ID: 1097887681

View in Genome Browser
Species Human (GRCh38)
Location 12:64745927-64745949
Sequence AAAAGTCATCAGGCCAGATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 8, 3: 68, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097887681 Original CRISPR AAAAGTCATCAGGCCAGATT TGG (reversed) Intronic
900568677 1:3347765-3347787 AGCAGGCATCAGGCCAGATCTGG - Intronic
902559134 1:17266147-17266169 AACAGGCAGTAGGCCAGATTTGG + Intronic
903061007 1:20668728-20668750 AATAGCCTGCAGGCCAGATTTGG - Intronic
903098001 1:20998604-20998626 ACAATTCACCAGGCCAAATTTGG + Intronic
905089232 1:35414637-35414659 AACAGGGAGCAGGCCAGATTTGG - Intronic
905497211 1:38401695-38401717 AAGAGGCAGCAGGTCAGATTTGG - Intergenic
907398899 1:54212312-54212334 AATAGGTAGCAGGCCAGATTTGG + Intronic
907967899 1:59350976-59350998 AACAGGCAGTAGGCCAGATTTGG - Intronic
908405724 1:63812254-63812276 AACAGGCCTCAGGCCAAATTTGG - Intronic
909286419 1:73825828-73825850 GCAAGTCATAAGGCTAGATTGGG - Intergenic
909334597 1:74456857-74456879 AAAAGTCTGCAAGCCATATTTGG - Intronic
910404915 1:86877740-86877762 AAAAGCAAGCAGGACAGATTTGG - Intronic
910582555 1:88844565-88844587 AATAGTAATCAGGCCGGATGTGG + Intergenic
911113198 1:94213614-94213636 AACAGGCAGCTGGCCAGATTTGG + Intronic
911463696 1:98223877-98223899 AAACGTGATCAGGCCAGGTGTGG + Intergenic
911471560 1:98325500-98325522 AAAAGGAATCAGGCCTGAGTTGG + Intergenic
911541818 1:99165562-99165584 AAAAGCCGTGAGGCAAGATTTGG + Intergenic
913457973 1:119053129-119053151 AAGAGTCCACAGGCCAGATTTGG - Intronic
913485690 1:119331083-119331105 AATAGGCAGCACGCCAGATTTGG + Intergenic
914736368 1:150421071-150421093 AATAGGCAGCAGGCCAGATTTGG + Intronic
916083002 1:161247901-161247923 CACAGGCAGCAGGCCAGATTGGG - Intergenic
916200625 1:162267967-162267989 AAAGGTCTTAAGGCCAGATTCGG + Intronic
916481420 1:165218097-165218119 AACAGGCATCAGGCCAGATTTGG + Intronic
916510004 1:165465064-165465086 AAGAGGCATTAGGCCAGATGTGG + Intergenic
916720049 1:167477956-167477978 AATAGTCATCAGGACAGAAGGGG - Intronic
917697821 1:177545741-177545763 AACAGTTTGCAGGCCAGATTAGG + Intergenic
917969622 1:180198420-180198442 AAAACCCAGCAGGCCGGATTAGG - Exonic
919272777 1:195371334-195371356 AACAGACAACAAGCCAGATTTGG - Intergenic
919659572 1:200230617-200230639 AAAATTCATGAGGCCAGGTGTGG + Intergenic
923694947 1:236239262-236239284 AATAAGCAGCAGGCCAGATTTGG - Intronic
924326803 1:242903285-242903307 AAAAGAAATCAGGCCAGGTGCGG + Intergenic
924580444 1:245318756-245318778 AAATTTCATGAGGCCAGAGTAGG + Intronic
924662872 1:246038055-246038077 AACAGGCAGCAGGCCAGATATGG + Intronic
924814369 1:247429186-247429208 AAAAATCCTCAGGCCAGGCTGGG - Intronic
924931863 1:248739397-248739419 AGAATGCATCAGGACAGATTTGG + Exonic
1062889217 10:1045089-1045111 AACAGGCAGCAGGCCAGATTTGG + Intronic
1066129451 10:32378338-32378360 AAAATTAACCAGGCAAGATTAGG + Intronic
1067356606 10:45534264-45534286 AATAGGCAGCAGGCTAGATTTGG + Intronic
1069213540 10:65791309-65791331 AAAGGTCATTAGTCTAGATTGGG + Intergenic
1069359124 10:67621840-67621862 AATAGACAAGAGGCCAGATTTGG - Intronic
1071552801 10:86580183-86580205 AAAAGGCAGCAGGCCAGATTTGG - Intergenic
1072512028 10:96137036-96137058 AACAGGCAGCAGGCCAGATTTGG + Intronic
1072557534 10:96532738-96532760 AACAGGGAGCAGGCCAGATTTGG + Intronic
1072865733 10:99059147-99059169 AACAGGAAGCAGGCCAGATTTGG + Intronic
1074807503 10:117068099-117068121 AAGAGTCATCAGGCCAGGCACGG + Intronic
1074831729 10:117254367-117254389 AATAGTCAACAGGCCAGCTCCGG - Intronic
1075745765 10:124726244-124726266 AAAAGCCATGAGGTCAGAATTGG + Intronic
1076154860 10:128195938-128195960 AACAGGCAGCAGGCTAGATTTGG - Intergenic
1077408748 11:2393920-2393942 AAAACTCACCAGGCCAGGCTGGG + Intronic
1077596216 11:3533960-3533982 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1077750956 11:4969126-4969148 AATTGTCATAAGCCCAGATTCGG + Intronic
1079049222 11:17138806-17138828 AACAGAGAGCAGGCCAGATTTGG + Intronic
