ID: 1097886798

View in Genome Browser
Species Human (GRCh38)
Location 12:64737011-64737033
Sequence GTCTGATTTGGTTTGATCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 157}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097886794_1097886798 4 Left 1097886794 12:64736984-64737006 CCAGCTTGTCAGGCACCTACCTT 0: 1
1: 0
2: 1
3: 5
4: 121
Right 1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 157
1097886793_1097886798 12 Left 1097886793 12:64736976-64736998 CCACAGCACCAGCTTGTCAGGCA 0: 1
1: 0
2: 2
3: 28
4: 249
Right 1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 157
1097886791_1097886798 17 Left 1097886791 12:64736971-64736993 CCTGTCCACAGCACCAGCTTGTC 0: 1
1: 0
2: 1
3: 10
4: 194
Right 1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 157
1097886790_1097886798 21 Left 1097886790 12:64736967-64736989 CCTACCTGTCCACAGCACCAGCT 0: 1
1: 0
2: 1
3: 28
4: 320
Right 1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097886798 Original CRISPR GTCTGATTTGGTTTGATCCC AGG Exonic
902522922 1:17031788-17031810 CTCTGCTTTTGTTTTATCCCAGG + Intronic
903436598 1:23354670-23354692 GTCTCATTCGGTTTTATACCAGG + Intergenic
904348039 1:29886167-29886189 GTCTGATTTGGCTTTATGCAAGG + Intergenic
905372127 1:37488110-37488132 GTTGGATTTGCTTTGAACCCAGG - Intergenic
905390423 1:37632908-37632930 GTCTGATTTCCTTTGAGCCATGG + Intronic
907326112 1:53639496-53639518 GGCTGTTTTGGTTGGAACCCTGG + Intronic
908440481 1:64148949-64148971 GTCTGATTTAGCTTGTTCACAGG - Intronic
909152151 1:72020664-72020686 GTCTGTTTTGGTATGTTACCTGG - Intronic
910035115 1:82779367-82779389 GTCTGATTTGGCTTTATGCAGGG + Intergenic
918152645 1:181811282-181811304 GTCTGATTTCTTTTGGTCCTTGG - Intergenic
919181701 1:194092624-194092646 GTGTGAATTGGTTTAAGCCCTGG - Intergenic
1062778444 10:176710-176732 GTTTTATTTGGTTTGATTCCAGG + Intronic
1063095926 10:2908955-2908977 GGATGATTTGGTGTGATACCAGG - Intergenic
1063989035 10:11539423-11539445 GTCTGATTTGGTGGGTTCCAGGG - Intronic
1065487438 10:26248764-26248786 GCCTGATTTTGTTTGATTGCTGG + Intronic
1066582390 10:36895294-36895316 GTTCAATTTGGTTTCATCCCTGG - Intergenic
1068056013 10:52013623-52013645 GTCTGATTTGCTTTGAGCACAGG + Intronic
1070874495 10:79789985-79790007 GTCTGACTTGCTTTGTTCCTGGG - Intergenic
1071641417 10:87312143-87312165 GTCTGACTTGCTTTGTTCCTGGG - Intergenic
1073302772 10:102481032-102481054 GCCTGATTTGGTTTGGCCCCAGG - Intronic
1080677740 11:34443318-34443340 GTCAGATTTGGTTTGCTGACAGG + Intronic
1081045174 11:38265036-38265058 GTTTTATTTGGTTTGAACCTAGG + Intergenic
1085926651 11:81032131-81032153 GACCAATTTGGTTTGACCCCAGG + Intergenic
1090601947 11:128381437-128381459 CTCTTTGTTGGTTTGATCCCTGG + Intergenic
1093481977 12:19613401-19613423 GTCTGTTTTGTTTTGTTCACAGG + Intronic
1094229605 12:28087785-28087807 ATCTGATTTGCTATCATCCCAGG + Intergenic
1094410417 12:30162373-30162395 GTCTGATTTTGTTCTTTCCCAGG - Intergenic
1096585219 12:52615553-52615575 GTCTGATTTCCTCTGATGCCTGG + Intronic
1097194195 12:57234937-57234959 GGCTGCTTCTGTTTGATCCCTGG + Exonic
1097886798 12:64737011-64737033 GTCTGATTTGGTTTGATCCCAGG + Exonic
1100155916 12:91800192-91800214 GTCTGGTTTGATTGGATGCCAGG - Intergenic
1101708225 12:107240684-107240706 GTGTGACTTGGTTTGAGCCATGG + Intergenic
1102204656 12:111082366-111082388 GCCTGAATTGGTTTGATTCCAGG + Intronic
