCTAATTTTTTAGTAGAGACGGG - Intronic
1104146386 12:126037858-126037880 GCTAATTTATAAAGAAAAAGAGG + Intergenic
1104349546 12:128033086-128033108 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1104552379 12:129769224-129769246 GCTAATTTATAAAGAAAAAGAGG + Intronic
1104627017 12:130365660-130365682 GCAAATATAGTAACAAAAACAGG - Intronic
1105493146 13:20906659-20906681 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1105698293 13:22912266-22912288 TCAAATTTATTAGAAAAAAATGG - Intergenic
1105849952 13:24324510-24324532 TCAAATTTATTAGAAAAAAATGG - Intergenic
1106120861 13:26859314-26859336 GATAATTTATAAAGAAAAACAGG + Intergenic
1106467739 13:30027754-30027776 GCTCATTTATTATAAAAAAGAGG + Intergenic
1106941722 13:34787458-34787480 GCTAATTTTTTAGTAGAGACAGG - Intergenic
1107183046 13:37484668-37484690 GATAATTTATAAGGAAAAAGAGG + Intergenic
1107619462 13:42211388-42211410 GGTAATTTATAAAGAAAAACAGG + Intronic
1107704071 13:43081836-43081858 GGTAATTTATAAGGAAAAAGAGG + Intronic
1108047937 13:46400829-46400851 GCTAATTTTTTAGTACAGACGGG - Intronic
1108270480 13:48755042-48755064 GATAATTTATAAGGAAAAAGAGG - Intergenic
1109097778 13:58140914-58140936 GCTAATTTATAAAGAAAAAGAGG - Intergenic
1109741703 13:66562425-66562447 GGTAATTTATTAAAAAAAAGAGG + Intronic
1109762413 13:66846936-66846958 TCTTATTTATCAGGAAAAACTGG - Intronic
1109859833 13:68182617-68182639 TATAATTTATTATCATAAACAGG - Intergenic
1110017592 13:70427429-70427451 GGTAATTTATGAGGAAAAACAGG + Intergenic
1110240031 13:73256727-73256749 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1110342711 13:74412007-74412029 GATAATTTATTAAGAAAAAGAGG - Intergenic
1110361214 13:74627604-74627626 GCAAATTTATTAGTAGAAACAGG + Intergenic
1111431491 13:88152411-88152433 GGTAATTTATTAAGAAAAAGAGG - Intergenic
1111464122 13:88585754-88585776 GGTAATTTATAAAGAAAAACAGG - Intergenic
1111803912 13:93014640-93014662 GCTAACTTATCAACAACAACAGG + Intergenic
1112190426 13:97172009-97172031 GATAATTTATAAGGAAAAAGAGG - Intergenic
1112253251 13:97803211-97803233 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1112586957 13:100727134-100727156 GGTAATTTATAAGGAAAAAGCGG - Intergenic
1112879470 13:104088089-104088111 GGTAATTTATAAAGAAAAACAGG + Intergenic
1113003669 13:105674447-105674469 GCTTATTTCATAGAAAAAACTGG - Intergenic
1113029229 13:105975682-105975704 GGTAATTTATAAGGAAAAAGTGG + Intergenic
1113298210 13:108985938-108985960 GGTAATTTATTAAGAAAAAGAGG + Intronic
1114061594 14:19022791-19022813 GCTAATGTTTTAGTACAAACAGG - Intergenic
1114100654 14:19377155-19377177 GCTAATGTTTTAGTACAAACAGG + Intergenic
1115132578 14:30071925-30071947 GGTAATTTATAAACAAAAAGAGG - Intronic
1115475292 14:33807623-33807645 TCTGCTTTATTAGCACAAACTGG + Intergenic
1115812498 14:37125124-37125146 GCTATTTTAGTAGCATAACCAGG - Intronic
1116419554 14:44716936-44716958 TATAATTTAGTAGCAAGAACTGG - Intergenic
1116745809 14:48817204-48817226 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1116857870 14:49969535-49969557 GCTAATTTATTATCTAAATTAGG + Intergenic
1117353889 14:54905225-54905247 GATAATTTATTAGCATAAAATGG + Intergenic
1117869849 14:60188763-60188785 GGTAATTTAGTATCAACAACAGG + Intergenic
1118449529 14:65887257-65887279 TTTAAATTTTTAGCAAAAACAGG - Intergenic
1118613412 14:67558921-67558943 GCAACTTTATTTACAAAAACAGG + Intronic
1119143128 14:72285514-72285536 GGTAATTTATAAGGAAAAAGAGG - Intronic
1119249634 14:73140522-73140544 ACTAATTTAACAGCAAAATCTGG + Intronic
1119540220 14:75433028-75433050 GCTAATTTTTTAGTAGAGACGGG - Intronic
1120223621 14:81764973-81764995 GATAATCTATTACCAAAATCAGG + Intergenic
1121170355 14:91848624-91848646 GCTATTTCATTGGCAAAAATGGG - Intronic
1121474952 14:94190434-94190456 GCTAATTTTTTAGTAAAGACAGG - Intronic
1122440781 14:101730511-101730533 GGTAAATTATAAGGAAAAACAGG - Intronic
1122456923 14:101861025-101861047 GATAATTTAATTGAAAAAACAGG - Intronic
1122646388 14:103197172-103197194 GCTAATTTTTTAGCAGAGATGGG + Intergenic
