ID: 1097837069

View in Genome Browser
Species Human (GRCh38)
Location 12:64283804-64283826
Sequence TTCAAACACAAGGTGAGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 161
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 146}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097837069 Original CRISPR TTCAAACACAAGGTGAGCCA GGG (reversed) Intronic
905744812 1:40406046-40406068 TTCAATTACAGGTTGAGCCATGG + Intronic
906901779 1:49843754-49843776 TTTAAAAAAAAGGTAAGCCAGGG - Intronic
908181189 1:61607533-61607555 TTCAAACACAAAGCAGGCCAAGG + Intergenic
909688268 1:78375524-78375546 ATCATACACAGGGTGAGGCATGG - Intronic
911315608 1:96353143-96353165 CTCAAAGAAAAGGTGAGCTAGGG - Intergenic
913210510 1:116578530-116578552 TTCTAACACAATGTGAGCACGGG + Intronic
915328418 1:155093256-155093278 CACAAACACAAGGAGAGGCAGGG + Intergenic
915406024 1:155660298-155660320 CTCAAAAAGAAGGGGAGCCAGGG - Exonic
916378353 1:164181056-164181078 TGCAAAGAAAAGCTGAGCCAGGG + Intergenic
917182344 1:172313520-172313542 TTGAAACATAATGTGTGCCATGG + Intronic
917320020 1:173771089-173771111 TTCAAGAAAAACGTGAGCCAAGG + Intronic
917438115 1:175041516-175041538 TTAAAAAACAATGTGGGCCAAGG - Intergenic
917486699 1:175461368-175461390 TTAAATCTAAAGGTGAGCCAGGG - Intronic
917970151 1:180201083-180201105 TTCACAGACGAGCTGAGCCAAGG - Exonic
923998853 1:239528402-239528424 TTCAAACAGATGGTCAGCCAAGG - Intronic
1063359036 10:5433596-5433618 ATGAAAGAAAAGGTGAGCCATGG - Intronic
1063414372 10:5861507-5861529 TTCTAACATAAGGCGAACCATGG + Intergenic
1066340897 10:34532360-34532382 TTCAAACACAAGTTGTTCAAGGG + Intronic
1067999650 10:51317478-51317500 TTTACACATAAGGAGAGCCAAGG - Intronic
1069634890 10:69919051-69919073 TTTCCACACAGGGTGAGCCAGGG + Exonic
1069915075 10:71782339-71782361 AGCACACACAAGGTGGGCCAGGG + Intronic
1070397002 10:76020096-76020118 ATCAAACACAAGGTGAGCTGAGG + Intronic
1073894714 10:108142011-108142033 TTCAATCAAAAGTTGAGTCAGGG - Intergenic
1074060216 10:109958527-109958549 GTCAAGGGCAAGGTGAGCCAGGG + Intergenic
1076617188 10:131763211-131763233 TTCATGCACAAGGTGGCCCAGGG + Intergenic
1076619421 10:131777744-131777766 TTCAAGCAGAAGGGGGGCCAAGG + Intergenic
1080615520 11:33941833-33941855 TTCAGAGACACTGTGAGCCAGGG + Intergenic
1081742075 11:45447961-45447983 TGCAAACACCACGTGAGGCAAGG + Intergenic
1082713382 11:56582710-56582732 TTCAAACACAAGTTGAACAGGGG + Intergenic
1091037612 11:132247646-132247668 TTCAAGCAGGAGGTGGGCCATGG + Intronic
1091329901 11:134724182-134724204 ATAAATCACAAAGTGAGCCAAGG + Intergenic
1097837069 12:64283804-64283826 TTCAAACACAAGGTGAGCCAGGG - Intronic
1102014418 12:109638274-109638296 TCCAAAGAGAAGGTGAGCCTGGG + Intergenic
1105901725 13:24760788-24760810 CTCAAACAGAAAGTGAGCAAAGG + Intergenic
1106075762 13:26459559-26459581 CTCAAAGACAAGCTGGGCCAGGG + Intergenic
1111055345 13:82941844-82941866 TTCAGAAACAATGTGAGCCCTGG - Intergenic