1107680875 13:42848740-42848762 GTCTGATTTGTTTCCACCCCAGG - Intergenic
1111612647 13:90623568-90623590 CTCCTATTTGGTTTGATTCCAGG + Intergenic
1113227622 13:108176394-108176416 CTCTGAATTGCTTTGATCCTTGG + Intergenic
1116742116 14:48769146-48769168 TTCTGATCTGGTTTGATCTAAGG + Intergenic
1118085556 14:62411983-62412005 TTCTTACTGGGTTTGATCCCTGG - Intergenic
1118982266 14:70726399-70726421 GTCTGATTTGTTTAGAGCCTGGG - Intronic
1119378021 14:74210552-74210574 GTCTGATTTGCTTGGAACTCAGG + Intergenic
1120129735 14:80791628-80791650 GTCTGAACTGATCTGATCCCAGG - Intronic
1122417141 14:101555475-101555497 GTCTGATTGGCTATGATTCCCGG - Intergenic
1123469620 15:20540697-20540719 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1123648442 15:22460002-22460024 GTTTGGTTTGGTTTTCTCCCAGG + Intronic
1123664061 15:22593330-22593352 AACTGATTTGTTTTGTTCCCTGG - Intergenic
1123667120 15:22616859-22616881 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1123682870 15:22775419-22775441 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1123729898 15:23135683-23135705 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1123748068 15:23333165-23333187 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1123762836 15:23446232-23446254 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1124280432 15:28357017-28357039 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1124302266 15:28554595-28554617 GTTTGGTTTGGTTTTCTCCCAGG + Intergenic
1124317892 15:28687768-28687790 AACTGATTTGTTTTGTTCCCTGG - Intergenic
1124320961 15:28711426-28711448 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1124334615 15:28847942-28847964 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1124439553 15:29676075-29676097 GTTTGCTTTGGTTTGACCCCAGG - Intergenic
1124481533 15:30083929-30083951 GTTTGGTTTGGTTTTCTCCCAGG + Intronic
1124487022 15:30126900-30126922 GTCTGATTTGTTTTCCTCCATGG + Intergenic
1124487990 15:30136025-30136047 GTTTGGTTTGGTTTTCTCCCAGG + Intronic
1124522059 15:30413265-30413287 GTTTGATTTGGTTTTCTCCCAGG - Intronic
1124536606 15:30552953-30552975 GTTTGATTTGGTTTTCTCCCAGG + Intronic
1124542105 15:30595875-30595897 GTCTGATTTGTTTTCCTCCATGG + Intergenic
1124543078 15:30605002-30605024 GTTTGATTTGGTTTTCTCCCAGG + Intronic
1124563032 15:30792444-30792466 GTTTGGTTTGGTTTTCTCCCAGG + Intergenic
1124565542 15:30809711-30809733 TTCTGATTTATTTTGTTCCCTGG + Intergenic
1124755537 15:32402296-32402318 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1124756503 15:32411422-32411444 GTCTGATTTGTTTTCCTCCATGG - Intergenic
1124762047 15:32454639-32454661 GTTTGATTTGGTTTTCTCCCAGG - Intronic
1124776583 15:32594429-32594451 GTTTGATTTGGTTTTCTCCCAGG + Intronic
1126057580 15:44745242-44745264 GTTTGATTTGGGTTGATTCTAGG + Intronic
1128386857 15:67155751-67155773 GGCTGAGTTGGGTTGATCACAGG + Intronic
1129036931 15:72655674-72655696 GTTTGGTTTGGTTTTCTCCCAGG + Intronic
1129212956 15:74081551-74081573 GTTTGGTTTGGTTTTCTCCCAGG - Intronic
1129397446 15:75259535-75259557 GTTTGGTTTGGTTTTCTCCCAGG + Intronic
1129401055 15:75283812-75283834 GTTTGGTTTGGTTTTCTCCCAGG + Intronic
1129730092 15:77925867-77925889 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1130260157 15:82348427-82348449 GTTTGGTTTGGTTTTTTCCCAGG - Intronic