1122839904 14:104452488-104452510 TCAAATTTATTAGAAAAAAGTGG - Intergenic
1123495627 15:20822179-20822201 GCTAATGTTTTAGTACAAACAGG + Intergenic
1123552114 15:21391271-21391293 GCTAATGTTTTAGTACAAACAGG + Intergenic
1123588358 15:21828668-21828690 GCTAATGTTTTAGTACAAACAGG + Intergenic
1123680500 15:22759672-22759694 TTTAATTTATTAACAAATACTGG - Intergenic
1123744127 15:23305281-23305303 TTTAATTTATTAACAAATACTGG - Intergenic
1124073259 15:26415245-26415267 GCTAATTTTTTAGTAGAGACAGG - Intergenic
1124332718 15:28834132-28834154 TTTAATTTATTAACAAATACTGG - Intergenic
1125103845 15:35948028-35948050 TGTAATTTATTGTCAAAAACAGG + Intergenic
1126244205 15:46484936-46484958 GCTAATTTATTAACATCAAGAGG - Intergenic
1126819858 15:52491828-52491850 GCAACATAATTAGCAAAAACTGG + Intronic
1126984706 15:54291345-54291367 GCTATTTTATTAGTAAAATGAGG - Intronic
1127124768 15:55801256-55801278 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1127164802 15:56233139-56233161 GGTAATTTATAAGGAAAAAGAGG + Intronic
1130019646 15:80217460-80217482 GCTAATTTCTTAGCACAAATTGG + Intergenic
1131470937 15:92696396-92696418 TCTATTTTATTTGTAAAAACCGG + Intronic
1131694978 15:94867339-94867361 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1131852546 15:96558063-96558085 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1202960462 15_KI270727v1_random:118502-118524 GCTAATGTTTTAGTACAAACAGG + Intergenic
1133684518 16:8153685-8153707 GCTTATTTATTAGCTCTAACAGG + Intergenic
1134233824 16:12450180-12450202 GGTAATTTATAAAGAAAAACAGG - Intronic
1135170354 16:20178313-20178335 GGTAATTTATAAACAAAAAGAGG - Intergenic
1135730363 16:24890060-24890082 ACAAATTTATTAGCACACACAGG + Intronic
1135874005 16:26180451-26180473 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1137260800 16:46828099-46828121 GCTAATTTTTTAGTAGAGACAGG + Intronic
1137473191 16:48781289-48781311 GGTAATTTATTAAAAAAAAAAGG + Intergenic
1137775988 16:51054720-51054742 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1138294499 16:55874763-55874785 GCTACTTACTTAGCAAAACCCGG + Intronic
1139394103 16:66626296-66626318 GCTAATTTTTTAGTAGAGACGGG - Intronic
1139746002 16:69075011-69075033 GCTAATTTTTTAGTAGAGACGGG + Intronic
1140739405 16:77927702-77927724 GCTAATTTTTTAGTAGAGACGGG - Intronic
1140791917 16:78400206-78400228 AATAATTTATAACCAAAAACAGG + Intronic
1140896558 16:79330053-79330075 GCTACTTGATTAGTAAAAAATGG - Intergenic
1143472203 17:7182820-7182842 TCAAATTTATTAGCATACACAGG - Intergenic
1143533220 17:7518473-7518495 GCTAATTTTTTAGTAGAGACTGG + Intergenic
1144379068 17:14674917-14674939 GATAATTTAATAGCCTAAACAGG + Intergenic
1144468943 17:15519735-15519757 GCTAATTTTTTAGTAGATACAGG - Intronic
1144637518 17:16919790-16919812 GCTAATTTTTTAGTAAAAACAGG + Intergenic
1146542104 17:33705143-33705165 GCTAATTTGTGAGAAAAAAGAGG - Intronic
1146565468 17:33909266-33909288 GCTATTTTGTTAGAAACAACGGG - Intronic
1147716416 17:42511796-42511818 GCTAATTTTTTAGTAAAGATGGG - Intronic
1150043354 17:61886935-61886957 GCTAATTTATTAACTTAAAAGGG - Intronic
1151864826 17:76794310-76794332 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1154368538 18:13734210-13734232 GGTAATTTATAAACAAAAAGAGG - Intronic
1154453031 18:14494606-14494628 GCTAATGTTTTAGTACAAACAGG + Intergenic
1154997481 18:21654469-21654491 GCTAAGTTCTTATCAAAAAGTGG + Intronic
1155746049 18:29357374-29357396 GATATTATATTAGCAAAAAAAGG - Intergenic
1155820652 18:30370983-30371005 GTGAATTTATTAACCAAAACTGG + Intergenic
1155988070 18:32251744-32251766 GCTTATATATTAGCAGAAAGAGG - Intronic
1156069540 18:33189599-33189621 GCCAATTGCTTAGCCAAAACAGG - Intronic
1156249534 18:35339193-35339215 GCTAATATATTGGGAAAGACTGG + Intronic
1156928405 18:42611220-42611242 GATAATTTATTAAAAAAAAGAGG + Intergenic
1157818240 18:50746676-50746698 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1158715549 18:59876053-59876075 GCTAAATTGCTAGCAAAAGCAGG - Intergenic
