ID: 1097850247

View in Genome Browser
Species Human (GRCh38)
Location 12:64404395-64404417
Sequence CTCCAAGAGACTGCTGGCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097850239_1097850247 12 Left 1097850239 12:64404360-64404382 CCTCCGGCGTCAGCCCGCGGGCT 0: 1
1: 0
2: 0
3: 8
4: 89
Right 1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 111
1097850241_1097850247 -1 Left 1097850241 12:64404373-64404395 CCCGCGGGCTGCCGCCCGCACTC 0: 2
1: 0
2: 0
3: 11
4: 142
Right 1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 111
1097850242_1097850247 -2 Left 1097850242 12:64404374-64404396 CCGCGGGCTGCCGCCCGCACTCT 0: 2
1: 0
2: 0
3: 8
4: 164
Right 1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 111
1097850240_1097850247 9 Left 1097850240 12:64404363-64404385 CCGGCGTCAGCCCGCGGGCTGCC 0: 1
1: 0
2: 0
3: 8
4: 223
Right 1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG 0: 1
1: 0
2: 0
3: 3
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097850247 Original CRISPR CTCCAAGAGACTGCTGGCGC CGG Exonic
900432829 1:2611163-2611185 CTCCAAGACACGGCGGGCGGTGG - Intronic
904116293 1:28164329-28164351 CTGCAAGGAACTGCTGGTGCAGG - Intronic
905455195 1:38083768-38083790 CTCCAGGAGACAGCTGGTGCTGG - Intergenic
905897913 1:41560716-41560738 CTCCAAGAGACTCCAGGCTGTGG + Intronic
910180679 1:84479354-84479376 CTTCAGGAGGCTGCAGGCGCTGG + Exonic
916499726 1:165376380-165376402 CTCCAAGAGAGCTCTGGCGGCGG - Intergenic
919923038 1:202177580-202177602 CCCCAAGGGGCTGCTGGCCCAGG - Intergenic
922244355 1:223780402-223780424 CCCCAAGGGCCTGCTGGTGCCGG + Exonic
922753951 1:228083698-228083720 CTCCGAGAGAGCGCTGGGGCCGG - Intronic
1066548090 10:36523672-36523694 TCCCAAGAGACTGCTGGCATAGG - Exonic
1067529423 10:47059713-47059735 CCCCGAGAGAATGCTGGAGCAGG + Intergenic
1068468229 10:57424311-57424333 ATGCAAGAAAATGCTGGCGCTGG + Intergenic
1069889887 10:71646119-71646141 CTCCAAGAGACGGCAGGGGCCGG + Intronic
1071604006 10:86972182-86972204 CTCCAGGAGGCTGGTGGGGCTGG + Intronic
1071937730 10:90549589-90549611 CCCCATGAGACTGTTGGTGCAGG - Intergenic
1074392396 10:113069104-113069126 CTCCAAGAGACGGCCAGCCCTGG - Intronic
1087135738 11:94716995-94717017 CACCAAAAGCCTGCTGGCTCTGG - Intronic
1088590624 11:111399691-111399713 CTCTCAGAGACTGCTGTCCCGGG - Intronic
1091181749 11:133611180-133611202 CCTCAAGAGACTGCTGGTGAGGG - Intergenic
1091561123 12:1614467-1614489 CTGCATGAGACAGCTGGAGCAGG - Intronic
1092924167 12:13258602-13258624 GTCCCAGAGCCTGCTGGGGCCGG + Intergenic
1097235752 12:57538323-57538345 CTTCAAGACACTGCTGGAGTAGG - Intronic
1097264722 12:57738455-57738477 CTCCAAGAGGGTGGGGGCGCAGG - Intronic
1097850247 12:64404395-64404417 CTCCAAGAGACTGCTGGCGCCGG + Exonic
1097959358 12:65517406-65517428 CTCCAAGACACTGTTGGCTTCGG + Intergenic
1102490423 12:113287014-113287036 CTTCCTGGGACTGCTGGCGCTGG + Exonic
1104265444 12:127228300-127228322 CACCAAGAGACTGTTGGTGGAGG + Intergenic
1108315032 13:49228492-49228514 TTTCAAGAGAGTGCTGGGGCAGG + Intergenic
