ID: 1097867297

View in Genome Browser
Species Human (GRCh38)
Location 12:64569398-64569420
Sequence CACTGCACAAAGCAGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097867297_1097867300 3 Left 1097867297 12:64569398-64569420 CCAGCCAGCTGCTTTGTGCAGTG No data
Right 1097867300 12:64569424-64569446 AAACTCCACACCTGTGGTGTTGG No data
1097867297_1097867303 18 Left 1097867297 12:64569398-64569420 CCAGCCAGCTGCTTTGTGCAGTG No data
Right 1097867303 12:64569439-64569461 GGTGTTGGCCCCTTCCCACCTGG No data
1097867297_1097867299 -3 Left 1097867297 12:64569398-64569420 CCAGCCAGCTGCTTTGTGCAGTG No data
Right 1097867299 12:64569418-64569440 GTGCACAAACTCCACACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097867297 Original CRISPR CACTGCACAAAGCAGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr