ID: 1097884967

View in Genome Browser
Species Human (GRCh38)
Location 12:64719950-64719972
Sequence ATGCTGTTCTTGAAGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 247}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097884967_1097884970 -3 Left 1097884967 12:64719950-64719972 CCCTTTGCCTTCAAGAACAGCAT 0: 1
1: 0
2: 0
3: 18
4: 247
Right 1097884970 12:64719970-64719992 CATGTCTACTAGAAAAAACTTGG 0: 1
1: 0
2: 1
3: 12
4: 217
1097884967_1097884973 30 Left 1097884967 12:64719950-64719972 CCCTTTGCCTTCAAGAACAGCAT 0: 1
1: 0
2: 0
3: 18
4: 247
Right 1097884973 12:64720003-64720025 GAAGAGAAAGGAAACTTACCCGG 0: 1
1: 1
2: 9
3: 43
4: 419
1097884967_1097884971 18 Left 1097884967 12:64719950-64719972 CCCTTTGCCTTCAAGAACAGCAT 0: 1
1: 0
2: 0
3: 18
4: 247
Right 1097884971 12:64719991-64720013 GGCCAAGTAAATGAAGAGAAAGG 0: 1
1: 0
2: 1
3: 32
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097884967 Original CRISPR ATGCTGTTCTTGAAGGCAAA GGG (reversed) Intronic
900174152 1:1284402-1284424 ATCCTGTTCCTGATGGCACACGG - Intronic
903845348 1:26276665-26276687 CTGCAGATCTTGAAGGCAACTGG - Exonic
906004532 1:42457094-42457116 AGGCTGTGCTTCCAGGCAAAAGG - Intronic
906593425 1:47049986-47050008 ATGCAGTTCCTGAAGACAAGAGG - Exonic
907055484 1:51363343-51363365 TTGGTTTTCTTGAAGGAAAATGG - Intronic
909175427 1:72351640-72351662 CTGTTGTTATTGAGGGCAAAAGG + Intergenic
910489210 1:87749646-87749668 CTGCTGGTCTTGTAGGGAAATGG - Intergenic
910536783 1:88307189-88307211 CTGCTCTTCTTGAAGTCAAGAGG + Intergenic
913563479 1:120047125-120047147 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
913634644 1:120746452-120746474 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
914284073 1:146206489-146206511 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914452092 1:147801562-147801584 ATCCTTTTCTTCAAGGCAGATGG + Intergenic
914545104 1:148657228-148657250 CTGCTGTGCTTGAAGGAAAGAGG - Intronic
914621462 1:149413460-149413482 CTGCTGTGCTTGAAGGAAAGAGG + Intergenic
915618407 1:157060704-157060726 ATGCAGTACTTGAAGGAGAACGG - Intergenic
915840165 1:159206760-159206782 AAGCTGTTCTGGGAAGCAAATGG + Intergenic
916608287 1:166364224-166364246 AGGGTGTTCTTGCAGGCAAGTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917618018 1:176766113-176766135 ATTCTCATCTTAAAGGCAAAAGG - Intronic
917729453 1:177860093-177860115 AGGCTGTTTTAAAAGGCAAAAGG + Intergenic
918671765 1:187225743-187225765 ATGCTGTACTTGAGTGCACAGGG + Intergenic
918917966 1:190669912-190669934 CTGAGGTGCTTGAAGGCAAAGGG - Intergenic
919603954 1:199657102-199657124 ATGGTGTTCTTAAAGATAAAAGG - Intergenic
920539482 1:206767328-206767350 ATGCTGATTTTCAAGGCTAACGG - Intergenic
920826348 1:209427218-209427240 ATGCTATTCTGGAAGGAAGAGGG + Intergenic
924627040 1:245704201-245704223 ATGCTGCATTTGAGGGCAAAAGG - Intronic