1112325704 13:98441612-98441634 TTCTCACACCAGGTGGGCCAGGG + Intronic
1112746905 13:102536859-102536881 TGCCAACACAAGAGGAGCCAAGG - Intergenic
1115303080 14:31905975-31905997 TTCAAACACAACCTAAGTCAAGG - Intergenic
1118861005 14:69663488-69663510 TTCCAAGATGAGGTGAGCCAGGG - Intronic
1119091767 14:71789485-71789507 TTCAAACACAGTGCCAGCCATGG - Intergenic
1119982200 14:79094249-79094271 TTCAGAAGCAAGGTAAGCCACGG - Intronic
1127744727 15:61955594-61955616 TCCAAACATAATGTGAACCAGGG + Intronic
1137454413 16:48607532-48607554 CTCTAACACAAGTTGAACCAGGG + Intronic
1137552878 16:49452666-49452688 TTGAAAGGAAAGGTGAGCCAAGG - Intergenic
1138107774 16:54299050-54299072 TTCAGTCACATGGTCAGCCAGGG - Intergenic
1141401289 16:83749349-83749371 TTCAAAATAAAGGTGAGCCTTGG + Intronic
1141703696 16:85653608-85653630 TTCACACACACGGTGGGGCAGGG - Intronic
1145119298 17:20242345-20242367 TTAAATGACAAGGTGAGGCATGG + Intronic
1146205466 17:30901403-30901425 TTCAAACTCAAGTGTAGCCAAGG + Intronic
1146946006 17:36874077-36874099 TTCAAAGACAAAGTGAGTCCTGG + Intergenic
1150897109 17:69224845-69224867 TTCAAACTCAAGCTTAGCAATGG - Intronic
1151180724 17:72325631-72325653 ATCAGACACAAGGTGAACCTGGG - Intergenic
1153166478 18:2267376-2267398 TTCAATCACAAGGTTAGAGAAGG + Intergenic
1153667597 18:7380103-7380125 TTCAAAGATAAGGTTAACCAAGG - Intergenic
1155717346 18:28961463-28961485 TTCAAAAACATGTTGAGCAAGGG - Intergenic
1157153833 18:45245263-45245285 TTCACACATAAGGCAAGCCAGGG - Intronic
1158243227 18:55401569-55401591 TCCAAACACAAGGTGAGAAGTGG - Intronic
1159610620 18:70521225-70521247 TTCAAAAACCAGGTGAGATATGG - Intergenic
1160111074 18:76031884-76031906 GTAAAGCACAAGGTGAGCCTGGG - Intergenic
1161014039 19:1974663-1974685 GACAGAAACAAGGTGAGCCACGG - Intronic
1162738036 19:12757490-12757512 TGCAAACACAGGGTGAGGCCAGG + Intronic
1163612441 19:18308467-18308489 TTCAAACAGCAGGAGAGCCAAGG + Intronic
1165502327 19:36199804-36199826 TTAAAACACAAAGTTAGGCATGG - Intronic
925316570 2:2931178-2931200 TGAAAACACCAGGTGAGCCTCGG + Intergenic
925866334 2:8230550-8230572 TGCAAATACAAGGTGACCCCAGG - Intergenic
928692662 2:33816861-33816883 GTCAAAGCCAAAGTGAGCCAAGG - Intergenic
930173547 2:48276943-48276965 CTCAAAGAAAACGTGAGCCAAGG - Intergenic
931834421 2:66083828-66083850 TTCAAGCTCACTGTGAGCCAAGG + Intergenic
933056088 2:77667051-77667073 TTTAAAAACAAAGTGAGCCAAGG - Intergenic
933687451 2:85154501-85154523 TCCAAACACAAGGAAAGCCTTGG - Intronic
934862264 2:97774139-97774161 TTCAAACGATATGTGAGCCAGGG - Intronic
938601713 2:132849233-132849255 TTCAAAAAGAGGGGGAGCCATGG - Intronic
939126491 2:138183900-138183922 TTCACACACAGTGGGAGCCAGGG - Intergenic
940725132 2:157328281-157328303 TGTAAACACATGGTTAGCCAAGG - Intergenic
941680077 2:168388406-168388428 TTCCATCAAAACGTGAGCCAAGG + Intergenic
943999867 2:194820431-194820453 TACATACACAAGGTAAGCCTAGG - Intergenic
948611894 2:239175246-239175268 TATAAACACACAGTGAGCCAAGG + Intronic
