ID: 1097872734

View in Genome Browser
Species Human (GRCh38)
Location 12:64614635-64614657
Sequence CCTTATTTGCAAAGGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 228}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097872734 Original CRISPR CCTTATTTGCAAAGGGAATA TGG (reversed) Intronic
909238876 1:73186574-73186596 CAATATTTTCAAAGGTAATATGG + Intergenic
909459659 1:75895218-75895240 CCTGATTAGCAAAGGGAAATTGG + Intronic
910354206 1:86336699-86336721 TTTCATTTGCAATGGGAATATGG - Intergenic
910622407 1:89271198-89271220 TTTTATTTGCAAAGGTTATAGGG - Intronic
914418021 1:147502559-147502581 CTTTATTTTCTATGGGAATAAGG + Intergenic
916269315 1:162922728-162922750 CCTTAATTGTACCGGGAATAGGG - Intergenic
917955090 1:180087750-180087772 CCTTGTTTGAAAAAGGAATAAGG + Intronic
918396805 1:184121770-184121792 ACTTGTCTGCAAAGGAAATAAGG - Intergenic
919173393 1:193987790-193987812 CTTTATATGCAAAAGAAATATGG + Intergenic
919719080 1:200812417-200812439 CCTAATTTGAAAATGGAATGAGG - Intronic
921086425 1:211797832-211797854 CACTATTTCCAAAGGGAAAAAGG + Intronic
921264904 1:213414328-213414350 CCTTATTTGGAAAGGAAATAGGG + Intergenic
923374041 1:233342106-233342128 CTTTATATTCATAGGGAATAAGG + Intronic
924842996 1:247734191-247734213 CCTTATTAGAACAGGGATTAGGG + Intergenic
1063773476 10:9231707-9231729 CCTTATTTGCAAAGTACAGAAGG + Intergenic
1068048282 10:51915653-51915675 TCTTATTTACAAAGCAAATAGGG + Intronic
1071948474 10:90675539-90675561 GCTTGTTTGGTAAGGGAATAGGG - Intergenic
1073690995 10:105809259-105809281 CCTTGTTTGCAAAGAGAAGTAGG - Intergenic
1073857655 10:107696142-107696164 CCTTATTTACAGAGAGAAGAGGG + Intergenic
1074944069 10:118264302-118264324 CTATAGTTCCAAAGGGAATAGGG + Intergenic
1077621925 11:3733196-3733218 TCATAGTTGCAAAGGGAAGAGGG - Intronic
1078348569 11:10573601-10573623 CCTTGCTTACAAATGGAATAGGG + Exonic
1078385862 11:10892054-10892076 CCTGAATTCCAAAGGGAAGAGGG + Intergenic
1078702688 11:13703531-13703553 TCTTATTTGCAAAGTGCATATGG + Intronic
1080802492 11:35620302-35620324 CCTTTTTCGGAAAGGGAATGAGG - Exonic
1081157276 11:39709666-39709688 ACTTATTTGCATATGGAATTAGG + Intergenic
1081376876 11:42369103-42369125 CTTTATCAGCAAAGGGAAAATGG + Intergenic
1081492364 11:43578674-43578696 CCACAATTGCAAAGGAAATAGGG + Intronic
1082201602 11:49377836-49377858 CCTTATTTGCAAGGAGTAGAGGG - Intergenic
1082615383 11:55353941-55353963 CCTTATTAACAAAGGGAAGCTGG - Intergenic
1084765950 11:71308537-71308559 GCTTATTTGGAATGAGAATAAGG + Intergenic
1085558744 11:77450424-77450446 CCATATTTGCAAAGGGAAGTAGG + Intronic
1085703328 11:78764225-78764247 CCTTATTTGTAAAGGTGAGAAGG - Intronic
1085841711 11:80018839-80018861 CCTTATTTGCAGATGCAATTAGG - Intergenic
1086312594 11:85550886-85550908 CCGTATTTCCAAAGGAAAGAAGG + Intronic
1086654067 11:89328389-89328411 CCTTATTTGCAAGGAGTAGAGGG + Intronic
1087194018 11:95286448-95286470 CTTTATATGCTAAGGGAAGAAGG + Intergenic
1088608244 11:111551911-111551933 CCATATTTACAAAGGGAAAGGGG - Intronic
