ID: 1097879886

View in Genome Browser
Species Human (GRCh38)
Location 12:64677120-64677142
Sequence GTGTAAATGAAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 1, 2: 6, 3: 26, 4: 440}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097879886_1097879889 28 Left 1097879886 12:64677120-64677142 CCTTCCTCATTCTTCATTTACAC 0: 1
1: 1
2: 6
3: 26
4: 440
Right 1097879889 12:64677171-64677193 TGTTTACTACAGTAATTAGATGG 0: 1
1: 0
2: 4
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097879886 Original CRISPR GTGTAAATGAAGAATGAGGA AGG (reversed) Intronic
900703876 1:4063848-4063870 GAGAAAATGAAGAAAGGGGAGGG + Intergenic
902238187 1:15071015-15071037 GTGATAATGAAGAATGAATAGGG + Intronic
903552288 1:24166281-24166303 GTATAAATGAATAATAAGAAAGG - Intronic
905502073 1:38447365-38447387 ATGATAATGAAGAATGAGAAGGG + Intergenic
905636551 1:39557701-39557723 GTGTATAGTAAGAATCAGGAGGG - Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906739401 1:48167402-48167424 GTGAAAAAAAAGAATGAAGAGGG - Intergenic
907517876 1:55004807-55004829 GAGTGAATGAAGAACCAGGAAGG + Intronic
910832435 1:91474275-91474297 GTGCAAAAGAGGAATGAGAAGGG - Intergenic
910981820 1:92965680-92965702 GAGTAGGTGAGGAATGAGGAAGG + Intergenic
911044762 1:93619282-93619304 GTGGAAAAGAGGGATGAGGAAGG + Intronic
911390807 1:97239407-97239429 GGATAAATGAAGACTGAGTAAGG - Intronic
911653165 1:100412491-100412513 AGGAAAATGAAGAAGGAGGAAGG - Intronic
912982457 1:114387900-114387922 GGGTAAATTAATAATGAGGCTGG - Intergenic
913241333 1:116832602-116832624 ATGTAAAGGAAGAAAGGGGAGGG - Intergenic
913440242 1:118889366-118889388 TTGTAAATGATCAAAGAGGATGG - Intronic
915281730 1:154827393-154827415 GTGAGATTGAGGAATGAGGAAGG - Intronic
915878008 1:159633441-159633463 TTTTAAAGGAAGAATGAGAAGGG - Intergenic
915900895 1:159846035-159846057 GAGAAAGTGAGGAATGAGGATGG - Intronic
915978457 1:160405762-160405784 CTGTAAGTGAGGAAGGAGGAAGG + Intronic
916169322 1:161988727-161988749 GTCTGCAGGAAGAATGAGGAGGG - Intronic
916635377 1:166662437-166662459 GTATAAAAGAGGACTGAGGATGG + Intergenic
916961992 1:169897598-169897620 GAGTAGATGAAGAGTGAAGAGGG - Intergenic
917526746 1:175795066-175795088 GTGTAGATGAAGAGGAAGGAAGG + Intergenic
918046088 1:180941845-180941867 TGTTAAAAGAAGAATGAGGAGGG - Intronic
920341552 1:205278273-205278295 GAGAAAATGAAGAAGAAGGAAGG - Intergenic
920817485 1:209348537-209348559 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
921171087 1:212550323-212550345 GAATAAATTAAGAAAGAGGAAGG - Intergenic
921535100 1:216339468-216339490 ATGTAAATGCAGAATGTGGGAGG + Intronic
921965636 1:221085688-221085710 CTTTACATGAAAAATGAGGATGG + Intergenic
923587170 1:235284031-235284053 TTTTAAATGTAGAATGAGGCTGG - Intronic
924107899 1:240667700-240667722 GTGAAGACGAAGAATGAAGAGGG - Intergenic
924696705 1:246407959-246407981 GTGTAAATGAAGAAACCTGAGGG + Intronic
1063724010 10:8616534-8616556 CAGTAAATGAAAAATGAGCACGG - Intergenic
1064053387 10:12077679-12077701 ATGTCAATGAAGAATGAGGAGGG + Intronic
1064443601 10:15373996-15374018 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1065044930 10:21738659-21738681 GTTAAGATGAAGAATGAGAAGGG - Intronic
1066516969 10:36173361-36173383 GTCTAAATGAAAAAAGAGGAAGG + Intergenic
1066761436 10:38757278-38757300 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1066960150 10:42215146-42215168 GTGAGAATGAAGAATAAGGTGGG - Intergenic
1067267050 10:44755632-44755654 GAGGAAATGAAGACTTAGGAAGG + Intergenic
1067488897 10:46679238-46679260 GTGGAAAGGAGGGATGAGGAAGG - Intergenic
1067605771 10:47661138-47661160 GTGGAAAGGAGGGATGAGGAAGG + Intergenic
1068421793 10:56804019-56804041 GTAAAAATAAAGAATCAGGAAGG - Intergenic
1069571489 10:69497039-69497061 CTGTAAAGCAAGAATAAGGATGG - Intronic
1070352152 10:75602934-75602956 GGGAAAAAGAAGTATGAGGAGGG - Intronic
1071621330 10:87122497-87122519 GTGGAAAGGAGGGATGAGGAAGG + Intronic
1071934081 10:90507310-90507332 GTGGAAAAGAGGCATGAGGAAGG + Intergenic
1072014577 10:91334320-91334342 GTGAACATAAAGAATGAGGTGGG + Intergenic
1072369586 10:94751715-94751737 GGGTCAATGAAGAATTAAGAAGG - Intronic
1073494377 10:103878411-103878433 GAGTAAACCAAGAATGAGGTAGG - Intergenic
1074124461 10:110517028-110517050 GTGTAAGTGTGGAAGGAGGAGGG + Intergenic