1169186301 20:3620025-3620047 TTGAAACAAAAGGAGAGGCAGGG - Intronic
1171138409 20:22719347-22719369 TTCAAGGACAAGGGAAGCCAGGG + Intergenic
1174073881 20:47918424-47918446 GTCAAGCACAAGGTGAGGTAAGG + Intergenic
1175032052 20:55964419-55964441 TTCAAACACAGGCTGAGTCCAGG + Intergenic
1179154838 21:38840721-38840743 TGGAACCACAAGGAGAGCCATGG - Intergenic
1179221130 21:39408525-39408547 CCCAAACACCAGGTGAGCCAGGG + Intronic
1179295244 21:40055750-40055772 TTCAATCAAAAGCTGAGCCCTGG + Exonic
1182532522 22:30970936-30970958 TTAGAACACAAGGAGGGCCAAGG - Intergenic
1184368218 22:44066257-44066279 TTCAAACAGAAGCAGAGCCGGGG + Intronic
1185395705 22:50586576-50586598 TTCAAGCACAGGGGTAGCCAGGG - Intronic
950506210 3:13396346-13396368 TTCAAAGACAAAGTGAGCCTTGG + Intronic
950961394 3:17111691-17111713 TCCAAACACAAGATGGGCCAGGG + Intergenic
953633458 3:44640671-44640693 TTCAAACATAAGGAGAGGCCGGG - Intronic
953772843 3:45792143-45792165 TCCAATGTCAAGGTGAGCCATGG + Intronic
953790834 3:45946702-45946724 GACAAACACCAGGTCAGCCAGGG - Exonic
956716652 3:72085646-72085668 CTCCATCACAAGGCGAGCCAGGG - Intergenic
956958230 3:74366476-74366498 TTAAAACACAAGCTGAGACTTGG - Intronic
958001550 3:87756785-87756807 TGCAAACACAAATAGAGCCAAGG + Intergenic
959003159 3:100988527-100988549 TACAAACACAAGTTGAGACAAGG - Intronic
960157991 3:114317442-114317464 TTCAAAAATGAGGTGAGCAATGG - Intergenic
961000204 3:123368977-123368999 ATCAAACACAAGGTGGGAGATGG + Intronic
965255810 3:166409443-166409465 TTCAAAAACAAGATGAATCAGGG - Intergenic
969197945 4:5578004-5578026 TTCAAGCACCAGGAGAGCCCTGG + Intronic
970181621 4:13403094-13403116 TTCAAAGAATATGTGAGCCAGGG - Intronic
973846023 4:54914114-54914136 TTCAAACACAAGGCTAGCAGGGG - Intergenic
975400987 4:73939399-73939421 TCCAAACACAAAGTGCTCCAAGG - Intergenic
976192014 4:82496550-82496572 TTCAAAAACAAGGTCAGCACAGG + Intronic
980434371 4:132749278-132749300 TACAAAGACAAGATGAGACAAGG - Intergenic
980874412 4:138646461-138646483 TTCAAACATAAGGTGTACCAAGG - Intergenic
980948212 4:139345088-139345110 TTCAACCTCAAGGTGAGCCAAGG - Intronic
982688657 4:158523750-158523772 GCTAAACTCAAGGTGAGCCACGG - Intronic
984655866 4:182317596-182317618 TTAAAACACAAGGCCAGGCATGG - Intronic
984839493 4:184054904-184054926 ATCAAACACAAGTTCAGACAAGG - Intergenic
987637225 5:20559416-20559438 TTCAAACATAAGCAGAGCAATGG + Intronic
990122437 5:52471590-52471612 TTGAAACAAAAGGAGGGCCAGGG + Intergenic
990914403 5:60888185-60888207 CTCAAAAACAATGTGAGGCATGG + Intronic
994079441 5:95690428-95690450 GATAAGCACAAGGTGAGCCAGGG + Intronic
994606710 5:101976653-101976675 TTCCAACACAAGGTGAGTCTAGG - Intergenic
994701283 5:103138866-103138888 TTCAAACACATGCTGTTCCAGGG - Intronic
999906855 5:156150319-156150341 TTAAAACATAAGCTGAGCCTTGG - Intronic
1000244935 5:159441544-159441566 TGCCACCACATGGTGAGCCAAGG - Intergenic
1000674780 5:164106993-164107015 TTCAAACATGAGCTCAGCCAAGG - Intergenic