1088694285 11:112353609-112353631 CCTTATTTGACAGGGGAAAAAGG - Intergenic
1089003442 11:115070878-115070900 CCCTATTTCTAAAGGGAATTTGG + Intergenic
1089054851 11:115577248-115577270 GCTTATTAGCCAAGGGAAAAGGG + Intergenic
1089855374 11:121539008-121539030 CCAAATTTGCAAAGGGTAAAAGG - Intronic
1095791645 12:46174489-46174511 CATTATTTGAAAAGGGGATGTGG + Intergenic
1097629316 12:62040369-62040391 CCTTATTTGGAAACAGAATCTGG + Intronic
1097872734 12:64614635-64614657 CCTTATTTGCAAAGGGAATATGG - Intronic
1100216549 12:92455965-92455987 CCTTATAAGAAAAGGGAATTTGG - Intergenic
1101505798 12:105345080-105345102 CCTGAATTTCAAAGGGAAGAGGG - Intronic
1104240644 12:126985708-126985730 CCTTATTAGCAATGTGAAAATGG - Intergenic
1106881522 13:34136989-34137011 CATTATTTTCAAAAGCAATAGGG + Intergenic
1107651375 13:42548837-42548859 CCTTAATTGCAAAGGGGAAGTGG - Intergenic
1107965991 13:45598722-45598744 CCTTCTTTGAAAAGGGGATCTGG - Intronic
1108118427 13:47156497-47156519 ACTTACTTGCATAGGGAAGAAGG + Intergenic
1108170235 13:47734333-47734355 CCTTATTTACAAAAACAATATGG - Intergenic
1108705287 13:52979941-52979963 CCTTATTTGCAAAATGTAGATGG + Intergenic
1109801027 13:67379468-67379490 TCTTATTTTTAAAGGGAATAAGG + Intergenic
1110707957 13:78616655-78616677 ACTTATTTGGAAAGAGAATGGGG - Exonic
1111172187 13:84541895-84541917 CCTTAATTCCAAAGGGAGTCGGG + Intergenic
1111607045 13:90552854-90552876 CCTTATTGGCACAGGCAACAGGG + Intergenic
1111787168 13:92803467-92803489 ACTGAGTTGCAAAGGGAATTAGG - Intronic
1112854161 13:103745841-103745863 TCATGTTTGCAAAGGGAAGAGGG + Intergenic
1114790006 14:25647396-25647418 CCTTATGTTCAAAGTGAGTAAGG - Intergenic
1114949174 14:27725815-27725837 CCTTATTTGCAAAGAGGAGGAGG + Intergenic
1115069296 14:29301794-29301816 CCTTATTTACCCAGGGCATATGG - Intergenic
1115110860 14:29820141-29820163 CCTTATTTCCAGGGGTAATATGG - Intronic
1118277757 14:64400780-64400802 CCTTATTTGCCTAGAGAAAAAGG - Exonic
1118585219 14:67346135-67346157 TATGATTTTCAAAGGGAATAAGG - Intronic
1119004868 14:70915291-70915313 TCTTATTTGGAAAGAGAAAAGGG - Intronic
1119242848 14:73076158-73076180 TCTTATTTTCAAAAGGAATGTGG - Intronic
1119987383 14:79153303-79153325 CTTTATTTGAAAAGGGAATATGG + Intronic
1121802850 14:96789353-96789375 CCTTTATGTCAAAGGGAATACGG - Intergenic
1124205576 15:27716393-27716415 CCTTATTTGCAAATGACATGAGG - Intergenic
1126277625 15:46902710-46902732 CCTTATTAGAAAAGGAAATTAGG + Intergenic
1126317592 15:47386892-47386914 GTTTATTTGCAAATGCAATAGGG + Intronic
1127211384 15:56778237-56778259 CATAATTAGCAAAGGGAATGAGG - Intronic
1127468148 15:59265213-59265235 CCTTAGTTGTAAAGGGAATGTGG + Intronic
1128871993 15:71166144-71166166 GCTTATTTCCCTAGGGAATAGGG + Intronic
1131259050 15:90879230-90879252 CCTCATTTTCCAAAGGAATAAGG - Intronic
1131645003 15:94331958-94331980 CCTTATCTGCAAAAGAAAGATGG + Intronic