1130268574 15:82431006-82431028 GTTTGGTTTGGTTTTTTCCCAGG + Intronic
1130281076 15:82520581-82520603 GTTTGGTTTGGTTTTTTCCCAGG + Intergenic
1130472447 15:84236761-84236783 GTTTGGTTTGGTTTTTTCCCAGG + Intronic
1130479938 15:84351332-84351354 GTTTGGTTTGGTTTTTTCCCAGG + Intergenic
1130491832 15:84436797-84436819 GTTTGGTTTGGTTTTTTCCCAGG - Intergenic
1130503446 15:84515837-84515859 GTTTGGTTTGGTTTTTTCCCAGG - Intergenic
1130526969 15:84715908-84715930 GTCTGAGCTGGTCTGATACCCGG - Intronic
1130594744 15:85241398-85241420 GTTTGGTTTGGTTTTTTCCCAGG + Intergenic
1136177004 16:28524030-28524052 GTCTGATTTGGCTTTCTGCCAGG + Intergenic
1138019944 16:53469894-53469916 GTTTGATTTGTTTTGACCCTAGG + Exonic
1138325832 16:56166622-56166644 GTCTGATTTGATTTGATTTGAGG - Intergenic
1138697220 16:58825897-58825919 GTCTCATTGGGTTTGAACTCAGG - Intergenic
1141898716 16:86976241-86976263 GACTGATCTGCTCTGATCCCTGG + Intergenic
1144149653 17:12430967-12430989 GACTGATCTGGTCTAATCCCTGG + Intergenic
1145866654 17:28246292-28246314 ATTTGATTTGGTTTGATCCTTGG + Intergenic
1159972020 18:74666511-74666533 CTCTGCTTTGTTTTGATCCTTGG + Intronic
1160226449 18:77015388-77015410 GTCTGGTGTGGTTTGATAGCTGG + Exonic
1160254618 18:77237735-77237757 GTATGTTTTAGTTTGACCCCAGG + Intergenic
1160937162 19:1602188-1602210 GTGTGATTTGCTGTGATCCAGGG - Intronic
1167827060 19:51983479-51983501 GTATGATTGGGTTTTATACCGGG - Intronic
1168139969 19:54379417-54379439 GTCTGATTGGCTGTGATCCTTGG - Intergenic
930368745 2:50477284-50477306 GCCTGCTTTGCTTTGATCCTTGG - Intronic
937103081 2:119286566-119286588 GGCTTCTTTGGTTTGATCTCTGG - Intergenic
941654764 2:168131477-168131499 CTATGCTTGGGTTTGATCCCTGG - Intronic
942698831 2:178679818-178679840 GTCTGATTTGGTCAGATTCTGGG - Intronic
943522593 2:188972390-188972412 TTCTGAATTGGTTTGAACACAGG + Intergenic
944313140 2:198257659-198257681 GTTTGATCTTGTTTGATCCTTGG + Intronic
944385534 2:199159829-199159851 TTCTACTTTGGTTTGCTCCCTGG - Intergenic
946877823 2:224147584-224147606 GCCTGATTGGGTTTGATTCCTGG + Intergenic
1168876047 20:1173047-1173069 GTTTGGTTTGGTTTGATGCTGGG + Intronic
1169301767 20:4448225-4448247 GACCAAGTTGGTTTGATCCCAGG + Intergenic
1174766866 20:53263008-53263030 GTTTGGTTTGGTTTGTTTCCTGG + Intronic
1176736559 21:10553527-10553549 GTCTAATTTTGTTTCAGCCCTGG - Intronic
1178178375 21:30130858-30130880 GTCTTTTATGGTTTCATCCCAGG + Intergenic
1178691223 21:34751859-34751881 GTCTGGCTGGGTTTGAACCCTGG - Intergenic
952229766 3:31417688-31417710 GTCTGATTTTGATTGATTGCTGG + Intergenic
952551982 3:34489319-34489341 GTCAAACTTGGTTTGATCCAAGG - Intergenic
953311481 3:41884711-41884733 GTCTGATTTGTTTTCCTCCATGG - Intronic
954806656 3:53224587-53224609 GGGTGATGTGGTTTGGTCCCAGG - Intergenic
955002595 3:54941045-54941067 GTTTGATTTGCTTTAATCACTGG - Intronic
960211395 3:114971321-114971343 GTCTTACATGGTTTGATCCTAGG - Intronic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
971652509 4:29296280-29296302 GTCTGACTTGGTTTCATTCCTGG - Intergenic
971715399 4:30168914-30168936 TTCTCATTTGGATTGGTCCCAGG + Intergenic
972929809 4:44058136-44058158 GTCTGATTTTGTATGGTCTCAGG + Intergenic
978496418 4:109364312-109364334 GTGTGAGTTGGGGTGATCCCTGG + Intergenic
980900829 4:138903722-138903744 GACAGATTTGGTTTGAATCCTGG + Intergenic
