ID: 1097839085

View in Genome Browser
Species Human (GRCh38)
Location 12:64303430-64303452
Sequence ATGTGTGTGTGGAGGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2507
Summary {0: 2, 1: 1, 2: 43, 3: 308, 4: 2153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097839085 Original CRISPR ATGTGTGTGTGGAGGGGAGA TGG (reversed) Intronic
Too many off-targets to display for this crispr