1133109651 16:3540143-3540165 CCTAATTTACAAAGGGAAAAAGG - Intronic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133690377 16:8208697-8208719 GCATATTTGCAAATGAAATACGG + Intergenic
1133849779 16:9491610-9491632 CCTTATTTGCAAGGAGACTGTGG + Intergenic
1134319147 16:13147058-13147080 TCTTATTTGCAGAAAGAATAAGG - Intronic
1134369895 16:13613490-13613512 CCTTATTTCCCAAAGGAAGATGG + Intergenic
1135418598 16:22288698-22288720 CTTTATTTGTAAAGAGAAAATGG - Exonic
1137681770 16:50353504-50353526 CATTATTTGCAAAGGGTTTATGG - Intronic
1138010868 16:53378666-53378688 CCTTTTTAGAAAAGGGAAAATGG + Intergenic
1138079960 16:54081264-54081286 CCTTCTTTGGAAAGGGGGTAGGG - Intronic
1138854418 16:60671361-60671383 CATTTATTGCATAGGGAATAAGG + Intergenic
1138898482 16:61239810-61239832 CCTCATTTCCAAAAGGAGTAGGG - Intergenic
1138938886 16:61765113-61765135 CCTTATTGGCAAAGGTCAGAAGG - Intronic
1141550672 16:84804670-84804692 CCTTATTTGGAAAAAGAATCTGG + Intergenic
1142478428 17:203701-203723 CCTTATTAGCATAAGGAATGTGG + Intergenic
1142819185 17:2451189-2451211 CTTTATTTTCAAAGGGAAAAAGG - Intronic
1144040474 17:11406072-11406094 TTTTCTGTGCAAAGGGAATAGGG - Intronic
1145767109 17:27466336-27466358 CCTTTTTTACAAAGGGAAATAGG + Intronic
1145978139 17:28996190-28996212 CCTTATTTCCAAATGGCTTAGGG + Intronic
1146100795 17:29979763-29979785 CCTTGTCTTCAAAGGGATTATGG - Intronic
1148216017 17:45834365-45834387 CCTTCATGGCAAAGGGCATATGG + Intronic
1151270703 17:72993512-72993534 GCATTTTTGCAAAGGGTATATGG + Intronic
1151550311 17:74818918-74818940 CCTTCTTTGCAAAGGAAAATGGG - Intronic
1153182125 18:2446754-2446776 CCTGAATTCCAAAGGGAAGAGGG + Intergenic
1153837566 18:8977680-8977702 CCTGAATTCCAAAGGGAAGAAGG + Intergenic
1155652131 18:28155110-28155132 CCTTATTTCCACAAGGAATCAGG - Intronic
1157927957 18:51787033-51787055 CCTTATTAGAAAAGGGATTGAGG + Intergenic
1158785675 18:60709327-60709349 CCTCCTTTGAAAAGAGAATATGG - Intergenic
1161842738 19:6692806-6692828 CAATCTTTGCAAAGGGAATTGGG + Intronic
1165692050 19:37871269-37871291 CCTGAATTCCAAAGGGAAGAAGG + Intergenic
926278135 2:11421496-11421518 CTTCATTTTTAAAGGGAATATGG + Intergenic
928519273 2:32072477-32072499 CCTGAATTCCAAAGGGAAGAGGG + Intronic
929077889 2:38093442-38093464 CTTTATATACAAAGGGATTAAGG + Intronic
929288311 2:40161433-40161455 TCTTGTTTGCAATAGGAATAGGG - Intronic
931753470 2:65350947-65350969 CCTCCTTTGCAAAATGAATAGGG + Intronic
932110699 2:68996756-68996778 CCTTGTCTGAAAAGGGAATAAGG - Intergenic
933868081 2:86542713-86542735 CATTATTTTTAAAGGGAAAAAGG - Intronic
934107818 2:88712025-88712047 CCTGAATTCCAAAGGGAAGATGG + Intronic
936490090 2:112962483-112962505 ACTTTTTTGCCAAGGGAATGTGG + Intergenic
936785195 2:116086561-116086583 GCTTATTTGAAAAAGGAAAATGG + Intergenic
937491837 2:122377592-122377614 CCTTATTTGCAAAATGAGGAGGG + Intergenic
938171880 2:129085901-129085923 CCTGAATTCCAAAGGGAAGAGGG - Intergenic
938234762 2:129696750-129696772 CTTTATTTGCAGAGTGAAAATGG + Intergenic
938967578 2:136402065-136402087 CATTACTTGGGAAGGGAATACGG - Intergenic