1064668629 10:17685226-17685248 ATACTGTTTTTGTAGGCACAAGG + Intronic
1066421587 10:35268988-35269010 ATGCTGTTCATGAAGATAATGGG - Intronic
1068045060 10:51876079-51876101 GTGCTGTTTTTAAAGGGAAAAGG - Intronic
1068301136 10:55141832-55141854 AATCTGTTCTTTAAAGCAAAAGG + Intronic
1069230128 10:65998202-65998224 ATGCTGTTCTTGTATCAAAATGG - Intronic
1071236258 10:83653049-83653071 ATAATTTTCTTGAAGGAAAAAGG + Intergenic
1071259884 10:83910136-83910158 ATGCTGTTCTTCTAGGGAGATGG + Intergenic
1074606551 10:114975192-114975214 ATGCCCTTCCTGAAGACAAATGG + Exonic
1075791668 10:125088807-125088829 GTGCAGTTCTTGAAGGCAGGTGG - Intronic
1079100128 11:17536005-17536027 AAGGAGTTCTTGAAAGCAAAGGG - Intronic
1079460581 11:20674627-20674649 ATGCTTTTCTTAAGGGCACAGGG + Intronic
1080508254 11:32940102-32940124 ATGCTTGTCTTGTTGGCAAAAGG - Intronic
1082671952 11:56045006-56045028 AGGTTCTTCCTGAAGGCAAAGGG + Intergenic
1082789878 11:57339685-57339707 ATGCTGTTCTTTCAGACAATGGG + Intronic
1085224452 11:74907060-74907082 GTGCTGTTCTGGAAGCCAAAAGG - Intronic
1085684937 11:78612802-78612824 TTGAGGTGCTTGAAGGCAAAGGG + Intergenic
1088765766 11:112975030-112975052 TTGCAGTTCTTAAAGGAAAAGGG + Intronic
1089004130 11:115076669-115076691 ATGGTGTTCCTGAAACCAAAGGG - Intergenic
1089041753 11:115457990-115458012 ATGCTGCTCTTGGATGCAAAAGG - Intronic
1089082326 11:115787313-115787335 CTGCTGTTCTTGGAGCAAAATGG + Intergenic
1090718205 11:129449269-129449291 CTGCTGCTCTTGAAGGAAAGAGG + Intronic
1092767602 12:11867488-11867510 ATCATCTCCTTGAAGGCAAAGGG - Intronic
1093855054 12:24092118-24092140 CTGATGTTCTTGAGGTCAAATGG - Intergenic
1097480794 12:60123245-60123267 ATGATTTTCTAGAAGGCAAGAGG + Intergenic
1097884967 12:64719950-64719972 ATGCTGTTCTTGAAGGCAAAGGG - Intronic
1098123061 12:67263476-67263498 AGGCTGTATTTTAAGGCAAAAGG - Intergenic
1099095058 12:78364988-78365010 ATGCTGTTATTAAAGATAAAAGG - Intergenic
1100344336 12:93712354-93712376 ATGCTGTCCTTGCTTGCAAAAGG - Intronic
1100758194 12:97775316-97775338 ATGCAGCTCTTGAACCCAAAAGG - Intergenic
1101739720 12:107491531-107491553 ATCCAGTTCTTGAATGAAAATGG - Intronic
1102634423 12:114310563-114310585 ATGCTGTTTTTGAAAGAAGAGGG + Intergenic
1104161109 12:126181892-126181914 AAATTGATCTTGAAGGCAAATGG - Intergenic
1104508197 12:129352379-129352401 AGGATGTTCTTGAAAGTAAAAGG - Intronic
1104700571 12:130900582-130900604 ATTTTGTTGTTTAAGGCAAAAGG + Intergenic
1104723973 12:131064786-131064808 ATGTTGTTTTAGAAAGCAAAGGG + Intronic
1104790386 12:131477946-131477968 ATGGAGGTCTGGAAGGCAAAGGG - Intergenic
1105636003 13:22215978-22216000 ATGCTGTCCTTTCATGCAAAAGG - Intergenic
1105957442 13:25297607-25297629 AGACTGTGATTGAAGGCAAATGG + Intergenic
1106703850 13:32259382-32259404 AAGCTGTTCTTGGAGGAATAAGG - Intronic
