ID: 1097871997

View in Genome Browser
Species Human (GRCh38)
Location 12:64610075-64610097
Sequence CCCCTACAGGACCCTGGTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097871984_1097871997 2 Left 1097871984 12:64610050-64610072 CCCTCGGCCGGGCAACCCCCACC 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 161
1097871979_1097871997 20 Left 1097871979 12:64610032-64610054 CCGTGGGACCTGGGGGGTCCCTC 0: 1
1: 0
2: 1
3: 28
4: 240
Right 1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 161
1097871983_1097871997 12 Left 1097871983 12:64610040-64610062 CCTGGGGGGTCCCTCGGCCGGGC 0: 1
1: 0
2: 1
3: 8
4: 174
Right 1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 161
1097871985_1097871997 1 Left 1097871985 12:64610051-64610073 CCTCGGCCGGGCAACCCCCACCC 0: 1
1: 0
2: 1
3: 22
4: 341
Right 1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 161
1097871986_1097871997 -5 Left 1097871986 12:64610057-64610079 CCGGGCAACCCCCACCCACCCCT 0: 1
1: 0
2: 8
3: 98
4: 809
Right 1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG 0: 1
1: 0
2: 0
3: 10
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097871997 Original CRISPR CCCCTACAGGACCCTGGTGC GGG Intergenic
900183037 1:1320772-1320794 AGCCTACAGGACCCCGGGGCTGG + Intronic
902367896 1:15989416-15989438 CCCCTACCCCACCCTGGCGCAGG - Intergenic
903999210 1:27328948-27328970 GCCCTACAGGACCTGGGTGCTGG - Intronic
907476185 1:54707188-54707210 CCCCGACAGGACCCTTCTGATGG + Intronic
910638923 1:89439515-89439537 TCCCTAAAGGACACTGGTGAAGG - Intergenic
911496426 1:98637419-98637441 CCCCTACAGTACACTGTTTCTGG - Intergenic
917650694 1:177074469-177074491 CCCCTACAGGACACTCATTCAGG + Intronic
919944617 1:202310187-202310209 CACCTCCAGGATCCTGGTGGGGG - Exonic
920283999 1:204866535-204866557 GCCCTACAGCACCCTGGGGCTGG + Intronic
920501518 1:206488280-206488302 CTCCTACAGCACCCAGGTCCCGG - Intronic
923025377 1:230199749-230199771 CTTCAACAGGACCCTGGTGTGGG - Intronic
1062988316 10:1790666-1790688 CCCCTAAAGAACACGGGTGCAGG + Intergenic
1066656626 10:37703651-37703673 CCCCTACAGGAATCAGGTGCTGG - Intergenic
1069777581 10:70935902-70935924 CCCCTACAACAGCCTGGTTCCGG + Intergenic
1071285862 10:84144465-84144487 CACCTACAGGAGCCTGAGGCAGG - Intronic
1071778467 10:88815830-88815852 AACCTACAGGACCCCAGTGCAGG - Intronic
1072891816 10:99330602-99330624 CCCCTACAGTGACCTGGTGAAGG + Exonic
1073217118 10:101842600-101842622 TCCCTACAGGGGCCAGGTGCTGG + Intronic
1075504418 10:123009234-123009256 CCCCTTCAGGCCTCTGGTGGAGG + Intronic
1076026757 10:127122083-127122105 CCCCCACTGGACCCAGGTACAGG - Intronic
1076804692 10:132849574-132849596 CTCCCTCAGGACCCTGGTGATGG - Intronic