1113662859 13:112118820-112118842 CTTCAAGAGATTGCTGGAGGTGG + Intergenic
1113982511 13:114288348-114288370 CTCCAAGATAGTGGTGGAGCTGG + Intronic
1117920543 14:60722788-60722810 CCCGCAGAGACTGCCGGCGCCGG - Intronic
1120705053 14:87736926-87736948 CTCCACGAGATTGCTGGGGAAGG + Intergenic
1126103931 15:45135554-45135576 CTCCAGGGGACAGCTGGCGTCGG + Exonic
1130116306 15:81007558-81007580 CTACTAGACACTGCTGGTGCTGG + Intronic
1131105124 15:89728753-89728775 CTCCAAAAGACAGCTGTCTCTGG + Intronic
1141262171 16:82463852-82463874 CTGTAAGAGCCTGCTGGCACTGG - Intergenic
1141825915 16:86480316-86480338 TTGCAAGAGATTGATGGCGCTGG - Intergenic
1146904240 17:36607966-36607988 GTCCAGGAGGCAGCTGGCGCCGG - Exonic
1150807936 17:68334009-68334031 CTCCAGGAGACTGATGGTTCAGG + Intronic
1151471168 17:74318748-74318770 CAGCAAGAGTCTGCTGGGGCAGG + Intergenic
1152596409 17:81239721-81239743 CTCCAAGAGCCAGCGGGCCCCGG + Intronic
1155056634 18:22189624-22189646 ATGCAAGAGCCTGCTGGGGCTGG + Intronic
1156902764 18:42320725-42320747 CTCCAAGGTACTGATGGGGCAGG + Intergenic
1157845491 18:51000276-51000298 CTCCAGGAGGCTGCCGGTGCAGG - Intronic
1158186273 18:54775439-54775461 CTCCAAAAGCCTGCTGCCTCAGG + Intronic
1160921267 19:1521892-1521914 CTCCCTGGGACTGCTGGGGCTGG + Intergenic
1161513088 19:4682623-4682645 CTCATAGAGACAGCTGGTGCCGG + Intronic
1162127231 19:8506157-8506179 CTGCAAGTGACAGCTGGGGCTGG + Intergenic
1165590669 19:36966807-36966829 CTCCAAGAGACTGCATGCTCTGG - Intronic
1165916708 19:39265194-39265216 CTCCAGGATCCGGCTGGCGCCGG - Intergenic
927519788 2:23691803-23691825 CGCCAAGACACTGCTGGAGGCGG + Exonic
927740706 2:25567024-25567046 CTCAAAGAAACTGCTGAGGCTGG - Intronic
934613774 2:95758898-95758920 CTCCCAGGGACTGCCGGCACAGG + Intergenic
934840502 2:97621337-97621359 CTCCCAGGGACTGCCGGCACAGG - Intergenic
935196819 2:100820865-100820887 CTCCGAGAGACCGCGGGCCCAGG - Intronic
938716526 2:134027172-134027194 CAGCAAGAGATTGCTGGCACAGG + Intergenic
940334013 2:152505717-152505739 CTCGAAGACACGGCTGGAGCCGG - Intronic
942690433 2:178579276-178579298 TTCCAGGAGACTGATGGAGCTGG + Exonic
948828278 2:240584900-240584922 GGCCAAGAGACAGCTGGTGCTGG - Intergenic
1169782400 20:9323678-9323700 CTTCAAGAGACAGCTGCCCCAGG + Intronic
1172510092 20:35494562-35494584 CTCCCAGAGGCTGGTGGAGCAGG + Exonic
1173469160 20:43309324-43309346 CTGCAAGAGAATGCAGGGGCTGG - Intergenic
1180054287 21:45349165-45349187 CTCCCAGAGACTGGTGGTTCTGG - Intergenic
950496917 3:13339431-13339453 CTGCAAGTCACTGCTGGCGAAGG + Intronic
951943230 3:28105168-28105190 TTCCAAGTGACTGCTGCCACTGG + Intergenic
952194310 3:31056884-31056906 CTCCAACAGACTGGTGGCAGAGG - Intergenic
954715714 3:52525687-52525709 CTCCAAGATGCTGGTGGCCCCGG - Intronic
954957148 3:54531317-54531339 CTCCAAGAGGCAGCTGGGCCAGG - Intronic
961020186 3:123498723-123498745 CTCTAAAAGACAGCTGGCTCTGG + Intronic
961361860 3:126373151-126373173 CTCCCAGCGACTGCAGTCGCTGG - Intergenic
961403709 3:126664562-126664584 CTGCAAGTCACTGCTGGCGAAGG - Intergenic
967571056 3:191028716-191028738 CTCCTAGAGACTCATGGCACAGG - Intergenic