1001846045 5:174922472-174922494 TTAAAACACAAGTTGAGGCCGGG + Intergenic
1002953456 6:1839222-1839244 TTTAAACAAGAAGTGAGCCAGGG + Intronic
1004954767 6:20717140-20717162 TTTAAACAGAATGAGAGCCAAGG + Intronic
1004962866 6:20811405-20811427 TTAAGACACAAGGTGAGTAAAGG - Intronic
1013265477 6:108493315-108493337 TTCCAGAACATGGTGAGCCAAGG + Intronic
1014294710 6:119604253-119604275 ATAACACACCAGGTGAGCCAGGG - Intergenic
1016269204 6:142269128-142269150 TTCCGACACTAGGGGAGCCACGG - Intergenic
1016491508 6:144609265-144609287 TGGAAACCCAAGGAGAGCCAGGG + Intronic
1017869582 6:158475545-158475567 TTCAAACACAACGTGAATCTGGG + Intronic
1017913774 6:158817494-158817516 CTCTAACAGAAGGTTAGCCATGG - Intronic
1017947990 6:159111387-159111409 ATTAAACACCAGGTGAGACAAGG + Intergenic
1018936745 6:168278800-168278822 ATCTAAGACAGGGTGAGCCACGG + Intergenic
1018936762 6:168278874-168278896 ATCTAAGACAGGGTGAGCCACGG + Intergenic
1018936778 6:168278948-168278970 ATCTAAGACAGGGTGAGCCACGG + Intergenic
1019318602 7:404117-404139 TTCATACACTAGATGAGCCCAGG + Intergenic
1021653260 7:22851993-22852015 TTCACACTCAAGGTGACCCAAGG + Intergenic
1026046935 7:66912359-66912381 GGCAAACACAAGCTGACCCAGGG - Intergenic
1026438455 7:70420980-70421002 TTCTAGCACAGAGTGAGCCATGG - Intronic
1028687855 7:93612566-93612588 TGCAAAAACAAGATGTGCCATGG + Intronic
1028728690 7:94120064-94120086 TCCAAACACCAGGGGTGCCATGG + Intergenic
1031316289 7:120261470-120261492 TTCAAACAGAGGGAGAACCAAGG + Intergenic
1032799105 7:135303977-135303999 TTCAAACGCCATCTGAGCCATGG - Intergenic
1035543928 8:464309-464331 TTCAAACGCAAGGCAAACCATGG - Intronic
1036727318 8:11231493-11231515 TTCAAACACAAGTTGGGCTCAGG + Intergenic
1039351950 8:36772811-36772833 TTCCCACCCAAGGTGAGCCTGGG - Intergenic
1040755352 8:50766974-50766996 TAAAAAGAAAAGGTGAGCCAGGG + Intronic
1041936274 8:63335356-63335378 GTCAAACAGAACGTGACCCATGG - Intergenic
1043560565 8:81488609-81488631 TTCAAATAAAAGGAGAGCCTTGG - Intergenic
1043589155 8:81807915-81807937 TCCAAACACCAGGTGCTCCAGGG + Intronic
1046504519 8:115120107-115120129 CTCACACACAAGGTTTGCCATGG - Intergenic
1047302803 8:123628890-123628912 TTCAAATCCATGGTCAGCCATGG + Intergenic
1050319113 9:4432962-4432984 TTCTAACACAGGGTAAGCAATGG + Intergenic
1058761268 9:108135561-108135583 TATAAACACATGGAGAGCCAGGG + Intergenic
1060455001 9:123783979-123784001 TTCACAGAGAAGGTGAGACAAGG + Intronic
1061309331 9:129752119-129752141 TTCAAAGGCGAGGTGAGGCAAGG - Intronic
1061590415 9:131594250-131594272 CTCAAAGACCAGGTGAGCCAGGG - Intronic
1186781943 X:12921577-12921599 GTAAAACAAATGGTGAGCCAGGG - Exonic
1188142966 X:26575046-26575068 TGTATACACAAGGTGAGGCAGGG - Intergenic
1188496878 X:30791069-30791091 TGCAAACACAAGGCAAGCCAAGG - Intergenic
1188498426 X:30801743-30801765 GCAAAACACAAGGTGAGGCAAGG - Intergenic
1198097682 X:133396765-133396787 TTCAAACACAAAGTGACCGCAGG + Intronic