941855776 2:170228946-170228968 TTTTTTTTGTAAAGGGAATATGG - Intronic
942177420 2:173347506-173347528 CCTGATTAGAAAAAGGAATATGG - Intergenic
942487769 2:176457277-176457299 CCTTATTTGCTTTGGGAATTTGG - Intergenic
942662980 2:178285845-178285867 CCTTATTTGCCAGGGGCACAGGG + Intronic
943235949 2:185319764-185319786 CCTTATCTGCAAATTGAAGATGG + Intergenic
946761027 2:222993179-222993201 CCTCATTTGAAATAGGAATATGG + Intergenic
947142207 2:227029999-227030021 GCTTATTTGCAAAAGGAATTAGG + Intronic
947294393 2:228614748-228614770 CCTGAATTCCAAAGGGAAGACGG - Intergenic
947393636 2:229665757-229665779 CCATCTTTGCATAGGGAAGAAGG + Intronic
948689384 2:239692275-239692297 CCTTATTTATTCAGGGAATAGGG - Intergenic
1168799311 20:634206-634228 CGTGATCTGCAAGGGGAATAGGG + Intergenic
1169979848 20:11372118-11372140 CTTTATTAGAAAAGTGAATATGG + Intergenic
1173048523 20:39536341-39536363 CCTTTTGTGCAAAGGGAAGGTGG + Intergenic
1174200360 20:48802820-48802842 CCCTTGTTGCAAAGGGAATGGGG - Intronic
1177303445 21:19281607-19281629 CATTGCTTGCAAAGGAAATACGG - Intergenic
1177945211 21:27459894-27459916 TCTTATTTCCTAAGGGGATAAGG - Intergenic
1178166171 21:29980288-29980310 CCTCATTGGCAAAGGTAATAAGG + Intergenic
1179987614 21:44930304-44930326 CCTCATTTACAAATGGAAAAAGG - Intronic
1183128678 22:35811386-35811408 CCTTATAAGAAAAGGGAATGTGG + Intronic
950158494 3:10741835-10741857 TCAGATTTGCAAAGGGACTAAGG - Intergenic
955402181 3:58600169-58600191 CCTTTTTTGGAAAGGGGAAAAGG + Intronic
955409489 3:58646615-58646637 GCTCATCTGCAAAGGGAAAACGG + Intronic
957816228 3:85301099-85301121 CATTATATGCAAAGTGGATATGG + Intronic
958116519 3:89226178-89226200 CCTTATTTGCTATGGGACTGTGG + Intronic
958119959 3:89273213-89273235 GCTTATTTGTTAATGGAATATGG + Intronic
959090916 3:101901840-101901862 CTGTATTTCCAAAGGGATTAAGG + Intergenic
960467681 3:118017398-118017420 GCTCATTTGCAAAGAGAAAAAGG + Intergenic
962099722 3:132329110-132329132 TCTTACAAGCAAAGGGAATAGGG - Intronic
963579369 3:147105309-147105331 CTTTCTTTGCAATGTGAATATGG + Intergenic
963861175 3:150312137-150312159 CCTTGTTTGTACAGGGAATGTGG + Intergenic
966754302 3:183354083-183354105 CCTGAATTCCAAAGGGAAGAGGG - Intronic
968148106 3:196316782-196316804 CCATATTTGCCAAGCAAATATGG + Intronic
969828181 4:9774857-9774879 CCTTATTTGCAGAAGGAATGAGG - Intronic
969925330 4:10579909-10579931 CCTGATTTGCATAGGGTTTAGGG - Intronic
971036895 4:22703387-22703409 CCTTATTTGCAAAATGAGAACGG + Intergenic
971728727 4:30348682-30348704 CCTGAGTTTCAAAGGGAAGACGG - Intergenic
972450367 4:39192001-39192023 CCTTATATCCTAAGAGAATAGGG + Intronic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
974669856 4:65015367-65015389 CCTGATTTCCAAAGGGAGGAAGG + Intergenic
975259330 4:72277880-72277902 TCTTATATGCCAAGGGAAGAAGG - Intergenic
975617290 4:76258855-76258877 CCTTATTTGGAAATTAAATATGG + Intronic
977057061 4:92205499-92205521 CCTTATTTGCCAGGGGTATATGG + Intergenic
977089268 4:92650507-92650529 CCTTATTACCAAAGGGAAATTGG - Intronic
