ID: 1097854835

View in Genome Browser
Species Human (GRCh38)
Location 12:64451832-64451854
Sequence CTACTGTCGGCCAGCGCTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097854828_1097854835 -1 Left 1097854828 12:64451810-64451832 CCTTGCTCAGCGTCGGTCCGCCC 0: 1
1: 0
2: 0
3: 2
4: 56
Right 1097854835 12:64451832-64451854 CTACTGTCGGCCAGCGCTCGGGG 0: 1
1: 0
2: 1
3: 1
4: 33
1097854827_1097854835 0 Left 1097854827 12:64451809-64451831 CCCTTGCTCAGCGTCGGTCCGCC 0: 1
1: 0
2: 0
3: 1
4: 24
Right 1097854835 12:64451832-64451854 CTACTGTCGGCCAGCGCTCGGGG 0: 1
1: 0
2: 1
3: 1
4: 33
1097854825_1097854835 22 Left 1097854825 12:64451787-64451809 CCTGTAAATCTTGGGATGTAATC 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1097854835 12:64451832-64451854 CTACTGTCGGCCAGCGCTCGGGG 0: 1
1: 0
2: 1
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097854835 Original CRISPR CTACTGTCGGCCAGCGCTCG GGG Intergenic
901086056 1:6613272-6613294 CTACTCCCGGCCAGGCCTCGGGG + Intronic
905909022 1:41641220-41641242 CTACTGTGGGCCAGTGGTGGAGG - Intronic
923338965 1:232991837-232991859 CTACTGTCTGCCAGTTCTGGAGG - Intronic
1069850155 10:71398862-71398884 CTGCTGTCCTCCAGCACTCGAGG - Intronic
1077324653 11:1958548-1958570 CTGCTGGCGGCCAGCGCACCAGG + Intronic
1083993967 11:66263106-66263128 CTGCTGTGGGCCAGGACTCGTGG + Intronic
1084209021 11:67612383-67612405 CCACTTTCGGCCGGAGCTCGAGG + Exonic
1202807632 11_KI270721v1_random:13725-13747 CTGCTGGCGGCCAGCGCACCAGG + Intergenic
1097854835 12:64451832-64451854 CTACTGTCGGCCAGCGCTCGGGG + Intergenic
1115610675 14:35046275-35046297 CTGCAGTTGGCCAGCTCTCGGGG + Intronic
1119769029 14:77208824-77208846 CTGCTCTCTGCCAGGGCTCGTGG - Intronic
1121302546 14:92883275-92883297 CTACTGTCGGCCAGGCATGGTGG + Intergenic
1130140673 15:81223742-81223764 CTACTGTTGGCCAGAGCTGGAGG + Intronic
1136253252 16:29020973-29020995 CTACTGTGGGCCACCTCTTGTGG - Intergenic
1143485683 17:7252341-7252363 CGACTGTGCGCCAGGGCTCGGGG + Exonic
1160516271 18:79480769-79480791 CTAGTGTCCGCCAGAGCTGGTGG + Intronic
1167906918 19:52668793-52668815 CTACTGGAGGACAGCCCTCGTGG - Intronic
928398603 2:30962096-30962118 CTGCTGTCTGCCAGGGCTGGAGG + Intronic
932867597 2:75361993-75362015 CTTCTGTCGGTCAGCTCTAGAGG - Intergenic
944501776 2:200368601-200368623 CTGCTGTGGGCCAGCACTTGGGG + Intronic
945957566 2:216100334-216100356 CTGCTGTGGTCCAGCTCTCGTGG + Exonic
1181029934 22:20144790-20144812 CTGCTGTTGGTCAGCGCTGGTGG + Intronic
1181513330 22:23398516-23398538 CTGCTGTTGGTCAGCGCTGGTGG - Intergenic
962068746 3:132011195-132011217 CTACTGTGGGCCTGAGCTCTGGG - Intronic
968526654 4:1061469-1061491 CTTCTGTCGGCCAGGGTTCCAGG - Intronic
969313585 4:6368438-6368460 CTACTGTGTGCCAGCCCTCTTGG - Intronic
971314123 4:25553022-25553044 GCACTGTTGGCCAGCGCTCTTGG - Intergenic
972151066 4:36091797-36091819 CTACTGTCAGCCATCTCTCTTGG - Intronic
972360371 4:38320749-38320771 CTATTGCCAGCCAGCCCTCGGGG - Intergenic
1002707312 5:181170470-181170492 CTGCTGTCGGCGAGCGCTCGGGG - Intergenic
1010374167 6:75147170-75147192 TTACTAACGGCCAGCGCTCCCGG - Intronic
1013220684 6:108074734-108074756 CGGCTCTCGGCCTGCGCTCGCGG - Exonic
1014384187 6:120780515-120780537 CTACTGTCAGCCACAGCTCCAGG - Intergenic
1049721195 8:144116251-144116273 CTACTTTCTGCCAGCGGACGCGG + Exonic
1058153321 9:101486109-101486131 CTAGTGTCGCACTGCGCTCGCGG - Intronic
1185507667 X:642484-642506 CTAGCGGCGACCAGCGCTCGGGG - Intronic