1159768089 18:72514884-72514906 GGTAATTTATAAAGAAAAACAGG + Intergenic
1159865540 18:73700253-73700275 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1160356859 18:78235402-78235424 GATCATTTATCAGCAAAAGCTGG - Intergenic
1163064274 19:14781652-14781674 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1163613710 19:18313982-18314004 GCTAATTTTTTAGTAGAGACGGG + Intronic
1165667658 19:37647558-37647580 GGTAATTTATAAGGAAAAAGAGG - Intronic
1166576607 19:43846431-43846453 ACAACTTTATTTGCAAAAACAGG - Intronic
1167026440 19:46922586-46922608 GTTAATTAATTAGCAAAATGAGG + Intronic
1167838140 19:52091976-52091998 GCTAATTTTTTAGTAGAGACAGG - Intronic
1167953618 19:53046992-53047014 GCTAATTTTTTAGTAGAGACAGG - Intronic
925377385 2:3397779-3397801 GCTAAATTATTAACAACAATGGG - Intronic
925575313 2:5354229-5354251 CCTATTTTATTAGCAAATGCTGG + Intergenic
925579712 2:5398170-5398192 AATAATTTATTTACAAAAACAGG + Intergenic
925620645 2:5789302-5789324 GGTAATTTATAAAGAAAAACAGG + Intergenic
925850513 2:8076969-8076991 GGTAATTTATAAGGAAAAAGAGG + Intergenic
925887961 2:8409985-8410007 GCTAATTTATCAGCCAGCACAGG + Intergenic
926882753 2:17566051-17566073 GATAATTTATTAAAAAAAAGAGG - Intronic
927105580 2:19820712-19820734 GCTAATTTTTTTGTAGAAACAGG - Intergenic
927190726 2:20515161-20515183 GGTAATTTATAAACAAAAAGAGG + Intergenic
927821541 2:26270049-26270071 GCTATTTTATGTGTAAAAACTGG - Intronic
927831833 2:26358091-26358113 GGTAATTTATAAAGAAAAACAGG - Intronic
928222659 2:29417634-29417656 GCTATTTTATCAGTAAAAATAGG - Intronic
928229425 2:29483886-29483908 GGTAATTTATAAAGAAAAACAGG + Intronic
928664158 2:33533820-33533842 GATAATTTATTTGAATAAACAGG - Intronic
929398176 2:41547545-41547567 TATAATTTATTAGCCAAATCAGG - Intergenic
930336780 2:50058915-50058937 GGTAATTTATAAAGAAAAACAGG - Intronic
931065297 2:58579239-58579261 GGTAATTTATAAGGAAAAAAAGG + Intergenic
931177029 2:59864468-59864490 GCTAAGTGACCAGCAAAAACTGG - Intergenic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932033784 2:68219379-68219401 GCTTAGTCATTAGTAAAAACAGG + Intronic
932858429 2:75263476-75263498 AAAAATTTATTTGCAAAAACAGG - Intergenic
933379130 2:81520804-81520826 AATAATTAATTAACAAAAACAGG - Intergenic
934699364 2:96427526-96427548 GCAAATTTTTTAGCGAAAATAGG - Intergenic
935497209 2:103795448-103795470 GTTAATTTATAAGGAAAAAGAGG + Intergenic
936257421 2:110928971-110928993 GGTAATTTATAAAGAAAAACAGG - Intronic
938084941 2:128393388-128393410 GGTAATTTATAAGGAAAAGCAGG - Intergenic
939330689 2:140756301-140756323 GCTAGTTTATTTGCCAAAATTGG + Intronic
939812244 2:146848550-146848572 GTTAATTTTTCAGCAAAAAAGGG - Intergenic
940402122 2:153259755-153259777 GGTAATTTATAAGGAAAAAGAGG - Intergenic
940430240 2:153581375-153581397 GTTATTTTATTAGCAAATAGGGG + Intergenic
940998551 2:160177114-160177136 ACTAGTTGATTAGCAAAAAATGG + Intronic
941810839 2:169754673-169754695 GATAATTTATTAAGAAAAAAAGG - Intronic
941931596 2:170946174-170946196 GCTAATTTTTTTGTAGAAACAGG + Intronic
942783552 2:179674213-179674235 GATAATTAATGAGCAAAAAATGG + Intronic
943336122 2:186616859-186616881 GCTTATTTATTAGGTAAAAATGG - Intronic
943394840 2:187321596-187321618 TCTAATTCATTATCCAAAACTGG + Intergenic
943809539 2:192167201-192167223 GATATTTTATTAGGAAAAATAGG - Intronic
943979610 2:194531351-194531373 GCCAATTTATTTGTTAAAACTGG - Intergenic
944529946 2:200657415-200657437 GTTAAATGATTAGCAGAAACTGG + Intronic
944861480 2:203819483-203819505 GTTACTTTCTGAGCAAAAACTGG + Intergenic
945347330 2:208733445-208733467 GGTAATTTATAAAGAAAAACAGG + Intronic
945542638 2:211107506-211107528 GGTAATTTATTAAAAAAAAAAGG + Intergenic
945957134 2:216096779-216096801 GCTGATTTATACGCAAAAACTGG + Intronic
946440770 2:219693305-219693327 GCTAATTTATAAAGAAAAATAGG + Intergenic
946985812 2:225271795-225271817 TCTAATTAATTAGAAAATACTGG + Intergenic
946989944 2:225317321-225317343 GCAAATTTATAAACAAAAAAAGG + Intergenic
