ID: 1097834629

View in Genome Browser
Species Human (GRCh38)
Location 12:64260596-64260618
Sequence TAGGCTATTACAGTAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097834625_1097834629 16 Left 1097834625 12:64260557-64260579 CCTTTAAAAAATGGATTGTAGGG 0: 1
1: 0
2: 2
3: 17
4: 208
Right 1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1097834623_1097834629 17 Left 1097834623 12:64260556-64260578 CCCTTTAAAAAATGGATTGTAGG 0: 1
1: 0
2: 5
3: 56
4: 467
Right 1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1097834622_1097834629 21 Left 1097834622 12:64260552-64260574 CCGTCCCTTTAAAAAATGGATTG 0: 1
1: 0
2: 4
3: 39
4: 361
Right 1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 68
1097834621_1097834629 24 Left 1097834621 12:64260549-64260571 CCACCGTCCCTTTAAAAAATGGA 0: 1
1: 0
2: 0
3: 20
4: 266
Right 1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097834629 Original CRISPR TAGGCTATTACAGTAGTTGC TGG Intergenic
910141648 1:84032845-84032867 TGGGCAATGACAGTAGTGGCTGG - Intergenic
911055661 1:93706184-93706206 GAGGCAATTACAGTAGCTTCAGG + Intronic
912674612 1:111667106-111667128 GAGGCTATTTCAGTAGTCCCAGG + Intronic
913426427 1:118736291-118736313 TTGGTTATGACAGTAGCTGCTGG - Intergenic
916570239 1:166019263-166019285 GAGGCTATTGCAGTAGTTTAGGG + Intergenic
919492521 1:198223240-198223262 TAGGCTATTATGGTAGTCCCAGG + Intronic
922970456 1:229732124-229732146 TGGGCTACTACTGTAGTTGCAGG - Intergenic
1062986925 10:1777614-1777636 TAGGTTATTATAGTATTTGATGG - Intergenic
1070209377 10:74299958-74299980 TATGCAATAACAGTAGTTGAAGG - Intronic
1072582969 10:96756264-96756286 TAGGTTAATACAGTAGTGCCAGG - Intergenic
1076190104 10:128476960-128476982 CTGGCTATTACTGCAGTTGCAGG - Intergenic
1078230382 11:9436268-9436290 CAGGTTCTTACAGGAGTTGCAGG + Exonic
1079603374 11:22338433-22338455 TAATCTCTTAAAGTAGTTGCGGG - Exonic
1081124342 11:39304390-39304412 AAGGCTATTACAGTAGCTTCAGG + Intergenic
1097834629 12:64260596-64260618 TAGGCTATTACAGTAGTTGCTGG + Intergenic
1099379285 12:81935757-81935779 TGGGCTATGACAGGAGTGGCTGG + Intergenic
1099689876 12:85938816-85938838 TGGGCTATGACAGGGGTTGCTGG - Intergenic
1100331647 12:93588226-93588248 TAGCATATTACAGTTGTTGTAGG + Intergenic
1101074423 12:101113732-101113754 TAGGGTAGTACAGTGATTGCTGG + Intronic
1104599367 12:130142120-130142142 GAGGACATTACAGTAGTCGCGGG - Intergenic
1105825875 13:24122607-24122629 AAGGTTCTTACAGGAGTTGCAGG - Intronic
1111880929 13:93956145-93956167 TGGGGTATTATAGCAGTTGCAGG - Intronic
1112729201 13:102340955-102340977 TGTGCTATTACACTTGTTGCCGG + Intronic
1116785430 14:49282506-49282528 AAGGCTATTATATTAGATGCTGG - Intergenic
1119577916 14:75744510-75744532 AAGGCTATCACTGTGGTTGCTGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120673368 14:87389834-87389856 TAGGATATTTCAGTAGCTTCTGG + Intergenic
1126059387 15:44765091-44765113 AAAGCTATTGCAGTAGTTCCAGG + Intronic
1127320629 15:57841684-57841706 TAGAATATTCCAGTTGTTGCAGG + Intergenic
1141307551 16:82880598-82880620 TGGGCTATTAGAGTAGCAGCTGG - Intronic