1077011700 11:381659-381681 TGCCTGCAGGACCCTGGGGCCGG - Exonic
1077087851 11:763504-763526 CCCCTGGAAGACCCTGGTGAGGG + Exonic
1077187413 11:1241542-1241564 CCCCAACTGGACCCTGGCACAGG + Exonic
1081567901 11:44270968-44270990 CCCCTGCAGCCCCCTGGAGCAGG + Intronic
1081685825 11:45042352-45042374 GCCCTTCAGGACCCTGCTTCAGG - Intergenic
1081718378 11:45267689-45267711 GACGTAGAGGACCCTGGTGCTGG - Intronic
1083473948 11:62903648-62903670 CCTCTCCAGGACCTTGGAGCTGG + Intergenic
1084769692 11:71334598-71334620 CCCCTGCAGGGCTTTGGTGCAGG - Intergenic
1085458318 11:76678255-76678277 CTCCTTCAGGATCCTGCTGCGGG + Intergenic
1090212856 11:124935156-124935178 CCCATCCAGGAAGCTGGTGCTGG - Intronic
1090863349 11:130673574-130673596 TCCAAACAGGACCCTGGTGATGG - Intronic
1091687858 12:2576339-2576361 GCTCTACAGCACCCGGGTGCCGG - Intronic
1091826151 12:3514367-3514389 CCCCAACAGCAATCTGGTGCTGG - Intronic
1091843436 12:3636778-3636800 CTCCTCAAGGGCCCTGGTGCAGG - Intronic
1096184140 12:49567426-49567448 CCCCTAGAGAACCCAGGTACTGG + Intronic
1096478369 12:51922448-51922470 CCCCTACTGGCCCCTGGCTCAGG + Intronic
1096518704 12:52172211-52172233 CACCTACAGGAAGCTGGTGGAGG - Exonic
1096593242 12:52676288-52676310 CACCTACAGGACCCTCCTGGAGG - Exonic
1097871997 12:64610075-64610097 CCCCTACAGGACCCTGGTGCGGG + Intergenic
1099127261 12:78777789-78777811 CACCTGCAGGACCCTGATGTGGG - Intergenic
1102168839 12:110826803-110826825 GCCTTACAGGACCCTGGGGATGG + Intergenic
1102454815 12:113064982-113065004 CTCCTCCAGGACCCTGCTGAAGG - Intronic
1102903909 12:116660341-116660363 CCCCTGCAGAACGCTTGTGCCGG - Intergenic
1103533699 12:121620303-121620325 CCCCTCTAGGATCCTGGGGCAGG + Intergenic
1103809502 12:123602235-123602257 CCCGTACATGACGCCGGTGCAGG + Exonic
1105525845 13:21177069-21177091 GCCCTACATGACCCGGGAGCAGG + Exonic
1114634140 14:24177978-24178000 CCCCTAGAGGAACCTGGAGAGGG - Intronic
1118637394 14:67760345-67760367 CCCCTACAGGACACTGAAGGGGG - Intronic
1118760953 14:68879897-68879919 GCCCTCCAGGGCCCTGGGGCAGG + Intronic
1121878682 14:97479435-97479457 CCCCTTCAGGACTCAGGTCCTGG - Intergenic
1122714118 14:103683538-103683560 TCCCAACAGGGACCTGGTGCTGG - Intronic
1128579211 15:68797167-68797189 CCCCCAGAGGCCCCGGGTGCTGG + Intronic
1128770345 15:70277225-70277247 CCCCTGCAGGCACCTGGAGCAGG + Intergenic
1129411783 15:75354411-75354433 GCCCTGCAGGACACTGGTGTTGG - Exonic
1130305869 15:82711725-82711747 CCCCCACCTGACGCTGGTGCGGG - Intergenic
1132502194 16:289498-289520 CCCCTACCGCACCCTGGTGAGGG - Exonic
1132533780 16:467291-467313 CCTCTTCAGGAGCCTGGAGCTGG - Intronic
