ID: 1097848635

View in Genome Browser
Species Human (GRCh38)
Location 12:64390484-64390506
Sequence CGGGCGGCAGATGCCGCCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 106}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097848633_1097848635 -8 Left 1097848633 12:64390469-64390491 CCGCGTCGTAGACCTCGGGCGGC 0: 1
1: 1
2: 0
3: 3
4: 22
Right 1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG 0: 1
1: 0
2: 0
3: 16
4: 106
1097848628_1097848635 19 Left 1097848628 12:64390442-64390464 CCACGATGCATGGCTCGTAGGCG 0: 1
1: 0
2: 0
3: 0
4: 14
Right 1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG 0: 1
1: 0
2: 0
3: 16
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097848635 Original CRISPR CGGGCGGCAGATGCCGCCGC AGG Exonic
900546349 1:3231444-3231466 CGGGAGGCAGATGCCCCAGGGGG - Intronic
902476851 1:16692953-16692975 TTGGCGGCACGTGCCGCCGCAGG + Intergenic
902515324 1:16986767-16986789 CGGGCGGGAGATGCTGGCGGAGG - Intronic
904181387 1:28668947-28668969 CGGGGGGCTGCTGCCTCCGCGGG + Intronic
905617269 1:39409500-39409522 CGGGCAGCAGCAGCGGCCGCGGG - Intronic
912401595 1:109397908-109397930 CGGGCGGCAGGTGTCGGCGTCGG - Exonic
912576095 1:110674294-110674316 CGGCCGGCGGATGCGGCCCCCGG + Exonic
915287599 1:154862758-154862780 AGGGCGGGAGATGCTGGCGCAGG - Intronic
922478746 1:225924285-225924307 CGGGCGGCTGATGGCGCCTTAGG + Intronic
923986359 1:239386910-239386932 CGCGCGTCACATGCCGCCTCCGG - Intronic
1062888344 10:1036624-1036646 CGGGGGACAGATGCCGCAGTGGG - Intergenic
1067015669 10:42755070-42755092 CGGGAAGCAGAGGCCGCCGCCGG - Intergenic
1068788350 10:61001440-61001462 CGGGCGGCCGAGGCTGGCGCGGG + Intronic
1073336562 10:102714475-102714497 GGAGCTGCAGAGGCCGCCGCCGG + Intergenic
1074483938 10:113854842-113854864 CGGGCTCCCGATGCGGCCGCCGG - Exonic
1075861326 10:125679233-125679255 CGGGCTGCAGCTGCAGCTGCTGG - Intronic
1076662630 10:132065563-132065585 CGAGCGGCAGAGGCCACGGCTGG - Intergenic
1077097244 11:804339-804361 CTGGAGGCAGCTGCTGCCGCAGG - Exonic
1077247508 11:1546772-1546794 CGGGCAGCAGATGGCGCTGCCGG + Intergenic
1084209900 11:67616067-67616089 CGGACGGCGGACGCCGCTGCGGG + Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090066946 11:123511297-123511319 TGAGTGGCAGATGCTGCCGCTGG + Intergenic
1202806683 11_KI270721v1_random:9324-9346 CGGGCGGCAGCTGCAGACACCGG - Intergenic
1092262465 12:6959923-6959945 TGTGCGGCCGATGCCGGCGCTGG - Exonic
1095349198 12:41188904-41188926 CGGGCGGCCGCTGGGGCCGCGGG + Exonic
1096157080 12:49346727-49346749 TGGGCGGCGGCGGCCGCCGCTGG - Intergenic
1096241397 12:49961980-49962002 CCGGCGGCAGCTGCCGCGGCGGG - Exonic
1097848635 12:64390484-64390506 CGGGCGGCAGATGCCGCCGCAGG + Exonic
1100963045 12:99984661-99984683 CGGGCCGCTGCTGCCACCGCGGG - Intergenic
1103854266 12:123954837-123954859 CGGGCGGCAGACCCCACCCCAGG + Intronic
1110596612 13:77326871-77326893 CGGGAGCCAGAGGCCGCCGCCGG - Intronic
1113378895 13:109786023-109786045 CGGGCGGCCCGTGCCGCGGCGGG + Exonic
1114069769 14:19097706-19097728 CGGGAAGCAGAGGCCGCCGCCGG + Intergenic
1114092493 14:19302297-19302319 CGGGAAGCAGAGGCCGCCGCCGG - Intergenic