947574858 2:231264931-231264953 GCTAATTTTTTAGCAGAGACAGG - Intronic
947806038 2:232968771-232968793 GATATCTTATTAGCCAAAACTGG - Intronic
948012441 2:234660402-234660424 GTTAATTAAATGGCAAAAACTGG + Intergenic
948131440 2:235603314-235603336 GGTAATTTATAAACAAAAAGAGG - Intronic
948312906 2:237002720-237002742 GGTAATTAATTGGTAAAAACTGG + Intergenic
948422968 2:237871703-237871725 TCTAATTTATAAGCAAATCCTGG - Intronic
948647603 2:239417014-239417036 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1170692722 20:18629694-18629716 GGTAATTTATTAAAAAAAAGAGG + Intronic
1173097506 20:40050562-40050584 GCTTATTTATTAGCAATTAAAGG - Intergenic
1175053365 20:56175463-56175485 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1175546608 20:59782197-59782219 GGTAATTTATAAGGAAAAAGAGG + Intronic
1176443000 21:6793643-6793665 GCTAATGTTTTAGTACAAACAGG - Intergenic
1176821157 21:13658657-13658679 GCTAATGTTTTAGTACAAACAGG - Intergenic
1177261448 21:18734193-18734215 GGTAATTTATAAAGAAAAACAGG - Intergenic
1178256516 21:31057514-31057536 GATAATTTATAAAGAAAAACAGG + Intergenic
1178379703 21:32097498-32097520 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1178809439 21:35867838-35867860 GGTAATTTATAAAGAAAAACAGG + Intronic
1178813998 21:35910627-35910649 GGTAATTTATAAAGAAAAACAGG - Intronic
1179161132 21:38900331-38900353 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1179322175 21:40302452-40302474 GCTAATTTATAAAGAAAAAGAGG - Intronic
1180480083 22:15745390-15745412 GCTAATGTTTTAGTACAAACAGG - Intergenic
1180978238 22:19863167-19863189 GCTAATTTTTTAGTAAAGACGGG + Intergenic
1181392177 22:22591387-22591409 GCATATTTAATAGGAAAAACAGG - Intergenic
1183819410 22:40333170-40333192 GCTAATTTTTTAGTAGAGACGGG - Exonic
1184181364 22:42828991-42829013 TATAATTTATTAGCATAAAAGGG - Intronic
1185144862 22:49127072-49127094 GGTAATTTATAAACAAAAAGAGG + Intergenic
949312817 3:2719457-2719479 GCTGATTTTTTAGCAGAGACAGG + Intronic
949707766 3:6838609-6838631 GCAGATTTATTAGAAAAGACAGG - Intronic
949796730 3:7859779-7859801 GGTAATTTATAAGGAAAAAGAGG + Intergenic
950211285 3:11125449-11125471 GGTAATTTATAAGGAAAAAGAGG + Intergenic
950705811 3:14780700-14780722 GCTATTTTTTTAGCCAAAAAAGG + Intergenic
951659576 3:25047677-25047699 GTTTACTTATTTGCAAAAACAGG - Intergenic
951805310 3:26637159-26637181 GCTAATTTTTTAGTAGAGACAGG + Intronic
951824382 3:26851735-26851757 GATCATTTATTAGAAAAAAAAGG + Intergenic
952044253 3:29298980-29299002 GATAATTTATTTGAGAAAACAGG + Intronic
952480348 3:33754657-33754679 GGTAATTTATAAAGAAAAACAGG + Intergenic
953113351 3:39966215-39966237 GCCAAATCATTATCAAAAACAGG + Intronic
953268112 3:41413011-41413033 GGTAATTTATAAGGAAAAAGAGG + Intronic
955156309 3:56420347-56420369 GCTAATTTTTTAGTAAAGACAGG + Intronic
955557997 3:60158703-60158725 GCTACTTCATTATGAAAAACAGG + Intronic
955625835 3:60918231-60918253 GCTAATTTATAAAGAAAAAGAGG - Intronic
955633098 3:60995741-60995763 GATAATTTATTAACCAAAATGGG - Intronic
955936528 3:64108051-64108073 ACAAATTTATTTACAAAAACAGG - Intronic
957476896 3:80737369-80737391 GGTAATTTATAAGGAAAAAGAGG + Intergenic
957527078 3:81391542-81391564 GGTAATTTATAAAGAAAAACAGG + Intergenic
957868743 3:86060599-86060621 GGTAATTTATAAGGAAAAAGAGG - Intronic
957934202 3:86921352-86921374 CATAGTTTATTAGCAAAATCTGG + Intergenic
957937303 3:86961393-86961415 GGTAAATTATTGGCAACAACAGG + Intronic
958196187 3:90245022-90245044 GATAATTTATTAAAAAAAAGAGG - Intergenic
958604510 3:96340019-96340041 GGTAATTTATGAACAAAAAGAGG - Intergenic
959147942 3:102572134-102572156 GCAAATTTATTATCCAAATCAGG - Intergenic
959971095 3:112410932-112410954 GCTAATTTTTTAGTAGAGACAGG + Intergenic
960523378 3:118681359-118681381 GCTAATTTATAAAGAAAAAGAGG - Intergenic
962172105 3:133112255-133112277 GATAATTTAAAAACAAAAACAGG - Intronic
963853561 3:150231546-150231568 GCTAATTTTTTAGTAGAGACGGG + Intergenic