1074150224 10:110752784-110752806 GTGTAAGTGAGGAAGGAGGCTGG - Intronic
1074727162 10:116323483-116323505 GGAAAAATGAAGAGTGAGGAGGG + Intergenic
1074744150 10:116514889-116514911 TTTTAAATGAAGAATGAAGAAGG + Intergenic
1074834088 10:117272528-117272550 GTTTAAATGGGGAAAGAGGAGGG - Intronic
1075359055 10:121813327-121813349 GTTGAGATGGAGAATGAGGAGGG - Intronic
1075896494 10:126000301-126000323 TTGTCAAGGAAGAATGTGGAAGG + Intronic
1078477796 11:11647439-11647461 GAGTAAATCAAGAAAGATGAAGG + Intergenic
1079888604 11:26021261-26021283 GTGTAAATTAAGTAGAAGGAAGG + Intergenic
1079944843 11:26729237-26729259 GTGGAAAAGAAGGATGAGGAAGG - Intergenic
1080232789 11:30036366-30036388 GTGTAAATGGAATATGTGGAAGG + Intergenic
1081010943 11:37811960-37811982 GTGTCCAGGAAGAATGAGGTAGG + Intergenic
1083149255 11:60781649-60781671 GTGTAAGTGGAGGGTGAGGAGGG - Intergenic
1084439216 11:69161706-69161728 GGATAAATGAATAATGATGATGG + Intergenic
1085998116 11:81947157-81947179 GTGAAAATCCAGATTGAGGATGG - Intergenic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1086931670 11:92700258-92700280 GTGTAAAGGCAGAGTGGGGATGG + Intronic
1087627901 11:100617956-100617978 GGGTAAAAGAAGAATCAGTATGG - Intergenic
1087729282 11:101760075-101760097 GTCCCACTGAAGAATGAGGAAGG + Intronic
1088183201 11:107135341-107135363 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1089060859 11:115624975-115624997 GTGAAAATGGTGAAAGAGGACGG - Intergenic
1089081378 11:115778870-115778892 GAGAAAATGAAGCAAGAGGAAGG - Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1090063244 11:123481616-123481638 GCGTTAATGAAAAATGAGGTGGG + Intergenic
1090944177 11:131414753-131414775 TTGTAAATGAAGAAATAGGCAGG - Intronic
1091268465 11:134288825-134288847 GTGCAAGTGGAGAATGAGTATGG + Exonic
1091356111 11:134938853-134938875 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1091364610 11:135007262-135007284 GTGTGAGTGACAAATGAGGAAGG + Intergenic
1091940068 12:4471395-4471417 GAGTAACTGCAGAATCAGGAAGG - Intergenic
1092023174 12:5219255-5219277 ATGAAAATGAAAAAAGAGGATGG + Intergenic
1092318360 12:7443381-7443403 GTGGAAATAAAGAATCACGAAGG - Intronic
1092589219 12:9935153-9935175 ATGTAAATGAACTTTGAGGAGGG + Intergenic
1093080163 12:14801820-14801842 TTGTAAAAGAAGAATAAGAAGGG + Intronic
1093757986 12:22874195-22874217 GTGTAGAGAAAGAAGGAGGAGGG - Intergenic
1094149273 12:27264347-27264369 GTGAGAATGAAGAATAAGGTGGG + Intronic
1095043553 12:37472260-37472282 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1097604135 12:61731556-61731578 AAGTAAAAGAAGAATGAGCAGGG - Intronic
1097879886 12:64677120-64677142 GTGTAAATGAAGAATGAGGAAGG - Intronic
1098292931 12:68975817-68975839 GTATAATTGAAGAAGGAAGAAGG - Intergenic
1099217479 12:79870784-79870806 GTATATAAGAAGTATGAGGAAGG - Intronic
1101618002 12:106356811-106356833 CTGTAAATGGAGAATGGTGATGG - Intergenic
1102572737 12:113837150-113837172 GTGTATATTAAGTAGGAGGATGG - Intronic
1103840960 12:123863923-123863945 ATGTAAGAGAAGAATGAGGTAGG + Intronic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104496072 12:129240536-129240558 ATATAAAGGAAGAATGAAGAAGG + Intronic
1105332669 13:19432437-19432459 GTGTAATTGAAGAATTGGGCAGG - Intronic
1105600818 13:21885483-21885505 ATGTGAACGAATAATGAGGATGG - Intergenic
1105879018 13:24587340-24587362 GTGTAATTGAAGAATTGGGCAGG + Intergenic
1105920818 13:24961712-24961734 GTGTAATTGAAGAATTGGGCAGG - Intergenic
1106787868 13:33124979-33125001 CTCTAAATTAAAAATGAGGAGGG + Intronic
1106900718 13:34352261-34352283 GTGAAAAAGAGGGATGAGGAAGG - Intergenic
1108050706 13:46435214-46435236 GTGGATATGAAGAATCAGGTAGG - Intronic
1108344100 13:49527362-49527384 GTGGAAATGCAGAGTGTGGAGGG - Intronic
1108423775 13:50277408-50277430 TTGTAGATGAAGAAAGAGCAGGG + Intronic
1108715661 13:53075547-53075569 GTGTAAATCAGCAATGAGAAGGG + Intergenic
1109487425 13:63045306-63045328 CTGTAAATGAAAAAAGAGAAAGG - Intergenic
1109543282 13:63808838-63808860 GTGGATATGAAGAATCAGGTAGG - Intergenic
1110192382 13:72745333-72745355 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1110499557 13:76210886-76210908 GTTTAAATGGAGAAACAGGAAGG - Intergenic
1110533451 13:76623597-76623619 GAGAAAGAGAAGAATGAGGAGGG - Intergenic