1107326267 13:39246451-39246473 ATGCAGTGCATGAAGACAAAGGG + Intergenic
1109651940 13:65338399-65338421 ATACTATTCTTGAATGTAAATGG + Intergenic
1109937197 13:69303020-69303042 ATTCTGGTCTTAAAGGGAAATGG - Intergenic
1110358968 13:74603595-74603617 ATGCTGTTCTTGAAATCCCAAGG + Intergenic
1111146746 13:84191748-84191770 ATGCTTTTTTTAAAGGAAAAGGG - Intergenic
1112803601 13:103138342-103138364 CTTCTGTTCTTGAAGTCACAAGG - Intergenic
1115849806 14:37582469-37582491 ATGCTGCTCTATAAGACAAAGGG + Intergenic
1115860778 14:37683887-37683909 ATGCTGTGGTTCAAGGAAAAGGG - Intronic
1118628615 14:67681911-67681933 AATCTGTTCATGAAGGCAGAGGG - Intronic
1119908682 14:78329528-78329550 AAGCTGTTAATGAAGCCAAAAGG - Intronic
1120823489 14:88934353-88934375 ATGCTTTTCTTGGAGCTAAAGGG - Intergenic
1121356753 14:93222252-93222274 ATTTTGTTTTTGAAAGCAAATGG + Intronic
1123830265 15:24128918-24128940 AAACTGTTCTGGAAGCCAAAAGG + Intergenic
1125427240 15:39561285-39561307 AAGCTGTTCTTTTAGGCAAATGG - Intergenic
1125671644 15:41477795-41477817 CTGGTATTCTTGAAGGGAAAAGG + Intronic
1127547671 15:60005468-60005490 ATGATGTTCTCGATGGCGAAGGG - Exonic
1127685351 15:61338170-61338192 GCCCTGATCTTGAAGGCAAAAGG - Intergenic
1127945968 15:63753650-63753672 ATGCTGTTGTTGAAGACTATGGG + Intronic
1128618629 15:69130252-69130274 ATGCATTTTTTAAAGGCAAAAGG - Intergenic
1131584846 15:93682274-93682296 ATGCTGGTCTTGATGTGAAAAGG + Intergenic
1132157102 15:99503245-99503267 ATACTGTCCTTGTGGGCAAAAGG - Intergenic
1133512283 16:6471736-6471758 TTGCTTTTCTTCAAGGCAAAGGG + Intronic
1133570859 16:7038623-7038645 ATGCTGGTCTTGAAATGAAAGGG - Intronic
1133645747 16:7763010-7763032 ATGCTCTACTAGAAGACAAAAGG - Intergenic
1137512109 16:49110129-49110151 ATGTTGCTATTGAAGGGAAAAGG + Intergenic
1137728425 16:50672543-50672565 AGGCTGTTCTTGAGGGCAATAGG + Exonic
1139084831 16:63572169-63572191 ATGCTGCTTTTGAAAGAAAATGG + Intergenic
1139117291 16:63971915-63971937 ATGCCTTTATGGAAGGCAAATGG - Intergenic
1139312421 16:66038952-66038974 ATGCAGTTCTGTAAGGAAAACGG - Intergenic
1139370164 16:66462195-66462217 ATCTTTTTCTTGTAGGCAAATGG - Intronic
1139663273 16:68436787-68436809 ATGCTCTAATTGCAGGCAAAGGG + Intronic
1140234637 16:73147323-73147345 AGGCTGTGGTTTAAGGCAAAAGG - Intergenic
1140981425 16:80113264-80113286 ATGCTGTGCTTGGAGGGATACGG + Intergenic
1141498862 16:84429883-84429905 ATGCTGTTCTTGAAGACCCTAGG + Intronic
1141765825 16:86059633-86059655 ATGCTATTCTTGAGGGCATGTGG + Intergenic
1142334400 16:89478230-89478252 ATGGGGTTCTTGAAGGCACTGGG - Intronic
1142682732 17:1559998-1560020 CTGCTGTTCTTGAAGATAAAAGG - Intronic
1146959340 17:36959527-36959549 TTTCTTTTCTTTAAGGCAAAAGG + Intronic
1148982671 17:51592217-51592239 ATGCTGGTATTGAAGATAAAAGG + Intergenic
1151698287 17:75729296-75729318 ATGACGTTCTTGAAGGAGAAGGG - Exonic