1132671985 16:1105809-1105831 CACCTAGAGGATCCTGGGGCTGG + Intergenic
1133040551 16:3058172-3058194 CCCCTGCAGGCCCCTGGTTCTGG + Exonic
1137835110 16:51584227-51584249 CCCCTACAGTTCCTTGGTGAAGG + Intergenic
1143862547 17:9901545-9901567 TCCCTTCAGCCCCCTGGTGCTGG + Intronic
1144944162 17:18961323-18961345 CCCCTTCAGAAGCCTGGGGCTGG - Intronic
1145018429 17:19413271-19413293 CCCCTGCAGGAGTCTGGTGAGGG + Exonic
1145157739 17:20554081-20554103 CCCCTCCCCCACCCTGGTGCAGG + Intergenic
1147419551 17:40315581-40315603 GCCCTCCAAGACCATGGTGCGGG - Intronic
1148558433 17:48592391-48592413 CCGCTACCAGACCCTGGAGCTGG - Exonic
1148561273 17:48608039-48608061 CCGCTACCAGACCCTGGAGCTGG - Exonic
1148562368 17:48613450-48613472 CCGCTACCAGACCCTGGAGCTGG - Exonic
1148562461 17:48613755-48613777 CTCCTACACAACTCTGGTGCTGG - Intronic
1149990558 17:61380945-61380967 TCCCTGCAGGAGCCTGGAGCTGG + Intronic
1150226546 17:63527652-63527674 CTCCTCCAGGGCCCTGGTGAGGG + Intronic
1150682295 17:67293623-67293645 GCCGTTCAGGACCCTGGGGCAGG - Intergenic
1150682890 17:67297319-67297341 GCCGTTCAGGACCCTGGGGCAGG - Intergenic
1151305075 17:73257954-73257976 CCCCTACAGGGTCCAGGTGAAGG - Intronic
1151334437 17:73431755-73431777 CCCCCACAGGCCCCTGGCTCTGG + Intronic
1151490700 17:74431092-74431114 CCCCTACGGGCCTCTGGCGCGGG + Exonic
1151816612 17:76474327-76474349 CCCCTGCCAGACCCTGGTCCCGG - Intronic
1152161991 17:78674687-78674709 CCTCCACAGGACCCTGGACCAGG - Exonic
1203163229 17_GL000205v2_random:70870-70892 CCCTTACATTACCTTGGTGCTGG - Intergenic
1154311983 18:13273965-13273987 GCCCCACAGGACCCTGCTGTTGG + Intronic
1155383946 18:25256630-25256652 CCCCTACAGGAGCGAAGTGCGGG + Intronic
1156010638 18:32493779-32493801 GCCCAAGAGGACCCTGATGCAGG - Intergenic
1158649586 18:59273539-59273561 CCACTAGAGGACCCTGTGGCTGG - Intronic
1160780273 19:874582-874604 CCTGCACAGGACCCGGGTGCCGG + Intronic
1160813804 19:1026414-1026436 CCCCTCCAGGCCTCTGGTGACGG + Intergenic
1160899314 19:1419279-1419301 CCCCACCAGGCTCCTGGTGCCGG - Intronic
1160948757 19:1655692-1655714 TCCCTCCAGGGCCCTGGTACGGG + Intergenic
1161327721 19:3671524-3671546 ACCCTACAGGCCCCCAGTGCAGG - Intronic
1161675761 19:5647789-5647811 CCCCTGCAGGAGCCTGGAACTGG - Intronic
1162935119 19:13978340-13978362 CCACTACAGGACCCTGTCTCGGG - Intronic
1163740607 19:19009577-19009599 CCCCGACAGGGTCCTGCTGCTGG - Intronic
1165832097 19:38735405-38735427 CCCCTACCTGCCCCTGGAGCTGG - Exonic
1166268826 19:41701277-41701299 CCTCCATAGGACCCTGTTGCTGG - Intronic
1167289105 19:48614883-48614905 CCCCCACAGGCCCCTGGAGGAGG + Intergenic
1167499123 19:49835750-49835772 CCCCTACGGTACCCTGAGGCTGG - Exonic