1111096223 13:83518544-83518566 ATGGAAAAGAAAAATGAGGAGGG + Intergenic
1111598521 13:90441991-90442013 GTGTGAAAGGAGAAGGAGGAGGG - Intergenic
1112150752 13:96760241-96760263 TTGTATCTGAAGATTGAGGAAGG - Intronic
1113756523 13:112815448-112815470 GTGTGTCTGAAGGATGAGGAAGG - Intronic
1116024463 14:39498116-39498138 AGGTAAATGAATAATGGGGATGG - Intergenic
1118297909 14:64587318-64587340 GTGAAGATGAGGAATCAGGAGGG + Exonic
1118667757 14:68088805-68088827 GCGTAACTGAAGAAGGAGGTTGG + Intronic
1119902605 14:78274091-78274113 GTACAAATGAAGAGTGAGGTGGG + Intronic
1121647792 14:95532666-95532688 CTTTAAAGGAAAAATGAGGAGGG - Intergenic
1121882241 14:97511341-97511363 GGGTCAACGAAGAATCAGGAAGG - Intergenic
1122074067 14:99224468-99224490 GTGTGAATGAAGGCAGAGGAAGG - Intronic
1122839433 14:104448678-104448700 GTGTTAAAGAAGATAGAGGAAGG + Intergenic
1123159789 14:106267381-106267403 GAATAAAGGAAAAATGAGGAGGG + Intergenic
1202932145 14_KI270725v1_random:47560-47582 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1202942090 14_KI270725v1_random:159853-159875 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1128127715 15:65205225-65205247 GTGAGGCTGAAGAATGAGGAGGG - Intronic
1128647097 15:69385715-69385737 GTGTATATGAAGAAAGAGGATGG - Intronic
1129323922 15:74789651-74789673 GAGTTAATGAAGACTGAAGAAGG - Intronic
1130657937 15:85805416-85805438 GTGTAAATGAAGACTTGGCATGG + Intergenic
1132307597 15:100827467-100827489 GTAAAAATGAAGAATGGGGGAGG - Intergenic
1133180368 16:4049664-4049686 GTGGACATGAAGGATGCGGAAGG - Intronic
1133576780 16:7099218-7099240 GTGTGGATGTAGAATGAGGGAGG + Intronic
1134539588 16:15054200-15054222 GTGTAAGTGAAGAAGGATGCAGG - Intronic
1136318713 16:29468721-29468743 GTGAAGACAAAGAATGAGGAGGG + Intergenic
1136433285 16:30208065-30208087 GTGAAGACAAAGAATGAGGAGGG + Intronic
1137940181 16:52676427-52676449 GTATGAATGATGAATCAGGAAGG - Intergenic
1140651572 16:77094134-77094156 GTGTACATGAAGAGGAAGGAAGG - Intergenic
1140925068 16:79574791-79574813 ATGTCAATGAAGAACTAGGAAGG + Intergenic
1141726536 16:85792980-85793002 GAGTAAGTGCAGAATGCGGAAGG - Intronic
1142571319 17:876669-876691 GTATAAATGAGGAATGAAGATGG - Intronic
1143495506 17:7310098-7310120 GTGAAAACCAAGAATAAGGAAGG - Intronic
1143993614 17:10988128-10988150 GTGTAGAAGAGGAATAAGGAAGG - Intergenic
1144083177 17:11783203-11783225 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1144497744 17:15759272-15759294 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144629542 17:16863760-16863782 GTGTATTTGAAGAAAGAGGGTGG - Intergenic
1144645824 17:16972719-16972741 GTGTAAAACAAGGATGAGGTCGG + Intergenic
1146413263 17:32607712-32607734 TTGTAAATGAAGAATAAAGTTGG + Intronic
1146551625 17:33785205-33785227 GTGAAGATGAAGAAAGAAGATGG + Intronic
1146745296 17:35323548-35323570 GTGCCAAAGAAGAATGAGGTTGG + Intergenic
1147484756 17:40801861-40801883 ATGGAAGTGAAGAAGGAGGATGG + Intergenic
1148481449 17:47962126-47962148 GTCTGAATGAAGAACGTGGAAGG - Intergenic
1148528487 17:48365908-48365930 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1148883307 17:50749843-50749865 CTGCAAATGAAGAATGAAAAAGG - Intronic
1149507822 17:57210677-57210699 GTGTAAAAGAAAAAAGAGGTGGG + Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1151709417 17:75793656-75793678 CTGTGAATAAAGAATAAGGAAGG - Intronic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1155237582 18:23836496-23836518 GTAGAAATGAAGAAGGAAGAAGG + Intronic
1155844307 18:30686355-30686377 GAGGAAAAGAAGAAAGAGGAGGG + Intergenic
1156132811 18:33998875-33998897 ATGTAAGTGAAGCATGTGGAAGG - Intronic
1156163027 18:34383181-34383203 GTGTAAATCAGGAATCAAGAGGG - Intergenic
1156217188 18:35011603-35011625 GTGTAAAGGAAAGATCAGGAAGG + Intronic
1156284402 18:35676651-35676673 GAATAAAGGAAGAAAGAGGAGGG + Intronic
1157342360 18:46790619-46790641 GTGTTCATTAAGAATGAGAAAGG - Intergenic
1157479185 18:48042193-48042215 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1158036351 18:53035950-53035972 GTGACAATGATGAATGAGCATGG - Intronic
1158396737 18:57084942-57084964 GAGTAAATGAGGCATGAGGATGG + Intergenic
1158403418 18:57140911-57140933 GTGTCAGTGAAGAAGGAGGAAGG + Intergenic
1159392442 18:67810377-67810399 GAGAAAATGAAAAATAAGGAAGG - Intergenic