1152788151 17:82262835-82262857 ATGATGTCCGAGAAGGCAAAAGG - Intronic
1153051108 18:904413-904435 ATTCTGTACTTAAAGGCAACAGG + Intergenic
1153818312 18:8810036-8810058 ATGCTGTCCCAGAAGCCAAAGGG + Intronic
1154071070 18:11151540-11151562 ATGCTGGTTTTGAAAGCCAATGG - Intergenic
1155928989 18:31685721-31685743 ATGCTGTACCTGAAAGGAAAAGG + Intronic
1156601122 18:38608341-38608363 ATGCTATTTTTCAAGTCAAAAGG - Intergenic
1157962196 18:52167711-52167733 ATCCTTTTCTTTAAGGCAAGTGG - Intergenic
1159815265 18:73065721-73065743 ATGGTGGTCTTGGTGGCAAATGG + Intergenic
1166900142 19:46054858-46054880 ATTTTGTTCTTGAAGACAGAAGG - Intronic
1167951604 19:53032119-53032141 AAGCAGTTCCTGAAGGCACAAGG + Intergenic
926692134 2:15744742-15744764 ATGCCTCTCTTGAAGGCAAAGGG - Intergenic
928131780 2:28656896-28656918 CTGCTGTTCTTACAGGGAAATGG + Intergenic
930463160 2:51709843-51709865 ATGCAGTACTTGAAAACAAATGG + Intergenic
931976739 2:67651678-67651700 TTGCCATTCTTGAAGCCAAAAGG - Intergenic
932161694 2:69466032-69466054 ATACTGCTCTTGGAGACAAATGG + Intronic
932340442 2:70960001-70960023 ATGCTGTTCATGACGTCAATAGG - Exonic
932592764 2:73076988-73077010 ATGGAGGTCTTGAAGGGAAAGGG - Intronic
933429457 2:82157079-82157101 ATGCTTGTCTTGAAAGCAAGAGG + Intergenic
935741026 2:106148030-106148052 TTTCTTATCTTGAAGGCAAAGGG - Intronic
936706223 2:115077724-115077746 GGGCTGTTCTTGAGGGCAACAGG - Intronic
937036669 2:118787814-118787836 ACTCTGGTCTTGAAGGAAAAAGG + Intergenic
937952250 2:127397680-127397702 AGGCTGATCTTGGAGGCAGAGGG - Intergenic
938972976 2:136449084-136449106 CTGCTGTTATTGAAGGCAAGTGG + Intergenic
939758196 2:146139069-146139091 ATGCGGATCTTGAACTCAAAAGG - Intergenic
940478192 2:154192730-154192752 AGGCTGATCTTGAAGGACAAAGG + Intronic
940584622 2:155630243-155630265 ATGATGTTCGTGAAGCCCAAAGG - Intergenic
942225678 2:173813346-173813368 ATGTTGATCTTAAAGGAAAAGGG + Intergenic
943606993 2:189987629-189987651 ATGAAGCTCTAGAAGGCAAAAGG + Intronic
943859824 2:192847416-192847438 ATGCTGTTTTTGAGGGGAAGAGG + Intergenic
944230900 2:197391352-197391374 ATACTGTTCTTAAAGGTAGAGGG + Exonic
944289069 2:197983984-197984006 ATGCTTCCCTTGAAGGCATATGG - Intronic
946888493 2:224248721-224248743 ATGCTGTCCCTGAAAGCAAAAGG - Intergenic
947280282 2:228444843-228444865 ATTCTGTTCTTGGAGTCAAAAGG + Intergenic
948686551 2:239674046-239674068 ATGATGTTCTTGCAGACAGATGG - Intergenic
1172954279 20:38744626-38744648 ATGCTCTTCTTGAAGGCTCCAGG - Intergenic
1175232931 20:57486054-57486076 AGGCTCTTCTTGAATGTAAATGG - Intergenic
1176017357 20:62942028-62942050 AGGCTGTTCTTGATGTCAACTGG + Intronic
1178127793 21:29534222-29534244 GTCCTTTTGTTGAAGGCAAAGGG + Intronic
1181870786 22:25897608-25897630 ATTCAGTATTTGAAGGCAAATGG - Intronic
1183598547 22:38826705-38826727 ATGCTGATCTTGAAGGCATCTGG + Exonic
1184591316 22:45485189-45485211 AAGCAGCTCTTGAAAGCAAAAGG - Intergenic