1118350950 14:64972202-64972224 CGGGCGGGCGAGGCAGCCGCGGG - Intronic
1122399138 14:101457387-101457409 CGGGCTGCAGCTGCCGCCGTGGG + Intergenic
1123028667 14:105440372-105440394 CGGCCGGCAGATGGCACTGCTGG + Intronic
1123173844 14:106399304-106399326 CGGGCGGCAGAAGCTGCTGCTGG - Intergenic
1123182097 14:106480578-106480600 CGGGCGGCACAAGCTGCTGCTGG - Intergenic
1202944808 14_KI270726v1_random:16152-16174 CGGGCGGCACAAGCTGCTGCTGG + Intergenic
1129440591 15:75578643-75578665 CGGGAGGCAGAGGCCGGCGTAGG + Intronic
1132752393 16:1464813-1464835 CCGGCGGGAGATGCCCCCGAGGG + Intronic
1132779422 16:1614471-1614493 GGGGCGGCAGGGGCCGCGGCGGG + Intronic
1132802674 16:1762055-1762077 GGGGTGGCAGATGATGCCGCTGG - Intronic
1141828660 16:86497680-86497702 CTCGCTGCAGAGGCCGCCGCCGG - Intergenic
1141831183 16:86510685-86510707 CGGGCGCCGGATGCCGGCGTTGG - Exonic
1142212644 16:88815820-88815842 GGGGCAGCAGAGGCAGCCGCAGG + Intronic
1143628301 17:8123185-8123207 CCGGCGTCGGATCCCGCCGCTGG + Intronic
1146332320 17:31937356-31937378 CGGGCGGCAAATCCGGCGGCGGG + Exonic
1146720453 17:35119893-35119915 CGGCCCGCAGATGGCGCTGCAGG - Intronic
1147150390 17:38510657-38510679 CGGGCGACAGCGGCCGCCGCAGG - Exonic
1147563151 17:41521188-41521210 AGGGGGGCAGCTGCCGCCCCTGG - Exonic
1147996719 17:44363663-44363685 CGCGCGGCTGTTGCCGCTGCTGG - Exonic
1148779609 17:50113941-50113963 CGGGCCGCAGCTGCTGCAGCTGG - Exonic
1152748446 17:82051755-82051777 CGCGCGGCTCATGCGGCCGCCGG + Exonic
1155507795 18:26549053-26549075 CGGGCCGCGGGTGCTGCCGCGGG + Exonic
1159578294 18:70206069-70206091 CGGGCTGCAGAGGCCCCAGCAGG + Intergenic
1160844083 19:1159054-1159076 GGGGCGGCGGTTGCAGCCGCAGG - Intronic
1162033205 19:7926051-7926073 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
1162125677 19:8498469-8498491 CAGGGGGCAGAGGCCTCCGCCGG + Exonic
1164191879 19:22925400-22925422 CGGGCGGCAGCTGCTGCGGTCGG - Intergenic
1165328285 19:35126617-35126639 TGGGCCGCAGCAGCCGCCGCGGG + Exonic
1166112185 19:40629471-40629493 CGGGCGGCAGATGCAGCGGAAGG - Exonic
1166199316 19:41226273-41226295 CGCGCGGGAGCTGGCGCCGCCGG - Intronic
1166960536 19:46493759-46493781 CGGGCGGCCGAGGCCGAGGCCGG - Exonic
1168100323 19:54138038-54138060 AGGGCGGCCGATGGCGCCGGGGG - Intronic
1202710866 1_KI270714v1_random:18779-18801 TTGGCGGCACGTGCCGCCGCAGG + Intergenic
929537613 2:42793172-42793194 CGGCCGGCAGACTCCGCCGCGGG + Intergenic
931737001 2:65204990-65205012 CGGGCTGCAGCTGCAGCAGCTGG - Intergenic
936038320 2:109129640-109129662 CGGGCGGCGGCCACCGCCGCGGG + Exonic
937933023 2:127220105-127220127 CGGGCGGCCGGGGTCGCCGCCGG - Intergenic
944221724 2:197310404-197310426 CGGAGGGGAGCTGCCGCCGCGGG + Intronic
945033068 2:205682798-205682820 CGGGCGGAGGCAGCCGCCGCCGG - Exonic
945251060 2:207767117-207767139 CGGGCGGCAGCAGCAGCGGCTGG + Exonic
1169065594 20:2692869-2692891 CGGGCGGCGGCGGCCGCGGCGGG + Exonic
1170651330 20:18245351-18245373 TGGCCGGCAGATGACTCCGCAGG + Intergenic
1172292034 20:33783752-33783774 GGGTGGGCAGATGACGCCGCAGG - Exonic
1175517171 20:59577235-59577257 CGGGCGGGAGGTGTAGCCGCCGG - Intergenic
