ID: 1097882011

View in Genome Browser
Species Human (GRCh38)
Location 12:64694770-64694792
Sequence CTGTAGTTCTGGAAGGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 1, 2: 2, 3: 19, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097882011_1097882015 2 Left 1097882011 12:64694770-64694792 CCTTCAGCCTTCCAGAACTACAG 0: 1
1: 1
2: 2
3: 19
4: 232
Right 1097882015 12:64694795-64694817 TTTCTTGCGCATCTTGGACAAGG 0: 1
1: 0
2: 0
3: 10
4: 112
1097882011_1097882014 -4 Left 1097882011 12:64694770-64694792 CCTTCAGCCTTCCAGAACTACAG 0: 1
1: 1
2: 2
3: 19
4: 232
Right 1097882014 12:64694789-64694811 ACAGAATTTCTTGCGCATCTTGG 0: 1
1: 0
2: 0
3: 9
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097882011 Original CRISPR CTGTAGTTCTGGAAGGCTGA AGG (reversed) Exonic
900934567 1:5757017-5757039 CTGAAGCTCTGAAAGGCTAAGGG + Intergenic
902242643 1:15099163-15099185 AAGTGGTTCTGGGAGGCTGATGG + Intronic
902370748 1:16005419-16005441 CTGTGTTCCTGGAAGGCAGATGG + Intronic
902625559 1:17674218-17674240 CTGGAGCCCTGGAAGGCTCAGGG - Intronic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
905386333 1:37606737-37606759 CTTAAGTTCTGGAAGGCTCTAGG + Intergenic
906203899 1:43976766-43976788 CTGTGGCACTGAAAGGCTGAGGG - Exonic
910763601 1:90759002-90759024 CTCTAGTTCTTGATGGCTGATGG - Intergenic
911345624 1:96693381-96693403 TTATAGTTCTGGAAGTCAGAAGG - Intergenic
911379066 1:97089583-97089605 AAGAAGTACTGGAAGGCTGATGG - Intronic
913955424 1:143285927-143285949 CTGTATTTCTGAATGCCTGATGG - Intergenic
915019260 1:152763936-152763958 ATCTAGTTCTGCCAGGCTGATGG + Intronic
915607661 1:156963297-156963319 ATGTCGCTCTGGAAGGCAGAAGG + Exonic
915684243 1:157615606-157615628 CTGAACTTCTGGAACCCTGAAGG + Intergenic
916429246 1:164711755-164711777 GTGTACATGTGGAAGGCTGAAGG + Intronic
916826453 1:168446323-168446345 TCATAGTTCTGGAAGGCTGGAGG - Intergenic
918045626 1:180939305-180939327 CTGAAGTTCTGGAGAGCAGATGG - Intronic
918186331 1:182130697-182130719 TTTTAGACCTGGAAGGCTGAGGG + Intergenic
921524747 1:216202758-216202780 CTGTAGTTGAGGAAGCGTGATGG - Intronic
922152945 1:223020831-223020853 CTGGAGCTCTGGATGGCTGCTGG - Intergenic
922852285 1:228743360-228743382 CTGACGTTCTGGAAGGATGAGGG - Exonic
923955903 1:239020373-239020395 CTTTGGTACTGGATGGCTGAAGG - Intergenic
1063026722 10:2186156-2186178 CTGTTTTTCTGGAAGTCTGATGG + Intergenic
1063394805 10:5677026-5677048 GTGTAGTTTTGCCAGGCTGATGG + Intergenic
1068388042 10:56358452-56358474 CTGTATTTCTCCAAGGCTGTTGG - Exonic
1069870924 10:71532481-71532503 CTCTGGATCTGGAAGGCTAAGGG - Intronic
1070278433 10:75030265-75030287 CTGCAGTTTGGCAAGGCTGAAGG - Exonic