1079924101 11:26471005-26471027 AAAAGTGATCAGTGCATATTAGG - Intronic
1082196671 11:49315086-49315108 AAAAGGCATCTGGCTACATTTGG - Intergenic
1082856489 11:57812227-57812249 AAAAAACATCAGGCCAGGTGTGG + Intronic
1084252124 11:67907940-67907962 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1084894672 11:72257232-72257254 AAAAGTCATAAGGCCGGGTGTGG - Intergenic
1085087605 11:73681520-73681542 AAAATGTATCAGGCCAGACTTGG + Intronic
1085349947 11:75791963-75791985 AAAAGTAATCAGTTCTGATTGGG + Intronic
1086138359 11:83465861-83465883 AAAATTGATCAGGCAAGATTTGG - Intronic
1086659155 11:89393119-89393141 AAAAGGCATCTGGCTACATTTGG + Intronic
1087211935 11:95453775-95453797 AAAAATCCACAGGCAAGATTTGG - Intergenic
1087283198 11:96235243-96235265 AACAGCCTGCAGGCCAGATTTGG - Intronic
1089924132 11:122239609-122239631 AAAAGACAAGGGGCCAGATTAGG + Intergenic
1090314986 11:125778323-125778345 CAAAATCATCAGGCTAGATAAGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1092036404 12:5339052-5339074 AAAAGTCATCAGAATAGAGTGGG - Intergenic
1092307027 12:7311658-7311680 AAAAGGTGGCAGGCCAGATTTGG - Intronic
1092422390 12:8342732-8342754 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1093454223 12:19348974-19348996 AAAAGACATCACATCAGATTAGG + Intronic
1094357161 12:29590139-29590161 AACAGGCAGCAGGCCACATTTGG + Intronic
1094554566 12:31485600-31485622 AACAGTCAGCTGGACAGATTTGG + Intronic
1094581906 12:31740986-31741008 AAAAGTCAGAATGCCAGACTGGG + Intergenic
1095549900 12:43423303-43423325 AATAGGCAACAGGCCAGATTTGG + Intronic
1096371865 12:51075670-51075692 AACAGGCATTGGGCCAGATTTGG + Intronic
1097792316 12:63828232-63828254 AAAAGTTACCAGGCCAGGTTTGG + Intergenic
1097887681 12:64745927-64745949 AAAAGTCATCAGGCCAGATTTGG - Intronic
1098111021 12:67121961-67121983 AAATGACATCAGGCAAGATACGG - Intergenic
1098115026 12:67166024-67166046 AATAGGCCACAGGCCAGATTTGG - Intergenic
1098221907 12:68279022-68279044 AAAAATCATCATGACTGATTTGG - Intronic
1098322901 12:69265899-69265921 AAAAGTAATCAGACTAGACTGGG - Intronic
1098377346 12:69831216-69831238 AACAGGCTGCAGGCCAGATTTGG - Intronic
1099980439 12:89595244-89595266 AATAGACAACAGGCTAGATTTGG + Intronic
1100144847 12:91665049-91665071 AGCAGTGAACAGGCCAGATTTGG - Intergenic
1100392706 12:94158015-94158037 AACAGGCAACAAGCCAGATTTGG + Intronic
1101051551 12:100868944-100868966 AACAGACAGCAGGCCAGATGTGG + Intronic
1101366289 12:104073846-104073868 AAAAGACAGCAGGCCACATTTGG - Intronic
1102033104 12:109754620-109754642 AGCAGCCAGCAGGCCAGATTTGG + Intronic
1103040288 12:117689568-117689590 AACAGTCAGCAGGCCAGATTTGG + Intronic
1103997086 12:124837341-124837363 AATAGGCATCAGGCTGGATTTGG - Intronic
1104051196 12:125194912-125194934 AAAAGTCTGCAGGCCAGATATGG - Intronic
1104058954 12:125251910-125251932 AAAGGCCTTCAGGCCAGATGTGG - Intronic
1105538062 13:21288282-21288304 AAAAATCAACAGGCCAGACGTGG + Intergenic
1105661616 13:22502119-22502141 TACAGGCATCAGGCCAGATTTGG + Intergenic
1108118296 13:47154581-47154603 AAAAGATGACAGGCCAGATTTGG - Intergenic
1110605747 13:77430117-77430139 AATAGGCATCCGACCAGATTTGG - Intergenic
1111524118 13:89445653-89445675 TATAGTCCTCAGGCCAAATTTGG - Intergenic
1111644117 13:91008678-91008700 AAAAGACAACAGGTCAGAGTAGG - Intergenic
1112070360 13:95843762-95843784 AAAAGTCAACCGGCCATATATGG + Intronic
1112439317 13:99414333-99414355 AAAAGTCCTCAGGACAGAGCGGG - Intergenic
1113006635 13:105711485-105711507 AAAATTCATCATGTCAGAATAGG - Intergenic
1114163382 14:20193533-20193555 AATAGGCAGCAGGCCAGGTTTGG - Intergenic
1114177267 14:20333694-20333716 AAATTTTATCAGGCCAGCTTTGG - Intergenic
1115167311 14:30463556-30463578 ATATGTCATAAGGCCAGATGTGG + Intergenic
1115322493 14:32098733-32098755 AAAAGGCAGCAGGCTGGATTTGG + Intronic
1115448125 14:33515466-33515488 AACAGGCAGCAGGCCAGATTTGG - Intronic
1116995471 14:51319293-51319315 AACAGTCAGCAAGCCAGATTAGG - Intergenic
1117713276 14:58554822-58554844 AAAAGACTTCAGGCCAGATTTGG + Intergenic