1184897115 22:47416319-47416341 ATGATGTTCCTTATGGCAAAAGG - Intergenic
1185103193 22:48852679-48852701 ATGCTGTTCCTGTAGGCAGGAGG - Intergenic
949521415 3:4858021-4858043 ATGCTGTTCTAGAAGAAAACAGG - Intronic
950031798 3:9858652-9858674 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
950065959 3:10111938-10111960 ATGCTGTTCTTGAGTGAAGATGG - Intergenic
950417125 3:12875152-12875174 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
951143907 3:19202760-19202782 ACTCTGTTATTGAAGCCAAAAGG - Intronic
952352710 3:32555977-32555999 CTGCTGTTCTTACAGGTAAAGGG + Intronic
957737847 3:84225567-84225589 ATGCAGCTCTTGAACCCAAAAGG + Intergenic
958634849 3:96730669-96730691 ATGCTGTCCTTTAGGGTAAAGGG + Intergenic
960709005 3:120508269-120508291 AGGCAGCTCTTGAAAGCAAAAGG - Intergenic
961783848 3:129337655-129337677 ATGCTCTTCTTGAGGCTAAAGGG - Intergenic
961794203 3:129397858-129397880 ATGATATCCTTGAAGGCAAGGGG + Intergenic
963701633 3:148633442-148633464 ATGTGTTTCTTGTAGGCAAAAGG - Intergenic
964290593 3:155175857-155175879 ATGCTAATATTGAAGGGAAATGG - Intronic
964795148 3:160489038-160489060 ATGCTGCTGTTGAACACAAATGG - Intergenic
965400357 3:168206026-168206048 CTGCTGTTCTGGATGACAAAGGG - Intergenic
966548763 3:181181679-181181701 ATGCTGTCCTTGTAGGCAGCTGG - Intergenic
970563231 4:17303833-17303855 TTGCTGTAGCTGAAGGCAAAAGG - Intergenic
970811263 4:20096872-20096894 ATGATGATCTTGAAGGCCAGAGG + Intergenic
971308366 4:25503311-25503333 ACCCTATTCTTGAAAGCAAAAGG - Intergenic
971316993 4:25575899-25575921 ATGGTGTTCTGGAAGCCAAGTGG - Intergenic
971644590 4:29182680-29182702 ATGCAGTACTTGAATACAAATGG - Intergenic
971709081 4:30088439-30088461 ACTCTGATTTTGAAGGCAAATGG + Intergenic
971907605 4:32747833-32747855 ATGCTCTTTTTCAAGGAAAATGG + Intergenic
971941134 4:33217093-33217115 GTGCTTTCCTTGAAGACAAAGGG - Intergenic
973660629 4:53102755-53102777 ATGATTTTCAGGAAGGCAAAAGG + Intronic
974564698 4:63567611-63567633 TTGCTGGCCTTGAAGGCTAAAGG - Intergenic
976539892 4:86262261-86262283 ATCCTGTGGCTGAAGGCAAAAGG - Intronic
977798688 4:101199118-101199140 ATGCTTTTTATGAAGCCAAAAGG - Intronic
979270851 4:118759850-118759872 ATGCTGGTCTTGAGCTCAAAAGG - Intronic
979602757 4:122604388-122604410 CAGCTGTGCTTGGAGGCAAAGGG - Intergenic
980419613 4:132542697-132542719 AGGCAGTTCTTGAACCCAAAAGG - Intergenic
980490628 4:133522593-133522615 ATTCTGGTTTTGAAGGCTAATGG + Intergenic
981260715 4:142715503-142715525 ATGCTATTCTTGGATGAAAATGG - Intronic
981633666 4:146850352-146850374 ATGCTGTCTTTGAAGCCAGATGG - Intronic
983417732 4:167480053-167480075 ATGCTGTTCTGGAAGGTCACGGG + Intergenic
984358313 4:178693868-178693890 ATGCTTTTCTTCAAGGCAAGAGG + Intergenic
986397871 5:7348100-7348122 AGGCTCTTCTTACAGGCAAAAGG - Intergenic