1072476306 10:95763663-95763685 TTACAGTTCTGGAAGTCTGAAGG - Intronic
1072745976 10:97939458-97939480 CTGTAGTCCTGGGAGGCAGTGGG - Intronic
1073318073 10:102596851-102596873 CCATTGTGCTGGAAGGCTGATGG + Intronic
1074478664 10:113797355-113797377 CTGTATTTCTGCAAGGCGGTTGG + Intergenic
1077758592 11:5064884-5064906 CTGGAGTTCTGGAAGCCTGGGGG + Intergenic
1078633747 11:13030073-13030095 CTGTAGTTGTAAAAGGATGAAGG + Intergenic
1079505278 11:21146374-21146396 CTTTAGGTCTGAAAGGATGAGGG + Intronic
1080344632 11:31310788-31310810 CTCTGTTTCTGGAAAGCTGAAGG - Intronic
1080829582 11:35878932-35878954 CAGTAGTTGCTGAAGGCTGAGGG - Intergenic
1081305155 11:41502785-41502807 CTGTAGCTCAGGGAGGCTGAAGG - Intergenic
1082591012 11:55009676-55009698 CTGTGTTTCTGGACTGCTGAAGG + Intergenic
1083235216 11:61346645-61346667 CTGTAGTTCTGGAAGCTTGGTGG - Exonic
1084354190 11:68626319-68626341 CTGAAGTTCTTGAATGCTGGAGG - Intergenic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1085027642 11:73245952-73245974 CAGTAGCTCAGGCAGGCTGAGGG - Intergenic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1086774684 11:90815476-90815498 CTATAGTTCTGGAGGCTTGATGG + Intergenic
1087568632 11:99895726-99895748 CTGCTGTTCTGGAAGCCCGAGGG - Intronic
1088551861 11:111021378-111021400 CTGGAATCCTGGCAGGCTGAGGG + Intergenic
1089098845 11:115942914-115942936 CTGTTGTTTTGGAGAGCTGAAGG - Intergenic
1089998733 11:122934503-122934525 CTGGTCTTCTGGAAGGTTGATGG - Exonic
1091796911 12:3302756-3302778 CTGTGGATATGGAGGGCTGATGG + Intergenic
1093615647 12:21220157-21220179 CTTGAGTTCTGGAAGGATGGTGG + Intronic
1095712979 12:45309726-45309748 CTGAAGATCTGGAAGTCTGTGGG - Intronic
1097882011 12:64694770-64694792 CTGTAGTTCTGGAAGGCTGAAGG - Exonic
1100391006 12:94146902-94146924 CAGGAGTTCTGGAAGGCTTAAGG - Intergenic
1102797844 12:115704301-115704323 CTGTACTTCTGGGAGCCTCAGGG + Intergenic
1103539975 12:121659245-121659267 CTGTTGGTCAGGAAGGCTGAGGG + Exonic
1103665281 12:122559231-122559253 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
1105783404 13:23724143-23724165 CTGAAGACCTGGAAAGCTGAGGG + Intergenic
1106756193 13:32825351-32825373 CTGTAGATCTGGAAGGCTGATGG - Intergenic
1107515276 13:41123029-41123051 CTGTAGTTCTGGAAGCCTCTGGG + Intergenic
1108349391 13:49577195-49577217 ATTTAGAACTGGAAGGCTGAAGG + Intronic
1109623259 13:64939323-64939345 ATGTGGTTTTGGAGGGCTGAAGG + Intergenic
1110688684 13:78405513-78405535 CTGAAGTCCTGGAAAACTGAAGG + Intergenic
1113767659 13:112891050-112891072 CTGCAGTTCTGGGTGGCTGGAGG - Intergenic
1115571465 14:34670667-34670689 CTTTAGGCCTGGAAGGATGATGG - Intergenic