1118147989 14:63161465-63161487 AACAGGCAGCAGGCCAGATTTGG + Intergenic
1119235020 14:73012298-73012320 ATGAGTCACCAGGCCAGAATGGG + Intronic
1120086208 14:80276689-80276711 AAAAGTCATCAAGCCAAGTATGG + Intronic
1120614496 14:86686395-86686417 AATAAGCAGCAGGCCAGATTTGG - Intergenic
1121386112 14:93527230-93527252 AACTGGCAGCAGGCCAGATTTGG - Intronic
1121615897 14:95313458-95313480 AAGAGGCAGCAGGCCAGATTTGG + Intronic
1121620071 14:95340373-95340395 AAACATCATCAGGGCAGTTTAGG - Intergenic
1124425725 15:29560887-29560909 CAAAAGCAGCAGGCCAGATTTGG - Intronic
1124711497 15:32016303-32016325 AAAAGTCACCAGAACAGGTTCGG + Intergenic
1125635865 15:41188238-41188260 AACAGTCTGCAGGCCAGATTTGG + Intronic
1125646120 15:41274247-41274269 AAAAGTTATTAGGCCAGGTGCGG - Intronic
1125826357 15:42679801-42679823 AACAGGCAGCAGACCAGATTTGG + Intronic
1125839630 15:42787108-42787130 ATAGGTAAGCAGGCCAGATTTGG - Intronic
1125848292 15:42879661-42879683 AACAGTCTGCAGGCCAAATTTGG - Intronic
1126138761 15:45418944-45418966 GAAAGACACCAGCCCAGATTTGG + Intronic
1126507756 15:49427620-49427642 AAAAGTCATGAGAAAAGATTGGG - Intronic
1126614499 15:50563122-50563144 AACAGGCAACAGACCAGATTTGG - Intronic
1126633528 15:50760547-50760569 AAAAGACATCAGGCCAGGTGTGG - Intronic
1126934793 15:53694902-53694924 AACAGGCAGCAGGCCTGATTTGG - Intronic
1127019425 15:54729413-54729435 ACAAGTGATCATGACAGATTAGG + Intergenic
1128190705 15:65692926-65692948 AACAGGCCTCAGGCTAGATTTGG - Intronic
1128994059 15:72283922-72283944 AATAGGCCACAGGCCAGATTTGG + Intronic
1129331097 15:74827691-74827713 AAAAGTATTCAGGCCAAACTTGG - Intronic
1129620940 15:77145156-77145178 AAATGTCTTCAGGCCAGGTGCGG + Intronic
1129936135 15:79451594-79451616 GAAAATCATGAGGCCAGACTGGG - Intronic
1130095584 15:80853365-80853387 AAAAATAATCAGCCCAGCTTTGG + Intronic
1130469979 15:84217454-84217476 AAAGGTCATAAGCTCAGATTTGG - Intergenic
1130477467 15:84332021-84332043 AAAGGTCATAAGCTCAGATTTGG - Intergenic
1130494298 15:84456109-84456131 AAAGGTCATAAGCTCAGATTTGG + Intergenic
1130592268 15:85222082-85222104 AAAGGTCATAAGCTCAGATTTGG - Intergenic
1130625203 15:85507285-85507307 AACAGGCAGCAGGCTAGATTTGG - Intronic
1131374084 15:91909270-91909292 AACAGGCAGCAGGCCACATTTGG - Intronic
1131522611 15:93127554-93127576 TAAAGTCAGCAGGCAAGATCAGG + Intergenic
1131588861 15:93726685-93726707 AAAAGTCATGACGACAGAGTAGG + Intergenic
1131734772 15:95320353-95320375 AAAAGTCATAGGGCAAGATATGG + Intergenic
1131786866 15:95922751-95922773 AAAAGTCATCAGAACAGCTGAGG + Intergenic
1132065420 15:98727009-98727031 ATAATTCATCAGGCCAGGTGTGG - Intronic
1132330628 15:101009874-101009896 AAAAGAAATCAGGCCAGGTGCGG - Intronic
1133375891 16:5286867-5286889 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1133608095 16:7407849-7407871 AATAGTCCGCAGGCCAGATTAGG - Intronic
1134147813 16:11781310-11781332 AAAGGACAGCAGGCCAGATTGGG + Intronic
1134303923 16:13015140-13015162 AACAGGCGGCAGGCCAGATTTGG - Intronic
1134555406 16:15159877-15159899 AACAGACAGCAGGCCAGAGTTGG + Intergenic
1134666199 16:16020455-16020477 AACAGGCAGCAGGCCAGATTCGG - Intronic
1134690092 16:16185272-16185294 AAAAGGCAGCAGGCAGGATTTGG - Intronic
1135830900 16:25772104-25772126 ACAAGGCAGCAGGCTAGATTTGG + Intronic
1136499612 16:30663958-30663980 GAAAGTCATCTGGCCAGAGATGG + Intronic
1137961876 16:52889335-52889357 AAGTGTCATCTGGGCAGATTTGG - Intergenic
1138278610 16:55755399-55755421 AAAAGACAGTAGGCCAGATTTGG - Intergenic
1138289945 16:55838222-55838244 AAAAGACAGTAGGCCAGATTTGG + Intergenic
1141043719 16:80695110-80695132 AACAAACATCTGGCCAGATTTGG - Intronic
1141061747 16:80879267-80879289 AAAAGCCATCATGCTACATTAGG + Intergenic
1141885162 16:86886693-86886715 AACAGGCAGCAGGCAAGATTTGG - Intergenic
1142332673 16:89464945-89464967 AAAAGACATTGGGCCAGATTCGG - Intronic
1142608159 17:1093531-1093553 AAAAGTTATGGGGTCAGATTCGG + Intronic
1146119638 17:30180757-30180779 AACAGGCAACAGGCCAGATTTGG + Intronic