968108914 3:196026248-196026270 CTCCAGGGGACTGCTGGGGAAGG + Intergenic
968463686 4:738957-738979 CGCCTAGAAACTGCTGGCGGGGG - Intronic
969390633 4:6889326-6889348 CTCCAGGAGACTGCAGGCTGGGG + Intergenic
971223488 4:24730677-24730699 CTCCAAGAGGCTGGCAGCGCGGG - Intergenic
972552178 4:40144068-40144090 CACCAAGAGGCAGCTGGTGCAGG + Intronic
980160407 4:129154908-129154930 CTCCAAGGGACTGACGGCTCTGG + Intergenic
980902966 4:138922531-138922553 CGCCATGAGACTGATGGGGCTGG + Intergenic
984834893 4:184010538-184010560 CTCCAAAAGGCTGCAAGCGCTGG - Exonic
985470669 5:42455-42477 CTCCAGGGGACTGCTGGGGAAGG + Intergenic
985683682 5:1270764-1270786 CTCCAAGTTACTACTGACGCTGG - Intronic
992111443 5:73498264-73498286 CTACGAGAGACTGCTGGCTTGGG - Intergenic
997308981 5:132864149-132864171 CTCCAGGAGCCTGCTTGTGCCGG + Exonic
997423765 5:133788961-133788983 CTCCAAGAGGCTGATTGCACTGG + Intergenic
998725273 5:145005467-145005489 TCCCAAGAGCCTGCTGGCACAGG - Intergenic
1001818698 5:174693040-174693062 CTCCACGAGGCAGCAGGCGCGGG + Intergenic
1005306723 6:24521158-24521180 CTCTAAAACACTGCTGGCGTGGG - Intronic
1006518682 6:34558915-34558937 CTCCAAGAGGCTGCTTGGGGTGG + Intergenic
1007509129 6:42362055-42362077 CTCCCTGACACTGCTGGCCCTGG + Intronic
1009004346 6:57764364-57764386 ATCCCAGACACTGCAGGCGCTGG + Intergenic
1011758996 6:90538792-90538814 CTTCCAGAGACTGCTGGCTTAGG + Intronic
1023876484 7:44289060-44289082 CCACAACAGACTGCTGGTGCAGG + Intronic
1024640637 7:51325817-51325839 CTCCAAGAAACTGATGGTTCTGG - Intergenic
1027139565 7:75647688-75647710 CTCCAAGGCCCTGCTGGCCCTGG + Intronic
1035146342 7:156821282-156821304 CTCCAGGAGACTGTAGGTGCAGG - Intronic
1035309107 7:157953490-157953512 CACCATGAGGCTGCTGGCACGGG + Intronic
1035335314 7:158124270-158124292 CTCCAGGAGACTGTAGGTGCAGG - Intronic
1038160338 8:25031219-25031241 CTCCTAGAGCCAGCTGGAGCTGG + Intergenic
1039593589 8:38770765-38770787 ACCGAAGAGACTCCTGGCGCTGG - Intronic
1039778077 8:40756287-40756309 CTCCAGGAGACTGTAGGTGCTGG + Intronic
1044364833 8:91332637-91332659 ACTCAAGAGACTGCTGGCGGTGG - Intronic
1045638417 8:104220471-104220493 CTGCAAGTGACTGCTGGGGATGG - Intronic
1047327913 8:123857745-123857767 CTCCAAGAACCTGCTGGCTGAGG - Intronic
1049706022 8:144042746-144042768 TTCCAAGACACTGCTTGCTCAGG - Intronic
1056284940 9:85078230-85078252 CTGCACTGGACTGCTGGCGCTGG + Intergenic
1057458608 9:95238182-95238204 CTCCCAGAGAGTGCTGGGGTAGG - Intronic
1059115819 9:111599397-111599419 CTCCAAGGAACTGCGGGGGCGGG + Intronic
1060730394 9:126033458-126033480 CCCCAAGAGCCTGCAGGGGCAGG + Intergenic
1186091487 X:6053404-6053426 CTCCACGAGCATGCTGGCTCAGG + Intronic
1191197203 X:57737054-57737076 CTCCAATAGACTGGTGGTGTTGG + Intergenic
1195387092 X:104323756-104323778 CTCAAGGAGACTGCTGCCTCAGG + Intergenic
1195578665 X:106477801-106477823 CTCTAGGAGGCTGCTGGTGCAGG - Intergenic
1196405320 X:115355710-115355732 CTTCAAGAGACTGCAGGAGTTGG + Intergenic
1197986460 X:132270927-132270949 CTCCTAGAAACATCTGGCGCTGG + Intergenic