1115696165 14:35900963-35900985 CTGTTGTTCTGGAACACTGGAGG + Intronic
1116191096 14:41667725-41667747 CTGTAGCTTTGGAATGCTGGTGG + Intronic
1116802884 14:49461809-49461831 ATGTGCTTCTGGAAGGCTGAAGG - Intergenic
1117267366 14:54103690-54103712 CTTTAATTTTGAAAGGCTGAAGG + Intergenic
1119545206 14:75467098-75467120 CTGTAGCTCTGGAAAGCTTGTGG - Intronic
1120848284 14:89145765-89145787 ATGTAGTTCTGGGATTCTGAAGG + Intronic
1122160642 14:99781611-99781633 CTGTGCTTCAGGAAGACTGATGG - Intronic
1123215960 14:106809697-106809719 CTGTGGACCTGGCAGGCTGAGGG - Intergenic
1124999840 15:34758273-34758295 GTGCAGTTCTGCTAGGCTGAGGG - Intergenic
1126666253 15:51078348-51078370 TTGTAATCCTGGAACGCTGAGGG + Intronic
1129325443 15:74798078-74798100 CTCCAGTCCTGGCAGGCTGACGG - Intronic
1130080018 15:80724691-80724713 CTGTGGGTCTGGGAGGGTGATGG + Intronic
1131220944 15:90583620-90583642 GTGTAGTGCTGGCAGGCTGCTGG + Intronic
1131762598 15:95640687-95640709 CTATAATTCTGCAAAGCTGAAGG - Intergenic
1133765632 16:8835941-8835963 CTGTAGTTCAGGAATACTCAGGG + Intronic
1134080815 16:11323749-11323771 ATGCAGTTCTGGAAGGCCGCCGG - Intronic
1134597122 16:15504700-15504722 CCGGAGCTTTGGAAGGCTGAGGG - Intronic
1134821008 16:17247428-17247450 TTGTGGTTCTGGAAGCCTGCAGG - Intronic
1135330645 16:21557133-21557155 CTGTAAATGGGGAAGGCTGAGGG + Intergenic
1136469838 16:30472822-30472844 CTCGAGTGCTGGAAGGATGAAGG + Exonic
1138789088 16:59881318-59881340 CTGCAGGTTTGGAAGGGTGAGGG + Intergenic
1142552185 17:747617-747639 CTCTAGTTCTGCATGGCAGATGG + Exonic
1142901885 17:3017335-3017357 CTGCACTTCTGCCAGGCTGAGGG + Intronic
1143518591 17:7432535-7432557 CGATAGTTCTGGTAGCCTGAAGG - Intergenic
1143571026 17:7758673-7758695 CTAAAGGTCTGCAAGGCTGATGG + Intronic
1144447817 17:15347386-15347408 CTATAGATATGGAGGGCTGATGG + Intergenic
1144685440 17:17223059-17223081 CTGTGCTTCTGGAGGGCAGAAGG + Intronic
1145795818 17:27654826-27654848 CAGTAGTGCTGGAAGGCCGCAGG - Intergenic
1148492763 17:48033766-48033788 CTGTGGGTGTGCAAGGCTGATGG + Intronic
1149363059 17:55914069-55914091 CTGCAGTGCAGGAAGGCTGTGGG + Intergenic
1150781585 17:68127399-68127421 TTGCAGTTGTGGAAGGCAGAAGG + Intergenic
1153752996 18:8252946-8252968 CTTTAGCACTGGAAGGCTAAAGG + Intronic
1153983850 18:10335747-10335769 CTGTGGTGCTGGATGGCTGGGGG + Intergenic
1156227496 18:35123637-35123659 CTCTCTTTCTGGGAGGCTGATGG + Intronic
1156989236 18:43386606-43386628 CTGTATTTCAGAACGGCTGAAGG - Intergenic
1157564072 18:48668069-48668091 CTGCAGGTTTGGAGGGCTGAAGG - Intronic
1158703492 18:59770467-59770489 CTGTAGTCCTTGAAGGGAGAAGG + Intergenic
1159139844 18:64380306-64380328 CTGTAGTTCTGAAAAGATAAAGG - Intergenic