1148250280 17:46072385-46072407 AAAAGTCAACAGTTCAGTTTTGG + Intronic
1149201083 17:54186630-54186652 AAAAGGCATCAGGCTAGAGCAGG - Intergenic
1149322862 17:55499118-55499140 AAAAGACACCAGGACAGAGTTGG - Intergenic
1149327457 17:55546758-55546780 AAAAGACATGAGGCCAGATGTGG + Intergenic
1149573409 17:57693875-57693897 AATAGGCAACAGGCCTGATTTGG - Intergenic
1150026865 17:61685242-61685264 AACAGGCAGCAGGCCAAATTTGG + Intronic
1150161913 17:62905757-62905779 AAAAGGTGGCAGGCCAGATTTGG + Intergenic
1151669968 17:75566625-75566647 AATAGGCAGGAGGCCAGATTTGG + Intronic
1151725858 17:75883889-75883911 AAAAGTAAACAGGCCAGGTGCGG + Intronic
1153141305 18:1975461-1975483 AAGAGGCAACAGGCCATATTTGG + Intergenic
1153403039 18:4702190-4702212 AAGAGTCATCAGGCCTCATTAGG + Intergenic
1153443461 18:5146841-5146863 AACAGACCACAGGCCAGATTTGG + Intronic
1155901097 18:31391634-31391656 AACAGACAGCAAGCCAGATTTGG - Intronic
1156086496 18:33411424-33411446 AAAAGGCTGCTGGCCAGATTTGG + Intronic
1156224158 18:35086175-35086197 AAAACACATCAAGCCAGATTGGG - Intronic
1157018631 18:43751084-43751106 AACAAGCAACAGGCCAGATTTGG + Intergenic
1157268902 18:46254470-46254492 AACAGGCAGCAGGCCAGAATTGG - Intronic
1157632266 18:49110037-49110059 AACAGACAACAGGCCAGATTTGG - Intronic
1158350132 18:56556194-56556216 AAAAGTAATGAGGCCAGGTGTGG - Intergenic
1160430164 18:78805502-78805524 GAAAGTCATCAGGACAGGTCAGG - Intergenic
1160712472 19:558914-558936 AACTGACCTCAGGCCAGATTGGG + Intergenic
1161127207 19:2564898-2564920 AAAAAGAATCAGGCCAGATGCGG + Intronic
1161214070 19:3084522-3084544 GAAAATCATCAGGCCAGGCTTGG - Intergenic
1161255835 19:3309021-3309043 AAAAACCAACAAGCCAGATTAGG - Intergenic
1163409172 19:17142835-17142857 AACAAGCATCAGACCAGATTTGG + Intronic
1164191151 19:22918345-22918367 AAAAGTCATGAGGCCGCCTTGGG - Intergenic
1164850701 19:31481019-31481041 AATAGGCAGCGGGCCAGATTTGG + Intergenic
1165526865 19:36363537-36363559 AAAAGACATCCGGCCATATCTGG + Intronic
1166320061 19:42012132-42012154 AATAGACAGCAGGTCAGATTTGG - Intronic
1167627464 19:50601935-50601957 AAAAGTCATGAGGCAAGACGCGG - Intergenic
1167711013 19:51110935-51110957 AACAGGCAGCAGGCCCGATTTGG + Intergenic
1168411835 19:56145095-56145117 AACAGGCTGCAGGCCAGATTCGG + Intronic
924963121 2:51976-51998 AACATTTATCAGGCCAGATTTGG + Intergenic
925529545 2:4844124-4844146 AAAAGTCACCAGGAAAAATTGGG + Intergenic
928649866 2:33392615-33392637 AATAGGTAGCAGGCCAGATTTGG + Intronic
928791097 2:34954979-34955001 AAAAGGTAACAGGTCAGATTTGG - Intergenic
929196433 2:39189605-39189627 AACAGGCAGTAGGCCAGATTTGG - Intronic
929470806 2:42190951-42190973 AACAGTTGACAGGCCAGATTTGG + Intronic
929987992 2:46756467-46756489 AACAGGCCACAGGCCAGATTTGG + Intronic
931008071 2:57875499-57875521 AAAAGTCAGCACTCAAGATTTGG + Intergenic
931119926 2:59205086-59205108 AACAGGCATCAGGTCTGATTTGG + Intergenic
931649023 2:64452328-64452350 AAAAGTAATAAGGCCAGGTGCGG - Intergenic
932064789 2:68543358-68543380 AAAAAGCAGTAGGCCAGATTTGG + Intronic
932848153 2:75155900-75155922 AATAGGCAGCAGGCCAGCTTTGG - Intronic
933189523 2:79318670-79318692 AACAGGCAGCAGGCTAGATTTGG - Intronic
933396202 2:81734368-81734390 AATAGTCAGTGGGCCAGATTTGG + Intergenic
933495871 2:83049611-83049633 AAAATTCAGCAGGGCACATTGGG - Intergenic
934862672 2:97777417-97777439 AACAGACTGCAGGCCAGATTTGG - Intronic
935604992 2:104962540-104962562 AAAAGACAACAGGCCAGATGCGG - Intergenic
935980819 2:108625130-108625152 AAAAGGCAGCAGGCCAGATTTGG - Intronic
935999671 2:108814924-108814946 AAAAATCTGCAGGCCAGATGTGG - Intronic
937164860 2:119803896-119803918 AAAATTCATAAGAACAGATTAGG - Intronic
937177303 2:119952715-119952737 ACAAGTCAGCTGTCCAGATTGGG - Intronic
938707474 2:133945016-133945038 AAAAGTCAACAGGCCTGAGAGGG - Intergenic
938953555 2:136278781-136278803 AATAGTCTTCAGGCTGGATTTGG + Intergenic
939659513 2:144870789-144870811 AATAGTCAGTGGGCCAGATTTGG + Intergenic