1167507501 19:49878512-49878534 CCTCTACAGGAGCCCAGTGCAGG - Exonic
926953676 2:18271550-18271572 CACCTTCAGGCCCCTGGAGCAGG - Intronic
926965933 2:18410965-18410987 GCACTGCAGGAGCCTGGTGCTGG - Intergenic
927667474 2:25042394-25042416 CCCCTGCACGGCCCTGGCGCGGG + Intronic
932435821 2:71702105-71702127 CCCCCACAGGACCCAGATGCCGG - Intergenic
933656217 2:84889052-84889074 CCCCTGCCAGAGCCTGGTGCAGG - Intronic
933903214 2:86863990-86864012 CCCCTACACTGCCCTGGTGAAGG - Intergenic
934767893 2:96890587-96890609 CCCCAAGAAGACCCTGGTTCTGG + Intronic
935671672 2:105561645-105561667 CCACTGCAGGTCCCTGATGCTGG + Intergenic
937919946 2:127121969-127121991 CCCCACCTGGACCCTGGGGCAGG - Intergenic
947758759 2:232588172-232588194 CCCTTCCAGGAGCCTGGTGCTGG - Intergenic
948728258 2:239947624-239947646 CCCTCACAGGACCCTGGGCCTGG - Intronic
1169035946 20:2452171-2452193 TCCTTACAGAAGCCTGGTGCTGG + Intergenic
1172929968 20:38579610-38579632 CCCCTTCAGGACCCAGTTCCAGG + Intergenic
1179553425 21:42157585-42157607 CACCTAGAGGACCCTAGAGCAGG - Intergenic
1179594173 21:42431012-42431034 TCCCTCCAGGGTCCTGGTGCAGG + Intronic
1179879589 21:44287797-44287819 CCCCCACTGCACCCTGGTTCTGG + Intronic
1180063781 21:45402805-45402827 AGCCTCCAGGACCCTGGTGGAGG + Intergenic
1180728740 22:17965304-17965326 CCCCTAAAAGACCCTGGAACTGG + Intronic
1180848386 22:18997205-18997227 CCCCTACAGTTCCATGGGGCAGG - Intergenic
1182878818 22:33715579-33715601 CCTCCAGAGGACCCTGATGCTGG - Intronic
1183186435 22:36294062-36294084 CTCCGCCAGGACCCTGGCGCGGG - Intronic
1183345772 22:37306952-37306974 CCCCTCCTGGAGCCTGGGGCTGG + Intronic
1184935324 22:47716596-47716618 CCTCTGCAGGCCCCAGGTGCAGG + Intergenic
1185236834 22:49718774-49718796 CCCCTGCTGGACCCGGGGGCTGG - Intergenic
950896252 3:16454346-16454368 CCCCTAGATGATCCTGATGCAGG - Intronic
953885442 3:46712284-46712306 CCCATCCAGGACCCTGCTCCTGG - Exonic
954328783 3:49877978-49878000 CCCCTGCAGGATACTGGTCCTGG - Intergenic
956725426 3:72152743-72152765 CTGCAACAGAACCCTGGTGCTGG - Intergenic
967528495 3:190521754-190521776 CCCCTTCAGGACCCAGGTTTGGG + Intronic
972702590 4:41508436-41508458 AGCCTACAGGACTCTGGTCCTGG - Intronic
976286171 4:83373370-83373392 ACCCTTCAGTAACCTGGTGCAGG + Intergenic
983941557 4:173538522-173538544 CACCTCCCAGACCCTGGTGCCGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
997510620 5:134451313-134451335 CCCCTTCAGGGCCCTGTGGCTGG - Intergenic
1000297021 5:159921064-159921086 CCCCTACAGGATCCTGTTCAGGG + Intronic
1001173641 5:169444931-169444953 TCCCCACAGGCCACTGGTGCAGG - Intergenic
1001507773 5:172293487-172293509 CCACCTCAGGAGCCTGGTGCTGG + Intergenic