1160009127 18:75090234-75090256 CTGTTGGCCTGGAAGGCTGGAGG + Intergenic
1160320920 18:77893889-77893911 CTGTAGCTTTGGAAAGCTAAGGG - Intergenic
1162157382 19:8688020-8688042 CTGTAATCGTGGGAGGCTGAGGG - Intergenic
1162523337 19:11194414-11194436 CTTCAGTTCTGGAGGCCTGAGGG - Intronic
1166459088 19:42970139-42970161 CTCTATTTCAGGAAGGGTGAGGG + Intronic
1167017638 19:46851294-46851316 CTGGTGATTTGGAAGGCTGAGGG - Intergenic
1168116243 19:54222645-54222667 CAGTAGTTCTGGGTGACTGATGG - Intronic
1168119225 19:54242393-54242415 CAGTAGTTCTGGGTGACTGATGG - Intronic
1168521118 19:57051288-57051310 CAGAAGTTCTGGAAGGTAGAGGG - Intergenic
925149915 2:1607908-1607930 CTGTATTTCTGCCAGACTGAGGG - Intergenic
928328330 2:30337540-30337562 CAGTAATTCTGGAGGGCTGCCGG - Intergenic
929837672 2:45421779-45421801 CTTTTGTTCTGGAAGACTGAAGG + Intronic
933138124 2:78761260-78761282 CTGTACTGCTGCAAGGCTGCAGG + Intergenic
934884075 2:98009016-98009038 CTGCATTTGTGGAAGGCTGTAGG - Intergenic
935208119 2:100914240-100914262 TGGTATTTCAGGAAGGCTGAAGG - Intronic
935300537 2:101690186-101690208 CTGTAACTTTGGGAGGCTGAGGG - Intergenic
935739968 2:106138692-106138714 CTGCTGCTCCGGAAGGCTGAGGG + Intronic
935744500 2:106178835-106178857 CTGTGGTTCAGGAAGGCTGGGGG - Intronic
936985096 2:118301763-118301785 TTGAAGCTCTGGAAGGCAGAAGG + Intergenic
937224726 2:120361847-120361869 GTGAGGATCTGGAAGGCTGAGGG + Intergenic
939538050 2:143457421-143457443 CTGTAGTCCCAGGAGGCTGAGGG + Intronic
940068666 2:149658729-149658751 CTCTATTTCTGGAAGTTTGATGG + Intergenic
942673610 2:178403508-178403530 CTGTAGTTCATGAAGTCTGCAGG + Intergenic
943143467 2:184012689-184012711 CTGTAGGTGTGGATGGCTTATGG - Intergenic
943674948 2:190707334-190707356 CTGGAGTTCTTGGAGGCTGGTGG + Intergenic
947404181 2:229757361-229757383 CTGTAGTTTTTGGAAGCTGAAGG - Intergenic
947443838 2:230148089-230148111 CTGGAAGACTGGAAGGCTGAGGG + Intergenic
948494922 2:238341785-238341807 CTGCGGCTCAGGAAGGCTGAGGG + Intronic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
1168949155 20:1784692-1784714 TTGTGGGGCTGGAAGGCTGAAGG + Intergenic
1169422900 20:5474005-5474027 CTGGAGTTCAGGTGGGCTGATGG - Intergenic
1169426527 20:5501470-5501492 CTGGAGTTCAGGTGGGCTGATGG + Intergenic
1169587155 20:7097492-7097514 CTGTAGTTCTTGAAGACTCATGG - Intergenic
1169845834 20:9990369-9990391 CTGGCTTTGTGGAAGGCTGAGGG + Intronic
1169987114 20:11457603-11457625 CTGTAGTGTTGGAATGCTGCCGG + Intergenic
1171042278 20:21776557-21776579 GTGTGGGTCTGGAAGGCAGAAGG + Intergenic
1173108008 20:40156255-40156277 CTATGCTTCTGGAAGACTGAAGG - Intergenic
1173468411 20:43302687-43302709 CTGATTTTCAGGAAGGCTGATGG + Intergenic