940450753 2:153833722-153833744 AACAAGCAGCAGGCCAGATTTGG + Intergenic
940898153 2:159101086-159101108 AAAAGTCATCAAGGTAGTTTCGG - Intronic
941677483 2:168359241-168359263 AACAGACAGCAAGCCAGATTAGG - Intergenic
942040732 2:172059675-172059697 AACAGTCAGCAGTCCAGATTTGG + Intronic
942758874 2:179374390-179374412 AAAAGTCCTCAGGTTAGATCAGG + Intergenic
943652046 2:190467672-190467694 AACAGGCAGCAGGCCAGATTTGG - Intronic
943786592 2:191884246-191884268 AAAAGTCATCAGGGGAAATTTGG - Intergenic
943949391 2:194111322-194111344 ATAAGTGATCAGGCCACTTTTGG + Intergenic
944420380 2:199523834-199523856 AAAATTCATCTGGACAGATTTGG - Intergenic
944564712 2:200977559-200977581 AAAAATCTTCAGGCCAGGTGTGG + Exonic
946189760 2:218002111-218002133 AAAAGTCTTAAGGCCAGACCTGG - Intronic
946504922 2:220288626-220288648 AAAAATCATCATCCCACATTTGG + Intergenic
946842100 2:223829289-223829311 AACAGGCAGAAGGCCAGATTTGG - Intronic
947190888 2:227503466-227503488 AACAGGCAACAGGCCAAATTTGG - Intronic
948228287 2:236330243-236330265 AACAGACAACAGGCCAAATTTGG - Intronic
948240706 2:236430995-236431017 AACAGGCACCAGGCCAGATTTGG - Intronic
948982670 2:241502445-241502467 TAAACTCATCAGGCCAGGCTTGG + Intronic
1168781595 20:496223-496245 AGCAGACATCAGGCCAAATTTGG - Intronic
1168866224 20:1089329-1089351 AACAAGCAGCAGGCCAGATTTGG + Intergenic
1169109799 20:3025046-3025068 AGCAGGCAGCAGGCCAGATTTGG + Intronic
1169837910 20:9900941-9900963 AAGAGGCAGCAGGCCAGATTTGG - Intergenic
1170092949 20:12612523-12612545 AAGAGGCAGCAGGCCAGGTTTGG - Intergenic
1170187605 20:13608721-13608743 ACCAGGCATCTGGCCAGATTTGG + Intronic
1173159623 20:40642808-40642830 AAAAGGCAGTAGGCCACATTTGG + Intergenic
1173219948 20:41124512-41124534 AAAGGGCCTCAGGCCAGAGTTGG + Intergenic
1173451107 20:43164891-43164913 AACAGGCAGCAGGCCAGATCTGG + Intronic
1173971993 20:47160400-47160422 AACAGGCGACAGGCCAGATTTGG + Intronic
1173991857 20:47309725-47309747 AAAACTCCTCAGGCCACATGGGG + Intronic
1174911432 20:54612198-54612220 AACAGTCAGCAGGCTGGATTTGG + Intronic
1175125449 20:56748007-56748029 AACAGACATCTGGCCAGATTTGG - Intergenic
1175760889 20:61561613-61561635 AACAGGCAGCAGGCCAGATTGGG - Intronic
1177271482 21:18853875-18853897 AAATGTCATCAGCCCACATCAGG + Intergenic
1177406525 21:20674685-20674707 AACAGACAGCAGGCCAGATTTGG + Intergenic
1177607986 21:23407156-23407178 AACAGGCAGCAAGCCAGATTTGG + Intergenic
1177925107 21:27204354-27204376 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1178465507 21:32843888-32843910 GAAAGTCATTAGGCAATATTAGG - Intergenic
1179298234 21:40082168-40082190 AAAAGTCATTAGGCCAGGTGTGG + Intronic
1179420739 21:41234386-41234408 AACAGGCAGCAGGTCAGATTTGG - Intronic
1180662950 22:17484884-17484906 AAAGGACATCAGGCCAGATTTGG + Intronic
1181505701 22:23355268-23355290 AAAAGACAGTGGGCCAGATTTGG - Intergenic
1181587065 22:23858494-23858516 TAAAGAAATCAGTCCAGATTGGG - Intronic
1182130464 22:27846533-27846555 AACAGGCAGCAGGCCAGATTTGG - Intergenic
1182141573 22:27964140-27964162 AAGCGTCATCAGGCCAGGTGCGG + Intergenic
1182307785 22:29383086-29383108 ATAGGTCAACAGGCCAGATATGG - Intronic
1182733854 22:32516654-32516676 AAAAGGTATCAGGCCAGGTGTGG - Intronic
1183026740 22:35070996-35071018 AACAGGGGTCAGGCCAGATTTGG + Intronic
949345593 3:3073379-3073401 AACAGGCAACAAGCCAGATTTGG - Intronic
951258180 3:20475373-20475395 AACTGTCAGCAGACCAGATTAGG + Intergenic
951277135 3:20701604-20701626 AAAAGGCATCAGTCCAGTTTTGG - Intergenic
951703419 3:25520007-25520029 AACAGGCAGCAGGCCAGATTTGG - Intronic
951989938 3:28665184-28665206 AACAGTCCACAGGCCAGATGTGG - Intergenic
954975110 3:54686144-54686166 AATAGGCAGCAGGCCAGACTTGG - Intronic
955037930 3:55286946-55286968 AAAGGGCAGCAGGCCAGATTTGG + Intergenic
955591723 3:60543233-60543255 AACAGGCAGCAGCCCAGATTTGG + Intronic
955824648 3:62932807-62932829 AAAAGTCATTAGCCCAGTGTAGG + Intergenic
955830308 3:62994520-62994542 AACAGTCCACAGGCCAGATTTGG + Intergenic
956721175 3:72118875-72118897 CAGAGGCAGCAGGCCAGATTTGG - Intergenic