1149798104 17:59540151-59540173 AAGGCTGTTGCAGTAGTTTCAGG - Intergenic
1156086024 18:33403719-33403741 CAGGCTAATGCAGAAGTTGCTGG + Intronic
927520957 2:23697752-23697774 GAGGATATTACCGCAGTTGCTGG + Intronic
928356115 2:30616434-30616456 TAGATTACTACAGTAGTAGCAGG - Intronic
930265570 2:49195262-49195284 CAGGCTATTAGAACAGTTGCAGG + Intergenic
935012460 2:99148488-99148510 TAGGCTACTACAGTAGACCCAGG + Intronic
941052234 2:160747972-160747994 TCGGCTATTCTAATAGTTGCTGG - Intergenic
942798112 2:179845086-179845108 AGGGCTATTAGAGTAGTTTCTGG - Intronic
946745219 2:222838722-222838744 TAGGACATTACTGTTGTTGCTGG - Intergenic
1169703520 20:8476064-8476086 AAGGCTATTACAGTCATTTCCGG + Intronic
1170831761 20:19848826-19848848 TAGTATATTACAGTAACTGCAGG - Intergenic
1174983375 20:55422111-55422133 TAGCCTATGACAGTGGTCGCTGG - Intergenic
1176361457 21:6000187-6000209 AAGGCTATTACAGTAGTCTGGGG + Intergenic
1176729365 21:10476881-10476903 TTGCCTATTACAATAGATGCAGG + Intergenic
1178445865 21:32641222-32641244 TAGGCTAGTCCAGTAGGAGCTGG - Intronic
1179762061 21:43538363-43538385 AAGGCTATTACAGTAGTCTGGGG - Intronic
960107852 3:113817346-113817368 GATTCTATTACAGTAGTTTCAGG + Intergenic
961860343 3:129912281-129912303 TAGGCTAGAACAGTAGTGGGCGG + Intergenic
965666354 3:171097776-171097798 TGGACTAATACAGTAGTTGATGG + Intronic
976483940 4:85578166-85578188 TAGTCAATTATAGGAGTTGCAGG - Intronic
983146768 4:164226342-164226364 TAAGCTATTAGAGTCGTTGGAGG + Intronic
997984933 5:138494063-138494085 TAGGCTGCTACAGAATTTGCAGG + Intergenic
999792584 5:154955216-154955238 TAGGCTATTGCTATAGTTTCAGG + Intronic
999933156 5:156455684-156455706 TAGGCTATTACAGTGATTGAAGG + Intronic
1000423234 5:161061040-161061062 TAGGCTATTACTGGAGCTGGAGG + Intergenic
1001170153 5:169411655-169411677 TAGGCAATTATAGTAGCAGCAGG + Intergenic
1002053182 5:176583563-176583585 CAGGCTGTGACAATAGTTGCAGG + Intronic
1003162963 6:3651575-3651597 AAGTCCAATACAGTAGTTGCTGG + Intergenic
1013153909 6:107475099-107475121 TAGTCTAGTACAGTAGTGGTTGG - Intergenic
1015873489 6:137800228-137800250 AAGGCTGTTACAGTACTTTCAGG + Intergenic
1016946482 6:149539237-149539259 TTGGCTGATACAGTAGTAGCAGG + Intronic
1026544176 7:71307401-71307423 TATGTTATTACACTAGGTGCTGG + Intronic
1028769397 7:94599345-94599367 TAGGTTATTACTGTAGATTCTGG + Intronic
1034863234 7:154618121-154618143 AAGGCTATTAAAGTTGCTGCTGG + Intronic
1046261270 8:111771400-111771422 TAGGCTATTACACTTTTTGGAGG + Intergenic
1047725795 8:127683003-127683025 TTGGCTATTACATTTGCTGCAGG - Intergenic
1051042260 9:12825886-12825908 AAGGCTATTGCAGTAGTTTCAGG - Intergenic
1192610772 X:72564602-72564624 TAGTTTATTACAGTAGATGAGGG + Intronic
1192945615 X:75963403-75963425 TGGGCTGTTGCAGTAGATGCAGG - Intergenic
1197583780 X:128318122-128318144 TAGGCTTTTACACTAGATACTGG + Intergenic
1198606164 X:138340337-138340359 TAGGGTATTTCAGTAGTATCTGG - Intergenic
1199493342 X:148425653-148425675 TACTTTATTACAGTAGCTGCAGG - Intergenic
1200242200 X:154502834-154502856 TGGGCAATCACAGCAGTTGCTGG + Intergenic