1175131473 20:56792894-56792916 CTACAGTTCTGGAGGTCTGAAGG - Intergenic
1175774686 20:61645724-61645746 CTGTGGTTCTGGGTGGTTGAAGG - Intronic
1181307107 22:21923116-21923138 CTCAGGTTCTGGAAGGCTGGAGG + Exonic
1183197608 22:36364266-36364288 CTCTAGTCCTGCAGGGCTGAGGG + Intronic
1183768932 22:39906702-39906724 CCGTGGTTCTAGAAGGCTGGGGG - Intronic
950571411 3:13802489-13802511 CTGGAGTTCTGGAAGGAAGCAGG + Intergenic
950703301 3:14765335-14765357 CTTTAGATTTGGAAGGCTGATGG + Intronic
950808452 3:15628621-15628643 CTGTTCTTCTGGAATGCTTATGG - Intronic
950885198 3:16356639-16356661 CTGCAGTTCTGGCAGGCACAAGG + Intronic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
953545944 3:43863646-43863668 CTGTTCATCTGGAATGCTGACGG - Intergenic
954403290 3:50330698-50330720 ATGTAGTTCAGGCATGCTGAAGG + Exonic
957167484 3:76693750-76693772 CTGTAGTTCTAGATGTCTAAGGG + Intronic
958891496 3:99788416-99788438 CTGAATTGATGGAAGGCTGAAGG + Intronic
961185582 3:124912321-124912343 ATGGGGTTCTGGAAGGGTGAGGG + Intronic
962248617 3:133820504-133820526 CTGCTGCTCTGGATGGCTGAAGG + Exonic
962604891 3:137024977-137024999 CTGGATGTCTGGAAGGCTGTAGG + Intergenic
962902606 3:139774369-139774391 CTGGATTTCTGTATGGCTGATGG - Intergenic
965592838 3:170378790-170378812 CTGTAACTTTGGGAGGCTGAGGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967836252 3:193965793-193965815 CTTCAGTTTTGGAGGGCTGAGGG + Intergenic
967939930 3:194757761-194757783 CTGTATCTAGGGAAGGCTGAGGG + Intergenic
968318288 3:197742788-197742810 TTGTAGTCCAGGAAGGCTCAGGG - Intronic
969078316 4:4598585-4598607 CTGTAGCCCTGGAGGCCTGAAGG + Intergenic
969278719 4:6154745-6154767 CTGTAGTTCATGATGGCTGGGGG - Intronic
969438427 4:7201925-7201947 CTGTAGCTTTGGAAAGGTGAAGG + Intronic
969696301 4:8737028-8737050 CTGTGTTTCTGGACAGCTGATGG - Intergenic
970914284 4:21314533-21314555 CTGTGGTTGTAGGAGGCTGAAGG + Intronic
971807407 4:31377344-31377366 CTGTAGATCCAGAAGGCTTAGGG - Intergenic
972042158 4:34616273-34616295 CAGTATTTCTGGAATGATGAAGG + Intergenic
975035208 4:69670706-69670728 CTGTAGTTCTTGCAGGCTCATGG - Intergenic
976152781 4:82108794-82108816 CTGTTGCTCTGGGAGGCAGATGG - Intergenic
976698785 4:87946714-87946736 CTTTAGTTCTGGAAGGATTTAGG - Intergenic
977321157 4:95518147-95518169 CCTTAGTTCTGGAATTCTGATGG - Intronic
977442817 4:97091036-97091058 CTGCACTTCTGGAAAGCTGGTGG + Intergenic
978127032 4:105146946-105146968 CTGGATTGCTGCAAGGCTGAGGG + Exonic
978268514 4:106858758-106858780 CTGAAGTTCTGGAAGGCAGCTGG - Intergenic
982949074 4:161665354-161665376 CTGTAGTCTGGGGAGGCTGAGGG - Intronic