956770079 3:72518166-72518188 AACAGGCAGCAGGCCAGATTTGG + Intergenic
956865499 3:73364992-73365014 AACAGGCATCAGGCTGGATTTGG - Intergenic
957066182 3:75524325-75524347 AACAGTCAGAGGGCCAGATTTGG - Intergenic
957110326 3:75947377-75947399 AACAGGCAGCAGGCCAGATCTGG - Intronic
957507135 3:81136533-81136555 AAAAGTTATCAGTACAGATTTGG + Intergenic
959890753 3:111552673-111552695 AATAGGCAACAAGCCAGATTTGG + Intronic
960670459 3:120150844-120150866 AACAGGCAGCAGGCTAGATTTGG + Intergenic
960765577 3:121126211-121126233 AACAGGCAGCATGCCAGATTTGG - Intronic
960980838 3:123224204-123224226 AATAGTCAGCAGGCTAGATTTGG + Intronic
961286961 3:125813714-125813736 AACAGTCAGAGGGCCAGATTTGG + Intergenic
961472328 3:127123710-127123732 AATAGGCAACAGGCCAGATTTGG + Intergenic
961776016 3:129286117-129286139 AACAGGCAGTAGGCCAGATTTGG - Intronic
962341869 3:134592667-134592689 AAAAGTCAGCCAGCCAGGTTTGG + Intergenic
962541508 3:136387301-136387323 AAAACACATCAGGTCAGATTTGG + Intronic
963081415 3:141398135-141398157 AACAGGTATCAGGCCAGATGTGG + Intronic
964441964 3:156721069-156721091 GATAGGCAGCAGGCCAGATTTGG + Intergenic
964584098 3:158276277-158276299 ACAATTTATCAGGCCAGATGGGG + Intronic
965917916 3:173873377-173873399 AAAATTCATCAGGCCAGGTGTGG - Intronic
965984206 3:174732034-174732056 AACAGGCATCCGGCCAAATTTGG + Intronic
966061891 3:175767919-175767941 AACAGTCATCATGCAGGATTTGG - Intronic
966672518 3:182543729-182543751 AATAGGCAGCAGGCTAGATTTGG + Intergenic
966844887 3:184120863-184120885 AAAAAACAGCAGGCCAGGTTGGG + Intergenic
969802653 4:9581580-9581602 AACAGTCAGAGGGCCAGATTTGG + Intergenic
970568631 4:17357418-17357440 AATAGGTAGCAGGCCAGATTTGG - Intergenic
971092169 4:23358580-23358602 AACAGTCAGCAAGCTAGATTTGG - Intergenic
971505682 4:27364330-27364352 AAAAGACATCCGTTCAGATTTGG - Intergenic
972435218 4:39027179-39027201 AATAGTCATAAGGCCTTATTGGG + Intronic
972458142 4:39274176-39274198 AAAAGTCAGAGGGCTAGATTTGG + Intronic
973164855 4:47064342-47064364 AGAAGTTATCAGGCCAGGTGCGG + Intronic
973883305 4:55295556-55295578 AAAAGAATTCAGGCCAGATGCGG - Intergenic
975328696 4:73089383-73089405 AACAGGCAGCAGGCCAAATTTGG + Intronic
976084146 4:81389926-81389948 AACAGGCAGCAGGCCAGACTTGG + Intergenic
978192157 4:105926383-105926405 AAATGTCATCGTGCCAGACTCGG - Intronic
978689887 4:111495035-111495057 AAAACTCTTCTGGGCAGATTTGG - Intergenic
979934705 4:126677031-126677053 AACAGGTAGCAGGCCAGATTTGG + Intergenic
981124921 4:141094621-141094643 AACAGGCCTCAGGCCAGATTTGG + Intronic
982596611 4:157393722-157393744 AATAATCCTCAGGCCACATTTGG - Intergenic
983198296 4:164832893-164832915 AATAAGTATCAGGCCAGATTTGG + Intergenic
983304706 4:165971480-165971502 AAAAATCAGCAGGCAAGATAAGG - Intronic
985843228 5:2325461-2325483 AAAACTCATCAGGCGAGTTCAGG + Intergenic
986341092 5:6790048-6790070 AACAGGCAACAGGTCAGATTTGG - Intergenic
986448874 5:7847602-7847624 AATAGGCAACTGGCCAGATTTGG + Intronic
987287431 5:16471073-16471095 AACAGGTAGCAGGCCAGATTTGG + Intergenic
988555583 5:32233137-32233159 AACAGGCGCCAGGCCAGATTTGG - Intronic
989242925 5:39220811-39220833 AACATTCCACAGGCCAGATTTGG - Intronic
990422060 5:55645456-55645478 AACAGACATCAGACAAGATTTGG - Intronic
991098313 5:62762934-62762956 AAATGTCAGCAGGCTACATTTGG - Intergenic
992570016 5:78045893-78045915 AATAGGCAGCAGGCCATATTTGG - Intronic
992594087 5:78328028-78328050 AACAGGCATTGGGCCAGATTTGG + Intergenic
992691832 5:79248179-79248201 AAAAGTTAAAAGGCCAGATGCGG - Intronic
993254213 5:85566730-85566752 AATAGTCCACAGGCCAGATTTGG - Intergenic
993617114 5:90126538-90126560 AAAAGTAATCAAGCCAAAATTGG - Intergenic
994065430 5:95534944-95534966 ACAAATCATCATGCCATATTGGG + Intronic
994370318 5:98960133-98960155 AAAAGTCATCAGGTTTGTTTGGG - Intergenic
994900894 5:105767878-105767900 GACAGGCATCAGGCCAGATTTGG - Intergenic
996813710 5:127549695-127549717 AAAAGATGACAGGCCAGATTTGG - Intronic