986958323 5:13183061-13183083 ATGCTTATCCTCAAGGCAAAAGG - Intergenic
988617315 5:32787460-32787482 AAGTTGTTCTTGAGGGAAAAGGG - Exonic
988734455 5:34007117-34007139 ATGCTGTTTTAGAAGGAAGAAGG + Intronic
991007638 5:61845691-61845713 ATGCTGTTCATCAAGACAATGGG + Intergenic
991476497 5:67026317-67026339 ATGCTGTTGTGGTAGGCAAGTGG - Intronic
993019585 5:82575735-82575757 ATATTGTTTTTGGAGGCAAAGGG - Intergenic
993485088 5:88474160-88474182 ATTATGTTCTTGGAGGAAAAGGG + Intergenic
994658997 5:102630717-102630739 ATGCATGTCTTGTAGGCAAATGG - Intergenic
994827807 5:104738124-104738146 ATGCTATTTTTGAGGGAAAATGG + Intergenic
995451206 5:112302974-112302996 ATGCTCTTCATAAAGTCAAAGGG + Intronic
995495561 5:112738183-112738205 AAGCTGTTTTTGAAGCCAGAAGG + Intronic
995932915 5:117471624-117471646 ATGATGTTCTTCAAAGCACAAGG + Intergenic
996526937 5:124489648-124489670 ATTCTGTTTTGAAAGGCAAATGG - Intergenic
997338809 5:133126621-133126643 CTGCTGTTGTTGAAGGCAGTGGG + Intergenic
998086136 5:139325218-139325240 CTGCTTTACTTGAAGGGAAACGG - Intronic
998929884 5:147169783-147169805 ATGCTTTGTTTGAGGGCAAAAGG - Intergenic
1001260032 5:170220445-170220467 AAGCTGTTCTGGTATGCAAATGG - Intergenic
1003656765 6:8018960-8018982 AGACTGTTCTTGTAGCCAAATGG - Intronic
1004196191 6:13507412-13507434 ATGTTGCTCTGGAAGGCAGAAGG + Intergenic
1006061350 6:31422257-31422279 ATGCTGTTCTAAAAGAAAAAAGG + Intergenic
1006262684 6:32888828-32888850 ATACTGTGGTGGAAGGCAAAAGG - Intergenic
1007013364 6:38438980-38439002 TTGCTGTTCTTGAACACACAAGG - Intronic
1007088262 6:39166017-39166039 ATGAATTTCTTAAAGGCAAAGGG + Intergenic
1007314634 6:40977229-40977251 ATACTAACCTTGAAGGCAAATGG - Intergenic
1008023935 6:46612373-46612395 ATCCTGATCTTCAAGGCCAAGGG + Intronic
1008370068 6:50721890-50721912 ATGATGTTCTTGAAGAAATATGG + Intronic
1010000323 6:70942374-70942396 AGGATGTTCTTGATGGCAAGAGG - Intronic
1010114086 6:72280794-72280816 ATTTGTTTCTTGAAGGCAAAGGG - Intronic
1011912203 6:92454509-92454531 TTACTTTTCTTGAAGGAAAAGGG + Intergenic
1013670813 6:112400366-112400388 TTGCTGATTCTGAAGGCAAAGGG + Intergenic
1013789474 6:113820193-113820215 ATGCTGTTTCTGAAGGAAGAAGG - Intergenic
1014195305 6:118550760-118550782 ATGATATTCTAAAAGGCAAAAGG + Intronic
1014948948 6:127531435-127531457 ATGATGTTCTAGAAAGTAAAAGG - Intronic
1016350780 6:143164850-143164872 ATGGTGTTCTTTCAGGCAAAGGG - Intronic
1017176140 6:151506421-151506443 CTTCTATTCGTGAAGGCAAATGG + Intronic
1017223998 6:151998809-151998831 ATGCTGTTTTGGACAGCAAATGG - Intronic
1020077834 7:5270245-5270267 ATGAAGTTCATGAAGACAAACGG - Intergenic
1021211922 7:17864028-17864050 AGGCTTTTCATGAAGTCAAAAGG - Intronic
1023116657 7:36869330-36869352 ATACTGTTCAGGAAGGCAGAGGG - Intronic
1023337009 7:39180845-39180867 AAGGTGCTCTGGAAGGCAAAGGG - Intronic
1023735516 7:43232614-43232636 ATGATGTTCTTGCGGGAAAAGGG + Intronic