1159469435 18:68832578-68832600 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1160259072 18:77274256-77274278 GTGTGAATGAAGAATGACCTGGG + Exonic
1162576382 19:11501474-11501496 GGGGAAATGAAGAAGGAGGCTGG - Intronic
1166114165 19:40642543-40642565 CTGTAAATAAAGAAGGAAGAGGG + Intergenic
1168382533 19:55936198-55936220 CTGAAAAGGAGGAATGAGGAGGG + Intergenic
1168399753 19:56078551-56078573 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
926259169 2:11241370-11241392 GTGTAACTGAAGTCTGAGAAAGG + Intronic
926646503 2:15295240-15295262 GTGTATAGCAAGAATGAGCATGG + Intronic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927037232 2:19190756-19190778 GTGTTAATGAAGAAAAAGAAAGG - Intergenic
928275663 2:29898008-29898030 GTGAAAATGAAGTTGGAGGATGG + Intronic
929083386 2:38144274-38144296 ATGTATATGGGGAATGAGGAAGG - Intergenic
929910954 2:46089185-46089207 ATGTAGAATAAGAATGAGGAGGG - Intronic
930342770 2:50138150-50138172 TTGTAAATGAAATATGTGGAAGG - Intronic
930398944 2:50858723-50858745 TTTTAAATGAAAAATCAGGAGGG + Intronic
932168538 2:69531866-69531888 CTTTAAGTGAAGAATGAGGAGGG - Intronic
933371803 2:81424318-81424340 GAGTAAAGGAAGAATCAGTAAGG - Intergenic
933409886 2:81911744-81911766 GAGGAAAGGAAGAAAGAGGAGGG - Intergenic
934324750 2:92001952-92001974 GTGAGAATGAAGAATAAGGTGGG + Intergenic
934463128 2:94232657-94232679 GTGAGAATGAAGAATAAGGTGGG + Intergenic
934987295 2:98896824-98896846 GTGGAAAAGAGGGATGAGGAAGG + Intronic
935609629 2:105007808-105007830 GTGGAAAACAAGGATGAGGAAGG + Intergenic
935686798 2:105690844-105690866 GTGTAAGAGAAAAATGAGTATGG + Intergenic
935951575 2:108334595-108334617 GTGTAAATGAAACATAAGAAGGG + Intergenic
936268604 2:111030929-111030951 GAGTAAAATAAGAATGAAGAAGG - Intronic
936474166 2:112825002-112825024 TGGGAAATGAAGAATGAGGTGGG + Intergenic
936661694 2:114550112-114550134 ATTTAAATGAAAAATGAGGGAGG - Intronic
937467586 2:122148241-122148263 TAGTAAATGAAGAAAGAAGAAGG + Intergenic
938717351 2:134032949-134032971 GAGTAAGTGGAGAGTGAGGATGG + Intergenic
939642830 2:144661190-144661212 GTGAAGTTGAAAAATGAGGAAGG + Intergenic
941406673 2:165098572-165098594 GTGGAAAAGAGGGATGAGGAAGG - Intronic
942018346 2:171840921-171840943 GATTAAATTAAGAATGAGAATGG + Intronic
942168377 2:173264861-173264883 GGGGAAATGGAGAAAGAGGAAGG + Intronic
942668003 2:178342708-178342730 TTTTAAATGAAGTAAGAGGAAGG + Intronic
942756311 2:179345428-179345450 TTGTACAAGAAGAAGGAGGAAGG - Intergenic
943181336 2:184546039-184546061 GTGACAATGGAGAATGAGGTTGG - Intergenic
943454522 2:188087950-188087972 GTGTAAAAGAAGCATGAGTAGGG + Intergenic
943566908 2:189526780-189526802 GTGTTGATGGAGAAGGAGGAGGG - Intergenic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
946185417 2:217978279-217978301 GGATAAATGGAGAATGAGGTCGG - Intronic
946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG + Intergenic
946973693 2:225123427-225123449 GAGGAAATGAAGAAAGAGAAAGG - Intergenic
947899410 2:233708350-233708372 GTTTAAATGAAGAATTAATAAGG - Intronic
947992935 2:234501056-234501078 CTGTAAATGGAGAATGGGGCTGG + Intergenic
948768958 2:240237679-240237701 GTGTAAATGCAGTAAGAGGCAGG - Intergenic
1169727900 20:8755815-8755837 TTGTAAAGGATAAATGAGGAGGG + Intronic
1169847719 20:10013526-10013548 GTTTCAATGAAGAATGAAGATGG + Intronic
1170225559 20:13988143-13988165 GTGTATATGAGGTATGAGGTGGG + Intronic
1171093127 20:22305024-22305046 ATGGAAAAGAAGAAAGAGGAAGG - Intergenic
1172083128 20:32358316-32358338 GTGTGTGTGAAGAGTGAGGAGGG - Intergenic
1173909430 20:46653431-46653453 GTGGAAAAGAGGGATGAGGAAGG - Intronic
1176336195 21:5602159-5602181 GCGTAACTGCAGAATGAGGCGGG + Intergenic
1176391562 21:6218789-6218811 GCGTAACTGCAGAATGAGGCGGG - Intergenic
1176469857 21:7097385-7097407 GCGTAACTGCAGAATGAGGCGGG + Intergenic
1176493418 21:7479163-7479185 GCGTAACTGCAGAATGAGGCGGG + Intergenic
1176507224 21:7659220-7659242 GCGTAACTGCAGAATGAGGCGGG - Intergenic
1176581080 21:8527077-8527099 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1176594174 21:8675698-8675720 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1177474971 21:21608364-21608386 CTGTGAATGAAGATTCAGGAAGG - Intergenic
1178226277 21:30722866-30722888 TTGTAAAAAGAGAATGAGGATGG - Intergenic
1179343116 21:40531332-40531354 GGGTGAATGAAGAATGAGACAGG - Intronic
