HTGT WGE

Individual CRISPR Summary

ID: 1097854880

 View in Genome Browser
Species Human (GRCh38)
Location 12:64452050-64452072
Sequence GTGCGCACGCGCACCCGCAC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 90}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097854873_1097854880 15 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 1097854873 12:64452012-64452034 CCGCCGCGGCTGTGGTGACTACC 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG 0: 1
1: 0
2: 0
3: 10
4: 90
1097854878_1097854880 -6 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 1097854878 12:64452033-64452055 CCAGACGGGCCATAGGCGTGCGC 0: 1
1: 0
2: 0
3: 0
4: 30
Right 1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG 0: 1
1: 0
2: 0
3: 10
4: 90
1097854874_1097854880 12 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 1097854874 12:64452015-64452037 CCGCGGCTGTGGTGACTACCAGA 0: 1
1: 0
2: 0
3: 3
4: 78
Right 1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG 0: 1
1: 0
2: 0
3: 10
4: 90
1097854870_1097854880 30 Complete closest: None
total_pairs: 1
max_distance: 1000		 Left 1097854870 12:64451997-64452019 CCGACTCGGCAGTTGCCGCCGCG 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1097854880 12:64452050-64452072 GTGCGCACGCGCACCCGCACCGG 0: 1
1: 0
2: 0
3: 10
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097854880 Original CRISPR GTGCGCACGCGCACCCGCAC CGG Exonic