1176068494 20:63213356-63213378 CGGGAGGCAGAGGCTGCAGCAGG + Intronic
1176085101 20:63292342-63292364 GGGGAGGCAGATGCCTCGGCCGG + Intergenic
1176120378 20:63451865-63451887 CGTGCAGCAGAGGCCGCTGCTGG - Intronic
1176157020 20:63627022-63627044 CGGGCGGCGGCGGCGGCCGCGGG + Intronic
1179225090 21:39445848-39445870 CGGGCAGCAGGAGCCGCGGCGGG + Intronic
1179522243 21:41953322-41953344 GGGGCGGCAGATGCCGGGGCGGG - Intronic
1179674907 21:42974751-42974773 CGGGCGGCAGCGGCGGCGGCGGG - Intronic
1179900617 21:44391583-44391605 CGGGCAGCAGGAGCCGCAGCCGG - Exonic
1180064340 21:45405140-45405162 CGCGCTGCAGCCGCCGCCGCTGG - Intronic
1180488236 22:15820269-15820291 CGGGAAGCAGAGGCCGCCGCCGG + Intergenic
1181823355 22:25493433-25493455 CTAGTGGCAGATGCTGCCGCAGG + Intergenic
1182076919 22:27501242-27501264 CGGGCTGCAGCTGCTGACGCAGG - Intergenic
1182516486 22:30861923-30861945 CGGGAGGAAGATGCCGCTCCAGG - Intronic
1183725478 22:39586870-39586892 GGGGCTGCAGATGCCTCCTCTGG - Intronic
1184207651 22:43015135-43015157 CTGGCGGCAGAAGCGGCCGCAGG - Exonic
954401263 3:50321106-50321128 CGGGCGGCCGGCGCCGCCGTGGG - Exonic
961368635 3:126416393-126416415 CCAGCTGCAGCTGCCGCCGCAGG - Exonic
961820706 3:129574371-129574393 TGGGCTGCAGAGGCCCCCGCAGG + Exonic
962738691 3:138347954-138347976 CGGGGGGAAAATGACGCCGCTGG + Exonic
973339271 4:48986907-48986929 TGGGCGGCAGCTGCTGCCGTGGG + Intronic
978777206 4:112516022-112516044 CGGGCCGCCGCCGCCGCCGCCGG - Exonic
984964332 4:185127723-185127745 CGGGCTGCAGAGGCCCCGGCAGG + Intergenic
985118207 4:186613108-186613130 CAGGCCACAGATGCCGACGCAGG - Exonic
996818192 5:127596693-127596715 CTGGCGGCAGAGGTCGCAGCAGG + Intergenic
1000065544 5:157690561-157690583 CGGGCGGCAGCAGGAGCCGCAGG + Intergenic
1002600946 5:180353544-180353566 CGGGCGCCAGATCCCGGAGCGGG + Intergenic
1005363337 6:25053421-25053443 CAGGCGCCAGATGCTGCCTCGGG - Intergenic
1007431497 6:41779858-41779880 CGGGCGGCGGCTGCTGCAGCGGG - Exonic
1008649028 6:53544811-53544833 TGGGCGCCAGGGGCCGCCGCCGG - Exonic
1012450587 6:99349596-99349618 TGGGCGGCAGCAGCGGCCGCCGG + Exonic
1013836724 6:114342895-114342917 CGGGAGGCAGCTGCCGGCTCGGG - Exonic
1014098182 6:117482597-117482619 CGGGCGGGAGACGCCCCCGCAGG + Intronic
1017021350 6:150142917-150142939 CAGGCGCCAGATCCCGCCTCTGG + Intergenic
1017146514 6:151240258-151240280 CTGGGGGCAGATGCTGCTGCAGG + Intronic
1017737901 6:157380866-157380888 CGCGCAGCAGCTGCCGCCTCGGG - Intergenic
1019174137 6:170151453-170151475 CGGGCGGCAGAGGCAGCTCCAGG + Intergenic
1019689787 7:2404040-2404062 CGGGCGGCAGAGGCTGATGCCGG - Intronic
1026822174 7:73557251-73557273 CGCGCGGCAGCAGCCGCAGCAGG + Intronic
1029540373 7:101179269-101179291 CGGACAGGAGATGCGGCCGCAGG + Intronic
1038566355 8:28622760-28622782 CCGGCTGCAGTGGCCGCCGCTGG + Intronic
1049235034 8:141508120-141508142 CGGCCGGCAGATGGCGCTGCGGG + Intergenic
1049746805 8:144266479-144266501 CGCCCGGCAGCTGCCACCGCGGG + Intronic
1055030503 9:71768482-71768504 CGAGCGGCAGCTGCGGGCGCCGG - Exonic
1061257387 9:129460570-129460592 CGGGCGGCTGGAGCCGGCGCGGG + Intergenic
1191717702 X:64204865-64204887 CGGGCGCCAGATGCGCCCGGAGG + Intronic