997123952 5:131206841-131206863 AAAAGGCAGCAAGTCAGATTTGG - Intergenic
997801548 5:136867680-136867702 TAAAGTCAACAGGTCATATTTGG - Intergenic
998852280 5:146362760-146362782 AACAGGCAGCAGGCCAGCTTTGG + Intergenic
999385270 5:151149772-151149794 AAAAGAGATCAGGCCAGGCTTGG - Intronic
1000672246 5:164077211-164077233 AAAATTCCTCAGGCCAGCTGTGG + Intergenic
1000950885 5:167481256-167481278 AACAGGCAGCAGGCCATATTTGG - Intronic
1001006048 5:168051289-168051311 AACAGGCAGCTGGCCAGATTTGG - Intronic
1001014603 5:168128694-168128716 AACAGGCAGCAGGCCAGATTTGG - Intronic
1001321385 5:170685133-170685155 AAAAGTCTTAGGGCCAAATTGGG - Intronic
1001893365 5:175358195-175358217 CAGAGTCATCAGGCTGGATTTGG + Intergenic
1002357661 5:178643844-178643866 AACAGTCAGCAGGCCAGATTTGG - Intergenic
1003252596 6:4443856-4443878 AAAAATCACCAGGCTAGATGTGG - Intergenic
1004568710 6:16824137-16824159 AACAGGCAGCAGGCCAGAATTGG - Intergenic
1004725759 6:18309777-18309799 TAAAATCATCAGGCCAGATGTGG + Intergenic
1004835313 6:19524465-19524487 AACAGGCAACAGGGCAGATTTGG - Intergenic
1006827338 6:36945604-36945626 AAAAGTTATCAGGCCAGGCTTGG + Intergenic
1007750593 6:44068463-44068485 AAAAGGGATCAGGCCAGGGTGGG - Intergenic
1007992216 6:46268880-46268902 AATAAGCATCAGGCCAGACTGGG - Intronic
1010050599 6:71499423-71499445 ATAAGTCATCTGGCCTTATTTGG + Intergenic
1012027137 6:94010024-94010046 AAAAGTGCTCAGGCCAGGTGCGG + Intergenic
1012193211 6:96306560-96306582 AAAAGACTTCAGGCCAGGTGTGG - Intergenic
1013258955 6:108418241-108418263 AACAGGCAGCAGGCCAGATTTGG - Intronic
1013400587 6:109792138-109792160 AAAAGGCATCAGGCTGGATTTGG - Intronic
1013416813 6:109932912-109932934 AAAAGGTGACAGGCCAGATTTGG - Intergenic
1014450543 6:121576729-121576751 ATAAGTCACCAGTCCAGATGGGG - Intergenic
1014593710 6:123306212-123306234 AAATGTTCTCAGGGCAGATTTGG - Intronic
1015170049 6:130242365-130242387 AACAGGCAGTAGGCCAGATTTGG + Intronic
1015283521 6:131459201-131459223 AACAGGCAGCAGACCAGATTTGG + Intergenic
1015989662 6:138925053-138925075 AAAAGACATCAGGCCAGGTGTGG + Intronic
1017747466 6:157459782-157459804 AAAAGTCATCTGGCCAGGCATGG + Intronic
1017832993 6:158148731-158148753 AAAATTAATCAGGCCAGGTATGG - Intronic
1018025552 6:159802871-159802893 AAAAGACTTCAGGCCAGGTGCGG - Intronic
1018044895 6:159957118-159957140 AACAGGCAGCTGGCCAGATTTGG - Intergenic
1020417269 7:7960493-7960515 AAAAGTAGTCAGGCCAGGTCAGG + Intronic
1020925768 7:14322131-14322153 AACAGGCAGCAGGCCAGATCTGG - Intronic
1021510698 7:21428813-21428835 AAAATTCATCACGACACATTAGG + Intronic
1021664643 7:22963747-22963769 AACAGGCATCAGGCCAGACTGGG + Intronic
1021883776 7:25118638-25118660 AACAGGCATCTGGTCAGATTGGG + Intergenic
1023532046 7:41168074-41168096 AACAGGCATCAGGCTGGATTTGG - Intergenic
1023678163 7:42652559-42652581 AAAAGGCAATAGGCCAGGTTTGG - Intergenic
1024250025 7:47499116-47499138 CAAAGTCAGCAAGCCACATTTGG - Intronic
1026197128 7:68182839-68182861 AAAAGTCAAGAAGCCAAATTTGG - Intergenic
1026291053 7:69006515-69006537 AACGGGCATCAGGCCAGATTTGG - Intergenic
1028194117 7:87885510-87885532 AAAAGGCAACAGACTAGATTTGG - Intronic
1028340401 7:89712380-89712402 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1029576585 7:101407424-101407446 AAAAGTCATCACCCGGGATTTGG - Intronic
1031025728 7:116677602-116677624 GAAAGTCTGCAAGCCAGATTGGG + Intronic
1031356139 7:120789358-120789380 AAAAGGCATTAGGCCAGATCTGG + Intronic
1031492956 7:122411508-122411530 AAAAGTAATAAGGCCAGGTGCGG - Intronic
1032214917 7:129950526-129950548 AAAAGGCATCAGGTCAAGTTAGG + Intronic
1034877296 7:154736526-154736548 AAGAGACAGCAAGCCAGATTTGG + Intronic
1035491377 7:159281787-159281809 ACCAGTCATCAGGCCAGCTTTGG + Intergenic
1036214575 8:6868358-6868380 AACAGGCAGCAAGCCAGATTTGG - Intergenic
1036248481 8:7141271-7141293 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1036252325 8:7173066-7173088 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1036365169 8:8114394-8114416 AACAGTCAGAGGGCCAGATTTGG + Intergenic