1180277027 22:10652828-10652850 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1180861083 22:19083388-19083410 GTGAAGAAGAGGAATGAGGAGGG - Intronic
1181489092 22:23250448-23250470 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1182105026 22:27682894-27682916 GTGGAAATTAAAAAGGAGGAGGG + Intergenic
1182791109 22:32953830-32953852 ATGTTGATGAAGAAGGAGGAGGG - Intronic
1184617982 22:45651021-45651043 GTGTGAATGAACAAAGAGAATGG - Intergenic
1184680014 22:46066420-46066442 CTTTAAATGAGGAATGAGAAAGG - Intronic
1184980226 22:48090411-48090433 TTGTAAAAGAAGAATGAGAATGG + Intergenic
949444557 3:4120007-4120029 GGCTAAATTAAGAATCAGGAGGG - Intronic
949530634 3:4951773-4951795 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
950251335 3:11468276-11468298 GCGTAAGTGAAGAATGAGAATGG + Intronic
950358820 3:12435812-12435834 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
950832084 3:15885040-15885062 GTGGGAAGGAAGAAAGAGGAAGG + Intergenic
951305551 3:21056519-21056541 AAGAAAATGAAAAATGAGGAGGG + Intergenic
953199450 3:40765863-40765885 GTCTAAATGAAGAAAAAGAAAGG + Intergenic
953764285 3:45723667-45723689 GTGGAAATGAACAGTGATGATGG - Intronic
953781386 3:45874128-45874150 ATATTAATGAAGAATGAAGATGG - Intronic
954092922 3:48299931-48299953 GTGGATATGAAGAGTGAGGGAGG - Intronic
956829663 3:73033615-73033637 CTGGAAATGAATAATGATGATGG - Intronic
957034967 3:75285557-75285579 CTGTAAATGCAGAATGAGCAGGG + Intergenic
957157074 3:76557843-76557865 CTGAAAAGCAAGAATGAGGAAGG - Intronic
957396146 3:79641228-79641250 GTAAAAATGAAGAATGAAAAGGG - Intronic
958013390 3:87910092-87910114 ATGTATATGAAGAATAAGAAGGG - Intergenic
959007842 3:101040526-101040548 GTGTATCTGAGGAATGAGGAGGG - Intergenic
959015821 3:101132886-101132908 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
959800488 3:110488435-110488457 GAGCAAATGAAGAATGAAGTAGG + Intergenic
960357751 3:116674360-116674382 GTGTACATGCAGAAGGAGGTGGG - Intronic
960659657 3:120043850-120043872 GTTTAGATGGAGAAGGAGGAGGG - Intronic
961078855 3:124007143-124007165 CTGTAAATGCAGAATGAGCAGGG + Intergenic
961304623 3:125949298-125949320 CTGTAAATGCAGAATGAGCAGGG - Intergenic
962013579 3:131418240-131418262 CTGTATCTGTAGAATGAGGAAGG - Intergenic
963642087 3:147873475-147873497 GGGTAAATCAAGACTGAGAAAGG + Intergenic
964324225 3:155529109-155529131 ATGTAAATGAAGAATGATCCAGG + Intronic
964894664 3:161581195-161581217 GTGTTATGGGAGAATGAGGAAGG - Intergenic
965044475 3:163557946-163557968 GTATAAATCAAGACTGGGGATGG - Intergenic
965391298 3:168107659-168107681 CTGTAAATGACTAATAAGGATGG + Intergenic
966496028 3:180581730-180581752 GTTAAAATGAAGAATGAGTTTGG - Intergenic
967420308 3:189265143-189265165 TTGTATATGAATAAGGAGGAAGG + Intronic
967527159 3:190508302-190508324 TTTTAAATGGAGAATGAGGGAGG - Intergenic
967935761 3:194726129-194726151 GTGTAAATGCAGACTTGGGACGG - Intergenic
969341554 4:6544993-6545015 GTGTAAATGCAGTGTCAGGAAGG + Intronic
970080155 4:12273767-12273789 TTGTAAATGAGGTATGAAGAGGG + Intergenic
970300336 4:14674700-14674722 GGGTAATTGAATCATGAGGATGG - Intergenic
970377255 4:15471452-15471474 GTGGAAAAAAGGAATGAGGAGGG - Intronic
971688771 4:29805312-29805334 GTGTAAGATAAGAAAGAGGAAGG - Intergenic
972067999 4:34976184-34976206 ATGGAAATGGAGACTGAGGAGGG + Intergenic
972234854 4:37120061-37120083 GTGAAAATGGAGAGTGAGGATGG - Intergenic
972636239 4:40886533-40886555 CTGTAAAAGAATAAGGAGGAAGG + Intronic
972910229 4:43806960-43806982 GTGTAAATAAAGTATAAAGAGGG - Intergenic
972961272 4:44455123-44455145 TTATAAATGTAGAATGTGGATGG + Intergenic
973128324 4:46617322-46617344 GTGGAAAAGAAGAATGAGGAAGG + Intergenic
974858867 4:67495525-67495547 GTGGAAAAGAGGGATGAGGAAGG + Intronic
975241955 4:72070407-72070429 TTTTAAAGGAAAAATGAGGAGGG + Intronic
975362965 4:73493248-73493270 TTTTAATGGAAGAATGAGGAAGG + Intronic
975612027 4:76213250-76213272 GGGTTAAAGAAGGATGAGGAAGG - Intronic
976476708 4:85492250-85492272 GTGTAACTGAAGAAGAAAGAGGG - Intronic
978752621 4:112268806-112268828 ATGTGAAGGAAGCATGAGGAGGG + Exonic
978806008 4:112801103-112801125 GTGTGAATTCAGAATGAGGAGGG + Intergenic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978978769 4:114915562-114915584 GTGTTAAAGAAAAATCAGGAAGG - Intronic