964570115 3:158101899-158101921 GCAAATGTAATAGCAAAAATAGG - Intronic
964789525 3:160439758-160439780 GGTAATTTATAAGGAAAAAGAGG - Intronic
964965929 3:162493797-162493819 AATAATTTATTTGAAAAAACTGG + Intergenic
965182171 3:165417751-165417773 GGTAATTTATAAATAAAAACAGG - Intergenic
966071257 3:175881223-175881245 GTTGTTTTATTAGCAGAAACAGG - Intergenic
968557749 4:1256473-1256495 GGTAATTTATAAGGAAAAAGAGG - Intergenic
968980522 4:3846666-3846688 GGTAATTTATAAGGAAAAAGAGG - Intergenic
969109529 4:4834754-4834776 GGTAATTTATAAGGAAAAACAGG + Intergenic
970702392 4:18757670-18757692 GCTAATTTTTTAGTAGAGACGGG - Intergenic
970872445 4:20831585-20831607 ACTAATTAATTAGAAAAATCTGG + Intronic
970919270 4:21374232-21374254 GCTAATTTACAAGGAAAAAGAGG + Intronic
971948817 4:33316382-33316404 GGTAATTTATAAGGAAAAAGAGG - Intergenic
972245037 4:37237354-37237376 GGTAATTTATAAGGAAAAAAAGG + Intergenic
972937489 4:44156352-44156374 GCTAATTTATAAAGAAAAAGAGG + Intergenic
973610366 4:52630571-52630593 GCTAATTTTTTAGTAGAGACAGG - Intronic
974010156 4:56599077-56599099 GGTAATTTATTAAGAAAAAGAGG - Intronic
974317797 4:60305450-60305472 GGTAATTTATTAAAAAAAAGAGG + Intergenic
974348099 4:60708419-60708441 TCTAATTTATTAGCAGCATCTGG - Intergenic
974778523 4:66520956-66520978 GGTAATTTATGAGAAAAAATGGG + Intergenic
974920930 4:68238057-68238079 GCTAATTACTTAACCAAAACAGG - Intronic
975046116 4:69806808-69806830 GGTAATTTATAAGGAAAAAGAGG - Intergenic
975900793 4:79149656-79149678 GCTAACTTTTTAGCAGACACAGG + Intergenic
976247583 4:83019250-83019272 GCTTATTTATTGGGAAAACCTGG + Intergenic
976326797 4:83780692-83780714 GGTAATTTGTTTGCAAAAAAAGG + Intergenic
976406740 4:84667879-84667901 GCTAATTTTTTAGTAGAGACGGG + Intergenic
979097214 4:116565940-116565962 GGTAATTTATTAAAAAAAAAAGG + Intergenic
979119076 4:116870727-116870749 GCAGATTTATTAGTAAAAAGGGG + Intergenic
980080879 4:128342640-128342662 CCAAATTTATTTGCAAAAACAGG - Intergenic
980350858 4:131681478-131681500 GGTAAATTATAAGCAAAAAGAGG - Intergenic
980430662 4:132689672-132689694 GGTAATTTATTAAGAAAAAGAGG - Intergenic
981003362 4:139850428-139850450 TCTAATTTATTATCCAAACCAGG - Intronic
981864977 4:149406854-149406876 GGTAATTTATGAAGAAAAACAGG + Intergenic
982129331 4:152213342-152213364 GCTAATTTATAAACAAAAAGAGG + Intergenic
982332787 4:154200426-154200448 GTTAATTTATAGGCAAAAAGAGG + Intergenic
982912149 4:161156585-161156607 GTTTATGTATTAGGAAAAACTGG + Intergenic
983117720 4:163840071-163840093 TCAAATTTATTAGCATAAAGTGG - Intronic
983405680 4:167326581-167326603 GGAAATTTTTTAGCAAAAATTGG + Intergenic
983561440 4:169105719-169105741 GCTAATTTTTTTGTAAAGACGGG - Intronic
983894069 4:173062805-173062827 GGTAATTTATAAACAAAAAGAGG - Intergenic
984410041 4:179386333-179386355 GGTAATTTATAAGGAAAAAGAGG + Intergenic
984827343 4:183938319-183938341 GTTAATTTACTAACACAAACTGG - Intronic
985596186 5:789787-789809 GGTAATTTATAAACAAAAAGAGG + Intergenic
985819583 5:2150576-2150598 GGTAATTTATAAGGAAAAAGAGG + Intergenic
986118202 5:4801569-4801591 GGTAATTTATAAAGAAAAACAGG - Intergenic
986391497 5:7291642-7291664 TTTAATTTATTAACAAATACTGG - Intergenic
987244068 5:16030369-16030391 GGTAATTTATAAACAAAAAGAGG + Intergenic
987344106 5:16963675-16963697 GGTAATTTATAAGGAAAAAGAGG - Intergenic
987887292 5:23829227-23829249 GGTAATTTATAAGGAAAAAGAGG + Intergenic
988014242 5:25531547-25531569 GGTAATTTATAAGGAAAAAGAGG - Intergenic
988219219 5:28319616-28319638 GCTAATTTGTTATCTCAAACGGG + Intergenic
988296449 5:29369291-29369313 GCTAATTTATAAAGAAAAAGAGG + Intergenic
988425174 5:31055617-31055639 GGTAATTTATTAAAAAAAAGAGG + Intergenic
988782943 5:34540073-34540095 GGTAATTTATAAACAAAAAGAGG - Intergenic
989656889 5:43754361-43754383 GGTAATTTATAAAGAAAAACAGG + Intergenic
990815950 5:59785015-59785037 GGTAATTTATAAAGAAAAACAGG - Intronic
991354055 5:65749150-65749172 GATAATTTATAAGGAAAAAGAGG - Intronic
993264623 5:85709127-85709149 GCTAATCTTTTACAAAAAACAGG - Intergenic