977451836 4:97208687-97208709 CCTAATTTGCAACTGGAAAATGG + Intronic
978453174 4:108859349-108859371 CCTTCCTTGCAGAGGGAATGTGG - Intronic
979528372 4:121741258-121741280 CCTTCTAGGCAGAGGGAATAGGG - Intergenic
979654316 4:123174544-123174566 CCATATTTGTAAAAGTAATATGG + Intronic
980292094 4:130856937-130856959 CCTTTTCTGCCCAGGGAATATGG + Intergenic
981112109 4:140947424-140947446 CCTTTGATGCAAAGGGGATAGGG + Intronic
981143715 4:141301079-141301101 CCTTGTTTGAAAAGGCAATTAGG + Intergenic
981342430 4:143637448-143637470 CCTTATTTGGGAAGGGAATATGG - Intronic
982867800 4:160540113-160540135 CCTGAATTCCAAAGGGACTAGGG - Intergenic
983170003 4:164524900-164524922 CCTTAATAGCAATGGGAAGAGGG - Intergenic
990308462 5:54516833-54516855 CCTCTTTCACAAAGGGAATAGGG - Intergenic
990780497 5:59356691-59356713 GCTTATTTGCAAGGGGCCTAAGG + Intronic
991252840 5:64582905-64582927 CCTTATTTCCTAATGGAATGAGG + Intronic
991277411 5:64865626-64865648 CCTTATTTTTAGAGGGAAGATGG + Intronic
993929459 5:93920310-93920332 CCTCATCTGAAAAGGGAAGATGG - Intronic
994743924 5:103655459-103655481 CTTTATTTTCAAAGAGAACAAGG + Intergenic
995884308 5:116876621-116876643 CCTAATTTCCAAAGAGATTAGGG + Intergenic
997773898 5:136580875-136580897 CTTCATTTGAAAAGGAAATAAGG + Intergenic
998826266 5:146104344-146104366 GCTTATTGCCAAAGGGAAAAAGG - Exonic
999549611 5:152671884-152671906 CCTTATTTTCAAGGGCAACAAGG - Intergenic
1001722690 5:173869536-173869558 CTTTATGTGCAAAGGAAACACGG - Intergenic
1002515270 5:179753463-179753485 TTTTATTTGTAAAGGGAATAAGG + Intronic
1003958657 6:11189683-11189705 CCTCATTTGCAAAATGAATGGGG - Intronic
1004778940 6:18883115-18883137 GTTTATTTTCACAGGGAATAAGG - Intergenic
1005286168 6:24329280-24329302 GCTTCTGTGCAAAGGGAATGAGG - Intronic
1005327649 6:24719100-24719122 CCTTTTTAGAAAAGGGATTAAGG + Exonic
1005533895 6:26735298-26735320 CCTCAGCTGTAAAGGGAATACGG + Intergenic
1005536900 6:26766356-26766378 CCTCAGCTGTAAAGGGAATACGG - Intergenic
1007277318 6:40684428-40684450 TCTCATATGTAAAGGGAATAAGG - Intergenic
1009368944 6:62877988-62878010 CCTAATTTCCAAAGGGAAAATGG + Intergenic
1010554796 6:77265795-77265817 TCTTATTAAGAAAGGGAATAAGG + Intergenic
1013198353 6:107865986-107866008 ACTGATTTTCAAAGGGAATGAGG - Intergenic
1013227357 6:108129570-108129592 GGTTATTTTAAAAGGGAATATGG + Intronic
1014566293 6:122953168-122953190 CATTATTCGCAAAGGCAAAATGG + Intergenic
1014672791 6:124327914-124327936 CTTTATTTTTAAAGAGAATATGG - Intronic
1015083991 6:129265186-129265208 ACTTGTTTGGAATGGGAATATGG + Intronic
1016803560 6:148190395-148190417 CCTGATTTCCAAAGGGGAGATGG - Intergenic
1017486269 6:154904453-154904475 CCTACTTTTCAATGGGAATATGG - Intronic
1017753532 6:157510655-157510677 CCTTATTTGCAATCCGCATAAGG + Intronic
1020527335 7:9278814-9278836 AGTTATTTGCCCAGGGAATATGG + Intergenic
1024628298 7:51227225-51227247 CCTTATTTGCAAACTGAGTTGGG + Intronic
1028122106 7:87067764-87067786 CTTTATTTCCAAAAGGAAAAAGG + Intergenic