979210527 4:118095708-118095730 GTGCAACTGATTAATGAGGATGG - Intronic
979687252 4:123524506-123524528 GAGGAAAGGAAGAAAGAGGAAGG - Intergenic
980411312 4:132423150-132423172 GGGTAAAAGAGGAATGAGGTAGG + Intergenic
980597735 4:134976506-134976528 GTTTAAAGGAAGAATAAGGCTGG + Intergenic
981235787 4:142414399-142414421 GTGTCACTGAAGAATCAAGAGGG + Intronic
981321354 4:143395839-143395861 GAGTAAGTGAAGAAAGAAGAAGG + Intronic
983699746 4:170577905-170577927 GGGTAATTGAATCATGAGGATGG - Intergenic
983843279 4:172482748-172482770 GTGGAAAAGATGAATGATGAAGG - Intronic
983867524 4:172786789-172786811 GTATAAATGAAAAGTGATGAAGG + Intronic
984154842 4:176183428-176183450 ATGTAAATGAAGATACAGGATGG - Intergenic
985348726 4:189035326-189035348 GAGTAACTGGAGAATGAGGTGGG - Intergenic
985362578 4:189191537-189191559 GTTCACATGAGGAATGAGGATGG + Intergenic
986656724 5:10020186-10020208 TTGTAAAATAGGAATGAGGATGG + Intergenic
986985820 5:13500139-13500161 GTGCAATTGTATAATGAGGATGG - Intergenic
987154045 5:15070003-15070025 TTGTAAAGGAAAAATGAGGAGGG + Intergenic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
988011882 5:25499125-25499147 GTGTGTATGAAGAATGAGACTGG + Intergenic
988203461 5:28100061-28100083 GTGTAAATGAAGATTGTCAAGGG + Intergenic
988921564 5:35947088-35947110 TTTTAAATGAAAAATGAAGAGGG + Intergenic
989177638 5:38544337-38544359 GTGTATGTGAAGAGTGTGGAAGG - Intronic
989225009 5:39016628-39016650 AAATAAATGAAGAATGAGAAGGG + Intronic
989609015 5:43273662-43273684 CTGGAAAAGCAGAATGAGGAGGG - Intronic
990550741 5:56875623-56875645 GTGGAAAAGGAGGATGAGGAAGG - Intronic
990805460 5:59655679-59655701 GTGGAAAAGAGGGATGAGGAAGG + Intronic
991202891 5:64014769-64014791 GTGTCTATGAAGAAGGAAGAGGG - Intergenic
992028569 5:72696808-72696830 GTGTAAAAGATGAATAAGTAAGG + Intergenic
992875388 5:81049480-81049502 GAGTAAAGGGAGAATCAGGAGGG - Intronic
993139645 5:84015297-84015319 GTTCAAAGGAAGAATGAGAAAGG + Intronic
993487691 5:88506658-88506680 GTGTAAAGAAAGTAGGAGGAGGG - Intergenic
994641009 5:102410065-102410087 GTGTCCAGGAAGAATGAGGTAGG + Intronic
995630318 5:114125860-114125882 GTTAAAATGAAGCATTAGGATGG - Intergenic
996447436 5:123571970-123571992 TTTTAAAGGAAAAATGAGGAGGG + Intronic
996672253 5:126132327-126132349 GAGTAAAACAAGAAAGAGGAGGG + Intergenic
996730786 5:126715570-126715592 GACTAAATAAAGACTGAGGAAGG + Intergenic
997188581 5:131907094-131907116 GAGTCAATGAAGAATTAAGAAGG + Intronic
997474510 5:134134839-134134861 GAGTAAATGAAGAAGGATGCTGG + Intronic
997696303 5:135863795-135863817 GTGTTACTGAAGTAGGAGGAAGG + Intronic
998374331 5:141681197-141681219 GGCTAATTGAAGAATAAGGATGG + Intronic
998708088 5:144787953-144787975 GTGTTCATGAAGAAAGAAGATGG + Intergenic
999632387 5:153584243-153584265 GGGTAAGTGATGGATGAGGAAGG - Intronic
1000080721 5:157843591-157843613 TTTTAAATGAAGAGTGAGAAGGG - Intronic
1001263816 5:170257204-170257226 GTGCAAATGAAGGATGGGGTTGG + Intronic
1001831059 5:174789795-174789817 GTGTATAGGAGGAATGAGAATGG + Intergenic
1003020431 6:2504832-2504854 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003020438 6:2504868-2504890 GAGGAGATGAAGGATGAGGAGGG - Intergenic
1003253066 6:4449443-4449465 GTGGAAAAGAAGGATGAGGAAGG + Intergenic
1003901248 6:10657808-10657830 GTCTAAATGAAGCAAGAGCAGGG - Intergenic
1004573505 6:16870622-16870644 ATGCAAATAAAGAATGAGGGAGG - Intergenic
1004604795 6:17183913-17183935 GTGTAAATGAAGGAAGCGGCAGG - Intergenic
1004963712 6:20822640-20822662 AGGTAAATGAATTATGAGGATGG + Intronic
1005213531 6:23497572-23497594 GTCTAAATGAAGCATGTGGAAGG + Intergenic
1006332641 6:33403412-33403434 GTGTAAAGGGAGAATGATGGAGG + Intronic
1007634808 6:43292961-43292983 GTGGAAGAGAAGAGTGAGGAGGG + Intergenic
1007754240 6:44088544-44088566 ATTTAAATGAAGAAGGAGGCTGG - Intergenic
1008117604 6:47570281-47570303 GATTTAATGAAGAAGGAGGAGGG + Intronic
1008521690 6:52367726-52367748 GTGTAGAGGAAAGATGAGGATGG + Intronic
1009192961 6:60651704-60651726 GTGGAAAAGAGGGATGAGGAAGG + Intergenic
1010715222 6:79221362-79221384 GTGTAAAGAAAGAATGGGGATGG - Intronic
1010751360 6:79619390-79619412 GTAACAATAAAGAATGAGGAAGG - Intergenic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1010935351 6:81853914-81853936 GTGTAAATATGGAATGGGGAAGG + Intergenic