993451019 5:88072162-88072184 GGTAATTTATAAGGAAAAACAGG + Intergenic
993583183 5:89689717-89689739 GTTAATATATTAGGAAAAACAGG - Intergenic
994468830 5:100176090-100176112 GTAGATTTATTAGCAAAAAGTGG + Intergenic
994540320 5:101087540-101087562 GGTAATTTATAAGTAAAAAGAGG + Intergenic
994763365 5:103884605-103884627 ACTAATATATTAGGAAAAGCTGG + Intergenic
995909567 5:117169294-117169316 GGTAATTTATGAGGAAAAAGAGG - Intergenic
996211363 5:120815345-120815367 GATAATTTATTAAGAAAAAGAGG + Intergenic
996271749 5:121613880-121613902 GCTAAATTATAAGCAAAAACAGG + Intergenic
996809219 5:127495636-127495658 CATAATTTATTTGCAAAGACAGG + Intergenic
997027331 5:130080888-130080910 GCAAATTTATTAGCATGCACAGG + Intronic
997028576 5:130095715-130095737 GCAAAAGTATAAGCAAAAACAGG + Intronic
997422926 5:133783428-133783450 GCTAATTTATCACCTAAACCAGG - Intergenic
997917668 5:137944592-137944614 GCTAATTTTTTAGTAGAGACAGG - Intronic
998569608 5:143245380-143245402 GGTAATTTATAAGGAAAAAGAGG - Intergenic
998573464 5:143287851-143287873 ACAAATTTATTTGCAAAATCAGG - Intronic
999842137 5:155439305-155439327 GCTAATTTTATAGAAAAATCTGG + Intergenic
1000221640 5:159219978-159220000 GGTAATTTATAAAGAAAAACAGG - Intergenic
1000934490 5:167291905-167291927 GGTAATTTATAAGGAAAAAGAGG + Intronic
1001201407 5:169720893-169720915 GCTAATTTTTTAGTAGAGACGGG + Intronic
1002464316 5:179398460-179398482 GCTAAGTTTTTAGTAGAAACGGG - Intergenic
1003196898 6:3922648-3922670 GCAAAATTATTAGGACAAACTGG - Intergenic
1003962582 6:11222586-11222608 GCTATTTTATTCTCATAAACTGG - Intronic
1004956707 6:20735292-20735314 GGTAATTTATTAAAAAAAAGAGG + Intronic
1006834938 6:36992257-36992279 GCTAATTTTTTAGTAGAGACGGG + Intergenic
1007551114 6:42730236-42730258 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1008166445 6:48144614-48144636 ACCAATTTAGTAGCAAAACCAGG + Intergenic
1008168971 6:48179003-48179025 ACTAATTAATTACCAAAAAAAGG - Intergenic
1008597403 6:53056466-53056488 ACAAATTTATTTACAAAAACAGG + Intronic
1008668518 6:53742383-53742405 GATAATTTAATAGAAAAAAGGGG + Intergenic
1009684824 6:66943770-66943792 GGTAATTTATTAAAAAAAATAGG + Intergenic
1009695159 6:67093515-67093537 ATTATTTTATTAGGAAAAACAGG + Intergenic
1010776759 6:79895663-79895685 GGAATTTTATTACCAAAAACAGG + Intergenic
1011673100 6:89703295-89703317 GGTAATTTAATGGCAAAAAATGG - Intronic
1011842051 6:91513754-91513776 GGTAATTTATAAACAAAAAGAGG + Intergenic
1013533865 6:111045586-111045608 GCTGATTTCTTGGCAAAAATTGG - Intergenic
1014147524 6:118015184-118015206 GGTAATTTATAAGGAAAAAGAGG - Intronic
1014945593 6:127493575-127493597 GCTGATTTATTGGCAAATTCAGG - Intronic
1015963202 6:138671283-138671305 GCTAATTTTTTAGTAGAGACGGG - Intronic
1016193929 6:141308433-141308455 TCTATTTTATTAACGAAAACTGG + Intergenic
1016726685 6:147378704-147378726 GCTAAATTGTTAGAAATAACAGG + Intronic
1017239769 6:152154843-152154865 GCTACTTTAATAGCAAAATAAGG + Intronic
1017490073 6:154937278-154937300 GCTAATTTTTTAGTAGAAATGGG + Intronic
1017802578 6:157910946-157910968 GCTAATTTTTTAGTAGAGACAGG - Intronic
1018256895 6:161929686-161929708 GCTAATTTTTTAGTAGAAACGGG + Intronic
1018468530 6:164075485-164075507 GCTTATTTGTTAGCAAAAGGAGG + Intergenic
1020869199 7:13606697-13606719 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1021280416 7:18709983-18710005 GGTAATTTATAAAGAAAAACAGG + Intronic
1021497245 7:21289535-21289557 GGTAATATTTGAGCAAAAACTGG + Intergenic
1022615186 7:31922338-31922360 GTTAAATTATAAGCAAAACCTGG - Intronic
1022890049 7:34687930-34687952 GCTGATTTAAAAGCAGAAACTGG + Intronic
1024342800 7:48284100-48284122 GCTAGTTCATAAGTAAAAACTGG + Intronic
1026081797 7:67228201-67228223 GGTAATTTATAAGAAAAAAGAGG + Intronic
1026351793 7:69523319-69523341 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1026695271 7:72585788-72585810 GGTAATTTATAAGAAAAAAGAGG - Intronic
1027127346 7:75566191-75566213 GCTAATTTTTTAGTAGAGACGGG + Intronic