1029031549 7:97473017-97473039 ATTTAATTGCAAAGGGAATTTGG - Intergenic
1030165073 7:106546134-106546156 CCTTATTTTTAAAGAGAATTAGG + Intergenic
1031756658 7:125652224-125652246 CCTTATTTGAATAGGGAAAAGGG + Intergenic
1032271772 7:130415158-130415180 CATTATTAGCAAAGGGAAGTTGG + Intronic
1032390017 7:131549831-131549853 GCTTATTCCCAAGGGGAATAAGG + Intronic
1033635648 7:143209373-143209395 CATAATCTGCAAAGGGAATAAGG - Intergenic
1036500716 8:9311462-9311484 CCTTCTCTGCAAAGGGACTCAGG + Intergenic
1038619343 8:29125292-29125314 CCTTATTAGAAAAGGAAATGAGG - Intronic
1038934139 8:32229710-32229732 TCTTGTTAGCAAAGGGAAAATGG - Intronic
1042873688 8:73420653-73420675 CCTTACTTGCTAAGAGTATATGG + Exonic
1043058653 8:75472549-75472571 CTTTACTTACTAAGGGAATAGGG - Intronic
1043983535 8:86667766-86667788 CCTTCTTTTCAAAGGTAATTAGG + Intronic
1044604630 8:94038005-94038027 CCTTATCTGTAAAGAAAATAAGG + Intergenic
1046522508 8:115343453-115343475 CCTTTTTTGCAGAAGGAAAATGG - Intergenic
1046731159 8:117727805-117727827 TCTTGTTTGCCAAGGGAAAAAGG - Intergenic
1046777859 8:118182864-118182886 CCTTTTCACCAAAGGGAATAGGG + Intergenic
1046806428 8:118484112-118484134 ACTTATTTGATAAGGGAACATGG + Intronic
1048685799 8:136904236-136904258 CCATTTTTGCAAAGGGAGAAGGG + Intergenic
1049988507 9:972586-972608 CCTTAAGTGCAAAGGAAAAAAGG - Intergenic
1050168200 9:2788526-2788548 CCTTCTGTGCCAAGGGAACAGGG - Intronic
1050745962 9:8876732-8876754 TCTTATTTGCAAAGGGTACCTGG - Intronic
1055367080 9:75556145-75556167 CCTTATATGAAAAGGAAATTAGG + Intergenic
1057204865 9:93165240-93165262 CCTTATTTGCAAAAGCAGAATGG + Intergenic
1060624214 9:125095711-125095733 CCTTTTTTCTAATGGGAATATGG + Intronic
1186699508 X:12074898-12074920 CAGTATTTGTAAAGGGAAGAAGG + Intergenic
1187577898 X:20577735-20577757 ACTTATTTACTAAGGCAATAAGG + Intergenic
1187877126 X:23813682-23813704 CCCTAAATGCAAAGGGAATGAGG + Intergenic
1188369877 X:29356652-29356674 CCATATTGGGAGAGGGAATAGGG - Intronic
1188521501 X:31043217-31043239 CCTGAATTCCAAAGGGAGTAGGG + Intergenic
1189319848 X:40081245-40081267 CCTCCTTTGCAAAGGCCATACGG + Intronic
1189461354 X:41245587-41245609 CATTATTTGCTCAGGGAAGATGG - Intergenic
1191830937 X:65415578-65415600 CCTTAACTCCAAAGGGAGTAGGG + Intronic
1193177921 X:78416568-78416590 CAATAATTGTAAAGGGAATAGGG - Intergenic
1193972431 X:88071662-88071684 CCTTATAAACAAAGGGAATCGGG + Intergenic
1194299364 X:92165894-92165916 CAGGATTTGCAAAGGGAATTTGG + Intronic
1194955526 X:100174784-100174806 ACTTATTGCAAAAGGGAATATGG - Intergenic
1198227419 X:134658331-134658353 CCAAATTTCCAAAGGGAAGAAGG + Exonic
1198272214 X:135065677-135065699 CCTTATGTACAAAGGGGCTATGG - Intergenic
1200373121 X:155748812-155748834 CATTAATTGCCAAGGGAACAAGG + Intergenic
1200616969 Y:5390728-5390750 CAGGATTTGCAAAGGGAATTTGG + Intronic
1201510690 Y:14758247-14758269 CTGTATTTGCAAATGGATTAAGG + Intronic
1201694137 Y:16806292-16806314 CATATTTTGCAAAGTGAATATGG + Intergenic