1012042581 6:94228061-94228083 GGGTTAATGAAGAAAGAGTAAGG - Intergenic
1012289691 6:97437480-97437502 GTGTGCATGATGAAGGAGGAAGG - Intergenic
1013668403 6:112371839-112371861 TTGTCAATGAAGAATCAGTAGGG - Intergenic
1013670802 6:112400230-112400252 GTGGAATTAGAGAATGAGGAAGG - Intergenic
1013724477 6:113076782-113076804 GTGTAAATGATGGATGTAGAGGG + Intergenic
1013777890 6:113699362-113699384 TTGTAAAGGAAAAATGAAGAGGG + Intergenic
1014013950 6:116508160-116508182 GAATAAATGAAGAATGAATAAGG - Intronic
1014090898 6:117402451-117402473 TTGGAAATGAAGAGTGAAGAGGG - Intronic
1014567947 6:122973866-122973888 GAGGAGACGAAGAATGAGGATGG + Intergenic
1014992261 6:128095492-128095514 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1015506777 6:133996719-133996741 GTGAACTTGAAGAATGAGGAAGG - Intronic
1015537241 6:134278949-134278971 GTGTAAATGGAGAAGGAAAAAGG + Intronic
1015712269 6:136155248-136155270 GTGTAAATGAAGAAAAAAGTTGG - Intronic
1016359527 6:143252476-143252498 GAATAAATGGAAAATGAGGATGG + Intronic
1016405875 6:143730103-143730125 TTTTAAATGAAGAATAAGGTTGG - Intronic
1016884546 6:148947066-148947088 GTGTAAATTAAGAATAATGTGGG + Intronic
1017185978 6:151600884-151600906 GGGTAAATGAAGAATGACTGTGG - Intronic
1018482212 6:164202705-164202727 GTATAGATGAAGAATGACGTGGG + Intergenic
1018592003 6:165436450-165436472 GGTTAAATGAACAAGGAGGAAGG + Intronic
1018920673 6:168170353-168170375 TTTTAAAGGAAAAATGAGGATGG - Intergenic
1019491558 7:1316195-1316217 TAGGAATTGAAGAATGAGGATGG + Intergenic
1020890698 7:13874440-13874462 GTGTCAGTGCAGAATGTGGAAGG + Intergenic
1021381108 7:19967509-19967531 GTGAAAATGAAGAGGGATGACGG - Intergenic
1022235392 7:28455756-28455778 GTGTAAAGGAGGAATGAGAGAGG + Intronic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1022296817 7:29063261-29063283 GTTGAAATGATGAATGAGAAAGG - Intronic
1022543287 7:31159949-31159971 GTGGAAATGAAAAATAATGAGGG - Intergenic
1023039091 7:36156530-36156552 GTGTGAATGGGAAATGAGGAGGG + Intronic
1023225787 7:37967427-37967449 GACTAAATGCAGAATGAGAATGG - Intronic
1024214917 7:47240515-47240537 GTGAAAATGGAGAATTGGGAGGG - Intergenic
1024806511 7:53147815-53147837 GTGGAAAAGAGGGATGAGGAAGG - Intergenic
1025289461 7:57701820-57701842 AAGTAAATGAAGAAAGAGTAGGG + Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1027261258 7:76466043-76466065 GGGGAAAAGGAGAATGAGGAAGG + Intronic
1027312642 7:76964151-76964173 GGGGAAAAGGAGAATGAGGAAGG + Intergenic
1027556303 7:79668819-79668841 GTCCAAATGAAAAATGATGATGG - Intergenic
1027737508 7:81952714-81952736 GTGTAAAGGAAGAAGAAGAAAGG - Intronic
1027747149 7:82091182-82091204 GTGTAAATGAAAGATGAATAAGG + Intronic
1028445405 7:90916188-90916210 TTGGAAGTGAAGAATGAGGCTGG + Intronic
1028715998 7:93969495-93969517 GTGGATATGAATAATCAGGAAGG + Intronic
1029918280 7:104234802-104234824 TTCTAATTGTAGAATGAGGAAGG - Intergenic
1029962318 7:104700987-104701009 GTGTAAACAAAGAAAGATGAAGG - Intronic
1030814754 7:114022439-114022461 GTGCAGATGATGAATGATGAGGG - Intronic
1030899316 7:115103017-115103039 GTGCAAATGCTGAATGAAGAAGG + Intergenic
1031020165 7:116619334-116619356 GTGTAATTGGAACATGAGGATGG - Intergenic
1032565615 7:132939687-132939709 TTGGAAAGGAAGAATGAAGAGGG + Intronic
1032790892 7:135241672-135241694 GTGAAAATGTACAAGGAGGAGGG - Intronic
1032955373 7:136964593-136964615 GTGCAAAGGAAAAAGGAGGAAGG - Intronic
1033724635 7:144101404-144101426 GAGTAAATCAAAAAAGAGGATGG - Intergenic
1033919640 7:146374025-146374047 GTGTCAACCAAGAAAGAGGAAGG + Intronic
1033932318 7:146539280-146539302 GGGTTTCTGAAGAATGAGGAAGG + Intronic
1034902923 7:154918735-154918757 GTGTGAATGAAGAATGAGGAGGG + Intergenic
1035274950 7:157742533-157742555 GAGTAAACGATGAATGTGGATGG + Intronic
1036059166 8:5295674-5295696 GTGTAAAGGAAAAATCAGGCAGG + Intergenic
1038226926 8:25666218-25666240 GGGTAGATGAAGAATGGGAAAGG - Intergenic
1038548539 8:28444925-28444947 GTGAAAATGAAGAAATAGGCCGG - Intronic
1038690294 8:29755193-29755215 GGGAAAATTAAGAATGATGACGG + Intergenic
1038764493 8:30414746-30414768 GGGAAAATAAAGTATGAGGAAGG + Intronic
1039201592 8:35099994-35100016 GTCAAAATGAAGGAAGAGGAGGG - Intergenic
1040861533 8:52004442-52004464 GTCTAAATAAATAATGTGGAAGG + Intergenic
1041326050 8:56665811-56665833 GTGTAGATGAATGATGAAGAGGG + Intergenic