983784993 4:171719076-171719098 CTGTTGTGCTGGAAGGGTTAAGG - Intergenic
985529995 5:428504-428526 TTCTACTTCTGAAAGGCTGAGGG - Intronic
987562654 5:19543660-19543682 CTGTAATTCTGGCATGGTGATGG - Intronic
990313307 5:54560851-54560873 TTGTAGGGCTGGAAGCCTGAAGG - Intergenic
993383300 5:87232928-87232950 ATGTAGTTCTGGAAAGCTGATGG + Intergenic
994518237 5:100796499-100796521 CTTTACATCTGGAAAGCTGAGGG + Intergenic
995246899 5:109945095-109945117 CGGTGTTGCTGGAAGGCTGAGGG + Intergenic
997186376 5:131885537-131885559 CTGTAGTTCTTGCAGACTTATGG - Intronic
997196026 5:131980638-131980660 CTGTGGGGCTGGGAGGCTGAGGG - Intronic
997307896 5:132853099-132853121 CTATAGTTTTGCAAGACTGAAGG + Intergenic
998003274 5:138640877-138640899 AACTAGTGCTGGAAGGCTGAGGG + Intronic
999214313 5:149919126-149919148 CTGTACTCCTGGCAGGCTCAGGG + Intronic
1000533535 5:162453231-162453253 CTGGAGATCTGGAGGGCAGAGGG - Intergenic
1002284311 5:178152094-178152116 CTGTAGTCCTGGAGAGGTGATGG - Intronic
1002857205 6:1048489-1048511 CTGTTCTTCCGGAAGGCCGATGG - Intergenic
1003364649 6:5460893-5460915 CTGTAGTACAGAAAGGCAGATGG + Intronic
1003475651 6:6479807-6479829 CTGTAGTTCTAGAAGCCCAAAGG - Intergenic
1004196191 6:13507412-13507434 ATGTTGCTCTGGAAGGCAGAAGG + Intergenic
1004245166 6:13967815-13967837 CTGTAATTCCAGGAGGCTGAGGG - Intronic
1006380324 6:33693495-33693517 CAGTGGCTCTTGAAGGCTGATGG + Intronic
1007262885 6:40576059-40576081 CTGTAGCTCAGGAAGGCTAATGG - Intronic
1007855234 6:44848729-44848751 CTGTAATTCTGGAAAGCAGGGGG + Intronic
1007937877 6:45750082-45750104 CTGTAGTACTGGAATGCTCTAGG + Intergenic
1008488259 6:52058323-52058345 CTGTACTTCTGGAAGCCTCTGGG + Exonic
1014545922 6:122735161-122735183 CTGCTTTCCTGGAAGGCTGAAGG - Intergenic
1014567685 6:122970285-122970307 CTGGAGTTCAGGAAAGATGAGGG - Intergenic
1014896309 6:126904210-126904232 TTGTAGTTATGGAAGTCTCAAGG - Intergenic
1014899580 6:126946469-126946491 CTGTCTTTCTGGCAGCCTGAGGG - Intergenic
1015339907 6:132086382-132086404 CTGAAGTTCTGGGACACTGAGGG - Intergenic
1016933639 6:149432376-149432398 CTTAACTTCTGGAAGGCAGAGGG - Intergenic
1017510783 6:155112833-155112855 CTGAAGCTCTGGAGGGCCGAAGG - Intronic
1018226858 6:161637021-161637043 CTGCAGCTCTGAGAGGCTGATGG + Intronic
1019828692 7:3304286-3304308 CTTTAATTCTGGAAGGCAGGTGG + Intronic
1020907749 7:14085672-14085694 CTGTGCTTCTGGAAGGGAGAAGG - Intergenic
1022476247 7:30712153-30712175 CTGTACTTCTTGAAGGCTAGTGG - Intronic
1026299449 7:69084340-69084362 CTGTAACTTTGGGAGGCTGAAGG - Intergenic
1028892971 7:96009448-96009470 CTTCAGTTCTGGAAGGCCCAGGG - Intronic
1029419358 7:100464511-100464533 CTGAAATTCAGGAAAGCTGAAGG + Intronic