1027388587 7:77682600-77682622 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1027733750 7:81906947-81906969 GGTAATTTATAAGCAGAAAGAGG - Intergenic
1028066408 7:86390818-86390840 GGTAATTTATAAAGAAAAACAGG + Intergenic
1029246272 7:99204205-99204227 GCTAATTTTTTGGTAGAAACAGG - Intronic
1030592072 7:111493833-111493855 GCTAATTTTTTGGCAGAGACGGG - Intronic
1031275339 7:119713629-119713651 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1031818923 7:126473973-126473995 GGTAATTTATAAAGAAAAACAGG - Intronic
1032145102 7:129372413-129372435 GGTAATATATTAAGAAAAACAGG - Intronic
1032447056 7:131993208-131993230 GGTAATTTATAAACAAAAATAGG - Intergenic
1032531764 7:132626688-132626710 GGTAATTTATTAAAAAAAAGAGG - Intronic
1033143442 7:138849033-138849055 CCAAATTTATTAACAAAAATGGG + Intronic
1033289376 7:140070045-140070067 GCTAATTTTTTAGTAAAGATGGG - Intergenic
1033423648 7:141224212-141224234 GGTAATTTATAAAGAAAAACAGG - Intronic
1034114828 7:148575514-148575536 AGTAATTTATTAGGAAAAAATGG + Intergenic
1034328475 7:150260050-150260072 ACAACTTTATTTGCAAAAACAGG - Intronic
1034764737 7:153709404-153709426 ACAACTTTATTTGCAAAAACAGG + Intergenic
1036077477 8:5517437-5517459 GCTAAATTATTAGGTAAAAAAGG - Intergenic
1037193852 8:16162571-16162593 GCAGATTTATTAACAAAAGCAGG + Intronic
1037361341 8:18077750-18077772 GCTCATTTATTAGCAAAATAAGG - Intronic
1037379536 8:18269842-18269864 GTCAATTTATTAGGAAAGACTGG - Intergenic
1038139924 8:24833377-24833399 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1038320348 8:26520235-26520257 GGTAATTTATTAAGAAAAAGAGG - Intronic
1038652420 8:29417724-29417746 GGTAATTTATAAACAAAAAGGGG + Intergenic
1038759049 8:30369370-30369392 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1039118653 8:34121246-34121268 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1039120982 8:34146041-34146063 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1039166882 8:34691746-34691768 GCTAATTTTTTTGCAGAAACAGG - Intergenic
1039910867 8:41825944-41825966 GGTAATTTATTAAGAAAAAGAGG - Intronic
1040009186 8:42647193-42647215 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1041443473 8:57924654-57924676 GCTTAAATATTAGGAAAAACTGG - Intergenic
1041543051 8:59008827-59008849 GCTAATTTCTTAGCAGAATTTGG + Intronic
1041635437 8:60137782-60137804 GGTAATATATTAGAAAAATCTGG + Intergenic
1041836352 8:62220306-62220328 GCTTATATGTGAGCAAAAACAGG + Intergenic
1042761647 8:72277459-72277481 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1042965429 8:74346889-74346911 GCTAATTTTTTAGTAGAGACAGG + Intronic
1044070607 8:87755615-87755637 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1044426116 8:92052567-92052589 GCTTATTTATGACCAAAAAGGGG + Intronic
1044918297 8:97139126-97139148 TCTTAATTATTAGGAAAAACTGG + Intronic
1045597355 8:103671371-103671393 GCTGATTTATTATGAAAACCTGG + Intronic
1045873946 8:106957261-106957283 GTTCATTTATAAGAAAAAACTGG - Intergenic
1046579550 8:116075301-116075323 GCTATATTATTTACAAAAACAGG + Intergenic
1046701865 8:117409899-117409921 GCAAATTTAGGAACAAAAACTGG + Intergenic
1047389210 8:124436562-124436584 GGTAATTTATTAAGAAAAAGAGG - Intergenic
1047591555 8:126332323-126332345 GCTAATTTAGGATTAAAAACTGG - Intergenic
1047686514 8:127310241-127310263 GCTAATTTGGTAGCTAAAAATGG - Intergenic
1048624950 8:136174920-136174942 GCTTATTTATTTGCTGAAACTGG + Intergenic
1049171238 8:141162146-141162168 AATAATTTATTAGGAAAAAATGG + Intronic
1050675387 9:8046709-8046731 ACAAATTTATAAGTAAAAACAGG - Intergenic
1050707029 9:8412467-8412489 GTTAATTTGGTGGCAAAAACTGG - Intronic
1050758772 9:9040220-9040242 AGTAATTTGTTAGCAAAATCAGG + Intronic
1050762468 9:9089302-9089324 AATACTTTATTGGCAAAAACAGG + Intronic
1051347271 9:16163532-16163554 TCTAATTTAGTAGGAAAATCAGG + Intergenic
1052267286 9:26589633-26589655 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1052294450 9:26881616-26881638 GGTAATTTATAAGGAAAAAGAGG - Intronic
