ID: 1097831967

View in Genome Browser
Species Human (GRCh38)
Location 12:64234661-64234683
Sequence ATGAGTCAAAACATCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097831967_1097831969 -4 Left 1097831967 12:64234661-64234683 CCAAGACAGATGTTTTGACTCAT No data
Right 1097831969 12:64234680-64234702 TCATTACCACTAGTGTCTTTGGG No data
1097831967_1097831971 19 Left 1097831967 12:64234661-64234683 CCAAGACAGATGTTTTGACTCAT No data
Right 1097831971 12:64234703-64234725 ACAGAAGACAGCTCCAGACCTGG No data
1097831967_1097831968 -5 Left 1097831967 12:64234661-64234683 CCAAGACAGATGTTTTGACTCAT No data
Right 1097831968 12:64234679-64234701 CTCATTACCACTAGTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097831967 Original CRISPR ATGAGTCAAAACATCTGTCT TGG (reversed) Intergenic
No off target data available for this crispr