1036738335 8:11339474-11339496 AACAGGCAGCGGGCCAGATTTGG - Intergenic
1036893387 8:12610793-12610815 AACAGTCAGAGGGCCAGATTTGG - Intergenic
1039104068 8:33971216-33971238 AATAGGCTGCAGGCCAGATTTGG - Intergenic
1039753566 8:40498764-40498786 AAATGTCAGTGGGCCAGATTTGG - Intergenic
1041294469 8:56340289-56340311 AAAAATCATCAAGCCACTTTGGG + Intergenic
1042330909 8:67579677-67579699 AACAGGCAGCAGGCCAGATATGG - Intronic
1043326311 8:79056175-79056197 AATAGGCAGCAGGCTAGATTTGG + Intergenic
1044313240 8:90719529-90719551 AACAGGTAGCAGGCCAGATTTGG + Intronic
1044343808 8:91079333-91079355 ACAAGTCATATGGCCAGAATGGG + Intronic
1045032675 8:98152660-98152682 AACAGACAGCAGGCCACATTTGG + Intronic
1045824086 8:106376239-106376261 AAAAATCAACAGGACAGAATGGG - Intronic
1046364305 8:113205969-113205991 AAAGGGCATCAGGCCATATTTGG - Intronic
1046885945 8:119367274-119367296 AACAGTCAGCAGACCAAATTTGG + Intergenic
1047096051 8:121626921-121626943 AAAAGTTCTCAAGCCTGATTAGG + Intronic
1047153276 8:122288662-122288684 AAAAATCATTAGCACAGATTTGG - Intergenic
1050243524 9:3662480-3662502 AAAAGTCAACAAGCCATATTGGG - Intergenic
1051677056 9:19569261-19569283 AACAGGCTGCAGGCCAGATTTGG + Intronic
1051731646 9:20149752-20149774 AACAGGCAGCAGGCCACATTTGG + Intergenic
1052480266 9:29015555-29015577 AATAGACAGCAGGTCAGATTTGG + Intergenic
1053214518 9:36259208-36259230 AAAAGTCTTAAAGCCTGATTCGG - Intronic
1053510719 9:38685917-38685939 AAATGTTATCAGGCCATACTTGG + Intergenic
1055590483 9:77807961-77807983 AATAGGCAGCAGGCCAAATTTGG + Intronic
1056874672 9:90316646-90316668 AAAAGGAATCAGGCCAGGTGTGG + Intergenic
1059807385 9:117817292-117817314 TAAAAACAGCAGGCCAGATTTGG - Intergenic
1059819459 9:117956122-117956144 GAAAGTCATCCGGTCACATTAGG + Intergenic
1060954898 9:127631729-127631751 AAAAGTCACGAGGCCAGGTGCGG + Intronic
1061538537 9:131264698-131264720 AAAAGGCTTCAGGTCAAATTAGG - Intronic
1061760715 9:132849314-132849336 AGCAGGCAGCAGGCCAGATTTGG - Intronic
1186052972 X:5619088-5619110 AAAGGTCATCAGGCCAGGAGGGG - Intergenic
1186637585 X:11422957-11422979 AAAAGTAAGCATGCCAGGTTGGG + Intronic
1186706342 X:12143264-12143286 AACAGTCAGCAAGCCAGATTTGG - Intronic
1186896322 X:14007962-14007984 AACAGACTGCAGGCCAGATTTGG - Intergenic
1187027885 X:15455022-15455044 AAAAGGAATCAGGACAAATTAGG - Intronic
1187694924 X:21909830-21909852 AAAAGTCATCAGTCCAAAAGAGG + Intergenic
1187729324 X:22236574-22236596 AACAGGCAGCAGGCCATATTTGG - Intronic
1188015249 X:25101183-25101205 AAAATCCATGAAGCCAGATTGGG + Intergenic
1188253336 X:27927515-27927537 AGAAGTCACAATGCCAGATTTGG + Intergenic
1188323160 X:28765333-28765355 AAAAGTCAGTGGGCTAGATTTGG + Intronic
1188338485 X:28969321-28969343 AAAATTCAGGAAGCCAGATTGGG - Intronic
1188522458 X:31053953-31053975 AAGAGTTAGCAGACCAGATTTGG + Intergenic
1190462120 X:50687365-50687387 ACTAGTTAGCAGGCCAGATTTGG + Intronic
1192342662 X:70277187-70277209 AACAGGCATCAGGCCAGATTTGG + Intronic
1192531395 X:71889949-71889971 AATTGACACCAGGCCAGATTTGG - Intergenic
1192778166 X:74266500-74266522 AAAAATAATCAGGCCAGGTGTGG - Intergenic
1192895691 X:75440787-75440809 AAAGGCCATCAGGGCAGGTTAGG + Intronic
1192903626 X:75525419-75525441 AAAAGTCAGTGGGCCATATTTGG - Intergenic
1193135909 X:77970378-77970400 ACAAGTCATTAGGCCAGGTGTGG + Intronic
1193743088 X:85242404-85242426 AACAGGCAGCAGTCCAGATTTGG - Intergenic
1194069343 X:89300824-89300846 AAAAGTCATCAGAACAGAAATGG + Intergenic
1194676632 X:96802377-96802399 AATAGGCTTCAGGCTAGATTTGG + Intronic
1195425843 X:104729429-104729451 AAAAGGCAGCAGGCCCTATTTGG - Intronic
1196108519 X:111921307-111921329 AACAGTTGACAGGCCAGATTTGG + Intronic
1196911686 X:120490211-120490233 AGAAGCCATCAGGTCAGACTTGG + Intergenic
1197300780 X:124777989-124778011 AACAGTCGATAGGCCAGATTTGG + Intronic
1201224249 Y:11802163-11802185 AAAAGAAATCAGGCCAGGTGCGG + Intergenic
1202580137 Y:26371824-26371846 AAAAGAAATCAGGCCAGGTGTGG + Intergenic