ID: 1097835108

View in Genome Browser
Species Human (GRCh38)
Location 12:64265104-64265126
Sequence TCCTCTCGTTGTCATCCTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097835103_1097835108 23 Left 1097835103 12:64265058-64265080 CCCAGATCCAGGGCACTGCGGAG 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1097835108 12:64265104-64265126 TCCTCTCGTTGTCATCCTGCGGG 0: 1
1: 0
2: 2
3: 11
4: 93
1097835104_1097835108 22 Left 1097835104 12:64265059-64265081 CCAGATCCAGGGCACTGCGGAGA 0: 1
1: 0
2: 1
3: 5
4: 146
Right 1097835108 12:64265104-64265126 TCCTCTCGTTGTCATCCTGCGGG 0: 1
1: 0
2: 2
3: 11
4: 93
1097835105_1097835108 16 Left 1097835105 12:64265065-64265087 CCAGGGCACTGCGGAGAAGCTAA 0: 1
1: 0
2: 2
3: 10
4: 108
Right 1097835108 12:64265104-64265126 TCCTCTCGTTGTCATCCTGCGGG 0: 1
1: 0
2: 2
3: 11
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097835108 Original CRISPR TCCTCTCGTTGTCATCCTGC GGG Intronic