1041428445 8:57750116-57750138 GTGTAAATAAATAATGAGGAAGG + Intergenic
1041536375 8:58930496-58930518 GTGTTAATGCTGAATGGGGAAGG + Intronic
1041718460 8:60953247-60953269 GTGTACATAAAGCATGAGCAGGG - Intergenic
1042100564 8:65271510-65271532 GTGAAGATGAAAAAGGAGGACGG + Intergenic
1042588765 8:70373946-70373968 TTGAAAATGAAGAATAAGGTTGG - Intronic
1043047847 8:75350510-75350532 TAGTACATGAAGAATGATGATGG - Intergenic
1043648421 8:82554359-82554381 GTTTAAATGAAGTAAGAGAATGG - Intergenic
1043917368 8:85938490-85938512 CTGTTAAAGAAGAAAGAGGAAGG - Intergenic
1044298059 8:90551355-90551377 TTGTAAAACAAGAATGATGATGG - Intergenic
1045150748 8:99404701-99404723 ATATAAATCAAGAATTAGGAAGG + Intronic
1046183392 8:110682222-110682244 GAGAAAATTAAGATTGAGGAGGG - Intergenic
1046358899 8:113124606-113124628 GGATAAATGAAGAATGACTAAGG + Intronic
1046676146 8:117110856-117110878 CTGTAAAGCAAGAAAGAGGATGG - Intronic
1047887550 8:129268565-129268587 GAGGAAATGAAGAATGAAAAAGG - Intergenic
1048032570 8:130646458-130646480 GAGGAAATGAGGCATGAGGAAGG - Intergenic
1050765919 9:9133805-9133827 GTGCACATGTAGAATGAGAAAGG + Intronic
1053459147 9:38255154-38255176 AGGTAACTGAAGCATGAGGAAGG - Intergenic
1054888660 9:70228323-70228345 GTGTAAATTGACATTGAGGATGG - Intergenic
1055049825 9:71967450-71967472 ATGAAAATGAAAAATGAGGTTGG - Intronic
1055134111 9:72807309-72807331 GTGTAAATGACGAATTACAAAGG - Intronic
1055862191 9:80765028-80765050 GTGTAAAAGCAGAATGAGCAAGG - Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1056831019 9:89917684-89917706 TTGAAAATGAGGAATGTGGATGG - Intergenic
1056861309 9:90185637-90185659 TTGAAAATGAAGAATAAAGATGG - Intergenic
1056878272 9:90360244-90360266 TTGAAAATGAGGAATGAGGTGGG - Intergenic
1057587938 9:96346371-96346393 GTGGAAATGATGAACGAGAAGGG + Intronic
1057737152 9:97673778-97673800 TTGAAAATGAAAGATGAGGAAGG + Intergenic
1058069276 9:100585199-100585221 GAGGGAATGAAGAAGGAGGAGGG + Intronic
1058348068 9:103988457-103988479 GTGCAAAGGTAGAATGAGGTGGG + Intergenic
1058568451 9:106312800-106312822 GAGAAAATGAAGAATGAGAAGGG + Intergenic
1059577671 9:115508108-115508130 GTGTAAGAGAAGAAAGAGAAAGG + Intergenic
1059614134 9:115930582-115930604 ATTTAAATGAAGATTGATGAGGG - Intergenic
1059632419 9:116138917-116138939 GTGTCACTGGAGAATGAGAAGGG - Intergenic
1059687648 9:116652792-116652814 GTGCACATGAAGAAAGAGGCAGG - Intronic
1059770658 9:117421091-117421113 GTGGAAATGAAGAACGACAATGG - Intergenic
1059986026 9:119821484-119821506 ATGAAAATAAAGGATGAGGAAGG - Intergenic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1203611094 Un_KI270749v1:5120-5142 AAGTAAATGAAGAAAGAGTAGGG - Intergenic
1203624309 Un_KI270749v1:155932-155954 GTGAGAATGAAGAATAAGGTGGG + Intergenic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1186299602 X:8185419-8185441 GGGTGAATGCAGAATGAGGATGG + Intergenic
1186927547 X:14351889-14351911 GTGGAAATGCAGAAGCAGGAGGG + Intergenic
1187185927 X:16985483-16985505 GTGTAAATGAAGCATGATATTGG - Intronic
1187266872 X:17741735-17741757 GTGGAAAAGAGGGATGAGGAAGG + Intronic
1188930155 X:36099118-36099140 TTATAAATGAAGAATAAGGTGGG + Intronic
1190171003 X:48111627-48111649 CTGTAAATGGAGAAGGAGCAGGG + Intergenic
1190534266 X:51409846-51409868 GTGTGAATAAAGCATGAGCAGGG - Intergenic
1192315196 X:70045796-70045818 GAGTAAACCAAGAAAGAGGAAGG + Intronic
1193471768 X:81913205-81913227 GTGGAGATGAAGAATGAGTTAGG - Intergenic
1193731656 X:85109630-85109652 GTGTAAGTGAAAAATGAGGACGG - Intergenic
1193775212 X:85633216-85633238 ATATAAATAAAGAATGATGATGG + Intergenic
1193980471 X:88175992-88176014 GGTTGAATAAAGAATGAGGAGGG - Intergenic
1194751505 X:97689813-97689835 GTGTAAACCAAGAAAGCGGAAGG + Intergenic
1195625345 X:107000361-107000383 GCGTGAATGAAGCAAGAGGAGGG + Intergenic
1196005886 X:110836761-110836783 ATGAAAAAGAGGAATGAGGAGGG + Intergenic
1196227825 X:113187792-113187814 GTTGAAATGAAGAATGATAAAGG + Intergenic
1196308210 X:114128844-114128866 GTGTAAATAAAGACAGAGAAAGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197763234 X:130042383-130042405 GTCTAAATGAAGACTGGGCATGG - Intronic
1198367000 X:135951218-135951240 CTGGAAACGAAGGATGAGGAAGG - Intergenic
1201148157 Y:11077858-11077880 GTGAAAATGCAGTCTGAGGATGG + Intergenic