984557527 4:181233226-181233248 GTTTGATTTTGTTTGCTCACTGG + Intergenic
986393469 5:7305953-7305975 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
986869041 5:12025748-12025770 GTTTGATATGGTTTGTTCACTGG - Intergenic
990803294 5:59629874-59629896 GTCTGAGTTAGCATGATCCCTGG + Intronic
994410609 5:99403110-99403132 TTCTGATGTGGTTCTATCCCAGG - Intergenic
994483223 5:100362159-100362181 TTCTGATGTGGTTCTATCCCAGG + Intergenic
998911291 5:146963188-146963210 TTTTGATTTGATTTGATACCAGG - Intronic
1001540689 5:172535973-172535995 GTCTGCTTTTGTTTGCTCTCTGG - Intergenic
1002043351 5:176529582-176529604 GTCTGCTTTGGTGAGACCCCGGG + Exonic
1003081575 6:3025550-3025572 GGCAGATGTGGTTTGAACCCAGG + Intergenic
1008172062 6:48220261-48220283 GTAAGATTTGTATTGATCCCTGG + Intergenic
1010935613 6:81857777-81857799 ATCAGATTTGGTTTTACCCCAGG - Intergenic
1012457712 6:99425708-99425730 GTTTGGTTTGGTTTGACCCTGGG - Intergenic
1014619807 6:123652955-123652977 GTCTAATTTGGGTTTACCCCAGG + Intergenic
1014645294 6:123965581-123965603 GTCTAGTTTGGTTAGATCGCAGG - Intronic
1016077942 6:139819905-139819927 GTGTGACTTTCTTTGATCCCTGG + Intergenic
1018366284 6:163123154-163123176 GTCTGATTTGCTTAGGGCCCAGG + Intronic
1018509421 6:164509404-164509426 GTCTCATCTGCTTTAATCCCAGG + Intergenic
1019494591 7:1331935-1331957 GCCGGATCTGGTTTGTTCCCTGG - Intergenic
1020212345 7:6166199-6166221 GACTGATTTTGATGGATCCCAGG - Intronic
1021061804 7:16121856-16121878 GTCAGGTTTGGCATGATCCCTGG + Intronic
1021097783 7:16552777-16552799 CTCAGACTTGGTTTGAGCCCTGG - Intronic
1022585311 7:31603267-31603289 GGAGGATGTGGTTTGATCCCTGG - Intronic
1023564000 7:41505525-41505547 CTCTGATTTTGTTTAATTCCAGG + Intergenic
1026180654 7:68036840-68036862 GACAGATGTGGTTTGAACCCAGG + Intergenic
1028939263 7:96502428-96502450 GTCAGACTAGGTTTGATTCCAGG + Intronic
1030557213 7:111041723-111041745 TTCTGATTTGTTTTCAGCCCAGG + Intronic
1040544281 8:48384967-48384989 GTCGGCCTTGGTTTGATCCTTGG - Intergenic
1040724069 8:50360189-50360211 GCCTAATTTAGTTTGATCCTAGG - Intronic
1049034468 8:140063473-140063495 GTCTGATGTGTTTAGAGCCCTGG - Intronic
1052203170 9:25807061-25807083 GGCCCATTTGGTTTGGTCCCAGG - Intergenic
1059174768 9:112159334-112159356 GTCTCAGTTGGTTTCATGCCTGG - Intronic
1060506348 9:124200992-124201014 ATCTGATTTGGGTTGACCACTGG - Intergenic
1060814031 9:126625528-126625550 GGCAGATTTCGTTGGATCCCTGG + Intronic
1061466473 9:130784627-130784649 GTCTGGTCTGGTCTGGTCCCTGG + Intronic
1186930438 X:14383242-14383264 GTGTCCTTTGGTTTGATTCCAGG + Intergenic
1187080137 X:15977276-15977298 GTCTGCTTTGGTTTCCTTCCCGG - Intergenic
1188989826 X:36803849-36803871 GTCTCATTTGGAATGCTCCCTGG + Intergenic
1190156414 X:47996878-47996900 GACTGATTTGGTTTTAGCCTCGG - Intronic
1192343022 X:70279869-70279891 GTCTGCTTAGGTTGTATCCCAGG + Intronic
1193665744 X:84314164-84314186 GACAAATTTGGATTGATCCCTGG + Intergenic
1196229852 X:113208862-113208884 GACTGAGTTGGCTTCATCCCTGG - Intergenic
1202366489 Y:24169108-24169130 GTTTGGTTTGGTTTTCTCCCAGG + Intergenic
1202374015 Y:24217532-24217554 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1202496766 Y:25452588-25452610 GTTTGGTTTGGTTTTCTCCCAGG + Intergenic
1202504293 Y:25501015-25501037 GTTTGGTTTGGTTTTCTCCCAGG - Intergenic
1202594832 Y:26526735-26526757 GTCTAATTTTGTTTCAGCCCTGG - Intergenic