1002070738 5:176677681-176677703 TCCCTACAGGGCACTGGGGCTGG - Intergenic
1003572687 6:7266350-7266372 GCACTGCAGGAGCCTGGTGCTGG - Intergenic
1004289185 6:14350920-14350942 CCCATCCATGACCCTGTTGCAGG - Intergenic
1005522697 6:26614248-26614270 CCCACACCGGGCCCTGGTGCGGG + Intergenic
1006029893 6:31170852-31170874 CCCCTCCAGGACCTCAGTGCAGG + Intronic
1006358662 6:33575428-33575450 CTCCTACAGCACCATGGGGCAGG - Exonic
1006683130 6:35811612-35811634 CCCCCACAGGAAGATGGTGCAGG + Intronic
1017647489 6:156552303-156552325 CCCCTTCAGGACTGTGGTCCAGG + Intergenic
1017792031 6:157808749-157808771 GCCCTGCAGAAGCCTGGTGCTGG - Intronic
1018975724 6:168563896-168563918 CCCCTGCAGGCCCCTGAAGCCGG - Intronic
1020281447 7:6652294-6652316 CACCTTCAGGAGCCTGGTTCTGG + Exonic
1021228498 7:18057010-18057032 CCTCTACAGGACCCTCTTGCTGG + Intergenic
1022739635 7:33109075-33109097 GCCCGGCAGGAGCCTGGTGCGGG - Intronic
1024522356 7:50316568-50316590 TCCCTCCAGGAGACTGGTGCGGG + Intronic
1029187062 7:98746876-98746898 TCCCCACTGGACCCTGGGGCAGG + Intergenic
1029444914 7:100606494-100606516 CTCCTACAAGACCCTGCCGCGGG + Exonic
1029462828 7:100706130-100706152 CCCGTTCAGGACCCCGGCGCGGG + Exonic
1029471838 7:100759590-100759612 CCCCTACTGGACTTTGGGGCTGG + Intronic
1035322666 7:158043543-158043565 CTCCTGCAGGAGCTTGGTGCTGG - Intronic
1035628204 8:1089436-1089458 CCCATTCAGGCCCCTGATGCTGG - Intergenic
1035767446 8:2118724-2118746 CCCCTGCAGGACCCAGAGGCTGG + Intronic
1040474511 8:47764550-47764572 CCCCATCAGGTCCCTGGCGCTGG + Intergenic
1043737871 8:83769359-83769381 ACCCCACAGGAGCCTGGTACAGG - Intergenic
1049477434 8:142803309-142803331 CCCCTACAGGACACTCGTACAGG - Intergenic
1049477730 8:142804581-142804603 CCCCTACAGGACCCCCGTACAGG - Intergenic
1049477773 8:142804752-142804774 CCCTTACAGGACCCCTGTACAGG - Intergenic
1052746813 9:32449324-32449346 CCCCTACTGTACCCTGTTCCCGG + Intronic
1055125763 9:72716877-72716899 CGCCACCAGGGCCCTGGTGCTGG - Intronic
1059539813 9:115118789-115118811 GCCCTGCAGGACACTGGGGCTGG - Intergenic
1060341777 9:122783638-122783660 CCTCTGCAGTACCCTTGTGCTGG - Intergenic
1061845644 9:133386660-133386682 AGCCTACAGGACCCGGCTGCTGG - Intronic
1062188312 9:135230332-135230354 ACCCCACAGGCCCCTGGAGCGGG + Intergenic
1189439781 X:41024942-41024964 GTGCTACAGGAGCCTGGTGCTGG - Intergenic
1190292235 X:49000739-49000761 GCCCTATAGGACCCTGAGGCTGG + Intronic
1195228990 X:102827076-102827098 CACCTACAGGACCCTGCACCAGG + Intergenic
1196066638 X:111471384-111471406 CCCATACAGAAGCCTGCTGCAGG - Intergenic
1197706954 X:129641024-129641046 TCCCTACAGGTCCCTGGGTCAGG + Intergenic
1197717800 X:129722038-129722060 CCCCTTCAGGATGCTGGGGCTGG - Intergenic