1030065261 7:105654500-105654522 CTGTAGCACTGGAAGCCAGAAGG + Intronic
1031338671 7:120571059-120571081 GTGTAGTTGTGGGAAGCTGAGGG - Intronic
1034574399 7:151984888-151984910 GTGTGGTTCTGAAAGGCTGGGGG - Intronic
1036116163 8:5962632-5962654 CTGCAGTTCAGGAGGCCTGAAGG - Intergenic
1036769233 8:11567237-11567259 CTGGAGATCTTGAAGGATGAGGG + Intergenic
1036797801 8:11768764-11768786 CTTTAGTTCTCGAAGGAGGATGG - Intergenic
1037951437 8:23020876-23020898 CTGCACTTCTGGAAGGCACAGGG - Exonic
1040786685 8:51174907-51174929 CTGCTGTTCTGCCAGGCTGATGG - Intergenic
1041292167 8:56318431-56318453 CTGTGGATCTGCAAGGATGAGGG + Intronic
1043426729 8:80155462-80155484 CTGGATTTCTGCAAGGCTCAGGG + Intronic
1044621950 8:94199479-94199501 GTGTTTTTCTGGAAGACTGAAGG - Intronic
1045234345 8:100336900-100336922 CACTAGATCTGGAAGCCTGATGG + Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1046820937 8:118633656-118633678 TGGTGGTTCTGGGAGGCTGAGGG - Intergenic
1048139432 8:131778809-131778831 CTGTGGTTCAGAAAGGCTAAAGG - Intergenic
1053432914 9:38055173-38055195 CTGTGGTTCTAAGAGGCTGAAGG - Intronic
1053595735 9:39559290-39559312 CAGCATTTCTGGGAGGCTGAGGG + Intergenic
1053853703 9:42315917-42315939 CAGCATTTCTGGGAGGCTGAGGG + Intergenic
1054570521 9:66805714-66805736 CAGCATTTCTGGGAGGCTGAGGG - Intergenic
1057090328 9:92252164-92252186 CTGTAGGACCCGAAGGCTGAAGG + Intronic
1057620378 9:96629294-96629316 CTGTAGTTGTGGAAGGGTGAAGG + Intergenic
1060213224 9:121723160-121723182 CTGTGGCTCTGGAAGGAAGAGGG + Intronic
1060390165 9:123269909-123269931 CTGTAGTTCTGTGTGGCTGGAGG - Intergenic
1062057600 9:134476602-134476624 CTTTAGTGTTGGATGGCTGAGGG + Intergenic
1062406445 9:136399075-136399097 CTGTGGTCCAGGAAGTCTGAAGG + Intergenic
1062480240 9:136747720-136747742 CTGCAGGGCTGGAAGGCTGGAGG - Intronic
1062480292 9:136747901-136747923 CTGTAGGGCTGGAAGGCTGGAGG - Intronic
1062532755 9:137009109-137009131 CTGTAGGGCTGGGAGGCTGGGGG - Intronic
1187308360 X:18117208-18117230 CTGAAGCTCTGGAAGGGGGAAGG + Intergenic
1187468615 X:19548274-19548296 CTGTAATTCTGGAAGTCACAAGG + Intronic
1189653395 X:43214390-43214412 TTGTATTTCTGTAAGGTTGATGG - Intergenic
1189783532 X:44539230-44539252 GTGTGGATCTGGAATGCTGAAGG - Intronic
1191170880 X:57445900-57445922 CTGTAGTCCTTGAGGTCTGATGG + Intronic
1192908611 X:75579247-75579269 CTGAAGTTATGGAGGGGTGATGG + Intergenic
1194986537 X:100495801-100495823 AGGTAGTGCTGGAAGCCTGAAGG + Intergenic
1199033191 X:143025305-143025327 CTGAAGTTCTGGCAGACTGAAGG + Intergenic
1199213599 X:145242665-145242687 TTCTAGTGCTGGAAGGCTCAAGG + Intergenic
1200092289 X:153641702-153641724 CAGCAGTTCCGGAAGTCTGAGGG - Intergenic