1024537380 7:50449589-50449611 ATTCTGTTCTTGATGCAAAACGG + Exonic
1024827588 7:53410082-53410104 ATGCTGTCCTTGAAGAAAATAGG - Intergenic
1027712803 7:81628614-81628636 ATGCTGAACATGAAAGCAAATGG + Intergenic
1027757566 7:82233857-82233879 ATGCTATTTTAGAAGGCAATTGG + Intronic
1030310464 7:108063895-108063917 ATGTTGTTGTTGCAGGCACATGG + Exonic
1031330958 7:120464045-120464067 ATGCTCTTCTGGAAAGCAAAAGG - Intronic
1032887351 7:136155024-136155046 GTGGTGTCCCTGAAGGCAAATGG - Intergenic
1032905071 7:136355316-136355338 ATGCTGTTTATGAAGGCAGAAGG + Intergenic
1035748416 8:1978347-1978369 ATGCGGAGCTTGAAGGCCAAGGG + Intronic
1036423667 8:8622569-8622591 GTGTTGTTGTTGAAGGCATAAGG - Intergenic
1036500129 8:9306294-9306316 ATGATATTCTTTAAGGGAAAAGG + Intergenic
1037002905 8:13742602-13742624 ATACTGTTCGTGAAGGTAACTGG - Intergenic
1037308449 8:17530003-17530025 GTGCTGGTGTTGAATGCAAATGG - Intronic
1039900675 8:41750201-41750223 ATGTTTATCTTGAAGGTAAAGGG - Intronic
1041935571 8:63327942-63327964 ATGTGCTTCCTGAAGGCAAAGGG + Intergenic
1043229691 8:77786487-77786509 ATACTATTCTTGAATGTAAATGG - Intergenic
1043588410 8:81796513-81796535 ATGGTTTTCTTGAAAGCTAAAGG - Intergenic
1043611130 8:82064941-82064963 TTGCTATTCTTGCAGGCATAAGG - Intergenic
1047453875 8:124991235-124991257 TTGCTGAACTTGAAGGCAAATGG + Intergenic
1050302987 9:4277625-4277647 CTGCTGTCCTTGGAGACAAAGGG - Intronic
1052675191 9:31613282-31613304 ATGATGCTCTTAAAAGCAAAAGG + Intergenic
1054828292 9:69595590-69595612 ATTCTATCCTTGAATGCAAAAGG - Intronic
1055285555 9:74724792-74724814 CTACTGTTCATGAAGACAAATGG + Intronic
1055922004 9:81470968-81470990 ATGGTGTTCTTAGAGGCCAAAGG - Intergenic
1057066518 9:92057406-92057428 CTGCCTTTCTGGAAGGCAAATGG - Intronic
1058555359 9:106160914-106160936 GTGCTTTTCTAGAAGTCAAAAGG + Intergenic
1059491150 9:114668254-114668276 GGGGTGTTCTCGAAGGCAAATGG + Intergenic
1186116915 X:6313865-6313887 AGGCTGTTCCTGAAAGTAAAAGG - Intergenic
1188215730 X:27474704-27474726 ATGCTCCTTTTAAAGGCAAATGG + Intergenic
1195423724 X:104704246-104704268 ATGATGGTCTTGAAGTGAAAAGG + Intronic
1196191748 X:112802034-112802056 AGGCTGTTTTTGAAGGCACATGG - Intronic
1196848403 X:119915054-119915076 ATGTTGTTCTAGAAGCCAAATGG - Intronic
1197739640 X:129880006-129880028 CTGGTGTTCAGGAAGGCAAAGGG - Intergenic
1198445892 X:136714048-136714070 AGTCTTTTCTTAAAGGCAAAAGG + Intronic
1198711314 X:139507689-139507711 AGCCTGAACTTGAAGGCAAATGG + Intergenic
1199502579 X:148524343-148524365 ATTCTGTTTTTGTAGGCTAATGG + Intronic
1200768839 Y:7104978-7105000 ATGCTGTTTTGAAAGGAAAAAGG + Intergenic
1201743436 Y:17346749-17346771 ATCCTGTCATTGAAGGCAACTGG + Intergenic
1201866474 Y:18661085-18661107 ATGCTCTTATTTAAGGCAATGGG - Intergenic
1201978841 Y:19884204-19884226 ATACTATGCTTGAAGGTAAATGG + Intergenic