ID: 1097831968

View in Genome Browser
Species Human (GRCh38)
Location 12:64234679-64234701
Sequence CTCATTACCACTAGTGTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097831966_1097831968 10 Left 1097831966 12:64234646-64234668 CCAAATCTGAAGTATCCAAGACA No data
Right 1097831968 12:64234679-64234701 CTCATTACCACTAGTGTCTTTGG No data
1097831967_1097831968 -5 Left 1097831967 12:64234661-64234683 CCAAGACAGATGTTTTGACTCAT No data
Right 1097831968 12:64234679-64234701 CTCATTACCACTAGTGTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097831968 Original CRISPR CTCATTACCACTAGTGTCTT TGG Intergenic
No off target data available for this crispr