1052867630 9:33474375-33474397 GCTAAGTAATAAGTAAAAACTGG - Intergenic
1053927810 9:43083611-43083633 GGTAATTTATTAAGAAAAAAAGG - Intergenic
1055201291 9:73665647-73665669 GCTAATATATTACCAATACCTGG + Intergenic
1055552991 9:77448077-77448099 AGAACTTTATTAGCAAAAACAGG - Intronic
1055627933 9:78193846-78193868 GGTAATTTATAAACAAAAAGAGG + Intergenic
1055792833 9:79941911-79941933 TCTAATATATTAGTAAAAACTGG + Intergenic
1056444620 9:86653802-86653824 GGTAATTTATAAGCAAAAGAGGG + Intergenic
1056607173 9:88095719-88095741 GCTAATTTTTTAGTAGACACAGG - Intergenic
1056824918 9:89870259-89870281 GCTGATTTATTAGAGAAAATGGG + Intergenic
1057716399 9:97499203-97499225 GCTAATTTTTTGGTAAAGACAGG - Intergenic
1057797029 9:98165129-98165151 GCTAATTTTTTTGTAAAGACAGG + Intronic
1058104428 9:100954693-100954715 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1058179555 9:101779940-101779962 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1058422603 9:104846861-104846883 AGTAATTCATGAGCAAAAACAGG + Intronic
1058937823 9:109785506-109785528 GGTAATTTATAAGGAAAAAGAGG + Intronic
1059230217 9:112713817-112713839 GCTAATTTTTTTGTAGAAACGGG - Intronic
1059527976 9:115010388-115010410 GCTACTTTCATAGCAAAACCAGG + Intergenic
1060695314 9:125704616-125704638 GAAAAGTTATTAGCAGAAACTGG + Intronic
1061694095 9:132358072-132358094 ACTTATTTATTTGCAGAAACGGG - Intergenic
1203526203 Un_GL000213v1:90888-90910 GCTAATGTTTTAGTACAAACAGG + Intergenic
1185595502 X:1304233-1304255 GCTAATTTTTTAGTAGAGACGGG - Intronic
1185973881 X:4696688-4696710 GGTAATTTATAAAGAAAAACAGG + Intergenic
1186069296 X:5800972-5800994 GGTAATTTATAAAGAAAAACAGG + Intergenic
1186147632 X:6641506-6641528 GGTAATTTATAAGCAAAAAGAGG + Intergenic
1186332584 X:8551145-8551167 GGTAATTTATAAGGAAAAAGAGG - Intronic
1186828507 X:13365818-13365840 ACAACTTTATTTGCAAAAACAGG - Intergenic
1186832103 X:13401286-13401308 GATAATTTTTTAGGAAAACCTGG - Intergenic
1186838950 X:13465737-13465759 GCTAATTTTTTAGTAGAGACAGG + Intergenic
1187057137 X:15751705-15751727 TCTAAGTTACTAGGAAAAACAGG + Intronic
1187387082 X:18858820-18858842 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1187851051 X:23592112-23592134 GGTAATTTATAAGGAAAAAAAGG - Intergenic
1187899699 X:24016173-24016195 GCTAATTTTTTAGTAGAGACGGG - Intronic
1188617793 X:32179947-32179969 GGTAATTTATAAGTAAAAAGAGG - Intronic
1188731282 X:33648915-33648937 GCTAATTTATAAAGAAAAAGAGG + Intergenic
1189760305 X:44315300-44315322 GGTAATTTATTAAAAAAAAAAGG - Intronic
1189976748 X:46468361-46468383 GCTAATTTTTTAGTATAGACGGG - Intronic
1190822466 X:53986404-53986426 GCTAATTTTTTAGCAGAGACAGG + Intronic
1191624847 X:63259622-63259644 CCTAATTTATTACTGAAAACCGG + Intergenic
1191998120 X:67118624-67118646 GCAAATTTATTTGCAAAACCAGG + Intergenic
1192364344 X:70458461-70458483 GTTAATTTATTTGTAGAAACAGG + Intronic
1193497329 X:82231074-82231096 GGTAATTTATAAGAAAAAAGAGG - Intergenic
1193686120 X:84579229-84579251 GGTAATTTATAAGGAAAAAGAGG - Intergenic
1194259878 X:91681559-91681581 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1194442333 X:93948118-93948140 GCTAATTGATGAGGAAAAAATGG + Intergenic
1195034930 X:100963899-100963921 GGTAAAATATTAGCAATAACTGG - Intergenic
1195952930 X:110296247-110296269 GCTAATTTCTCAGCAGAAACTGG - Intronic
1196307365 X:114119803-114119825 ACAATTTTATTTGCAAAAACAGG + Intergenic
1197172224 X:123447032-123447054 GATAATTTATTAGCAGACATTGG - Intronic
1197314030 X:124941809-124941831 GGTAATTTATAAGGAAAAAGAGG + Intronic
1197610052 X:128628104-128628126 GCTAATTTTTTAGTAGAGACGGG - Intergenic
1198583822 X:138096900-138096922 GGTAATTTATTAAAAAAAAAAGG + Intergenic
1199350396 X:146794075-146794097 GGTAATTTATGAACAAAAAGAGG - Intergenic
1199462523 X:148100299-148100321 GGTAATTTATAAACAAAAAGAGG - Intergenic
1199929906 X:152507449-152507471 GGTAATTTATAAGGAAAAAGAGG + Intergenic
1199948828 X:152689229-152689251 GGTAATTTATTAAAAAAAATAGG + Intergenic