ID: 1097889230

View in Genome Browser
Species Human (GRCh38)
Location 12:64760288-64760310
Sequence AGCGTGAGCCACCGCGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 6, 2: 50, 3: 148, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097889230_1097889233 0 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889233 12:64760311-64760333 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1097889230_1097889240 23 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889240 12:64760334-64760356 CGGGTGGATCACCTGAGGTCAGG 0: 13130
1: 55640
2: 86423
3: 98097
4: 93725
1097889230_1097889231 -4 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889231 12:64760307-64760329 CGCTTGTAATCCCAGCACTTTGG 0: 4214
1: 133667
2: 277190
3: 221574
4: 152657
1097889230_1097889234 3 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889234 12:64760314-64760336 AATCCCAGCACTTTGGGAGGCGG 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
1097889230_1097889239 18 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889239 12:64760329-64760351 GGAGGCGGGTGGATCACCTGAGG 0: 170
1: 10756
2: 46492
3: 81402
4: 95133
1097889230_1097889238 7 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889238 12:64760318-64760340 CCAGCACTTTGGGAGGCGGGTGG 0: 117
1: 639
2: 4081
3: 5478
4: 4498
1097889230_1097889232 -3 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889232 12:64760308-64760330 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013
1097889230_1097889235 4 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889235 12:64760315-64760337 ATCCCAGCACTTTGGGAGGCGGG 0: 2878
1: 3400
2: 2456
3: 2522
4: 3989

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097889230 Original CRISPR AGCGTGAGCCACCGCGCCCA CGG (reversed) Intergenic
900486709 1:2926126-2926148 GGCCTGAGCCACTGCTCCCAGGG + Intergenic
901550909 1:9995747-9995769 GGTGTGAGCCACCGCACCCGCGG - Intergenic
901607833 1:10473374-10473396 GGGGTGAGCCACCGCCCCCGGGG - Intronic
901691922 1:10979271-10979293 GGTGTGGGCCACCGCACCCAGGG + Intronic
901801872 1:11712918-11712940 GGCATGAGCCACCATGCCCAGGG - Intronic
902533689 1:17106720-17106742 GGCGTGAGCCACCCTGGCCAAGG + Intronic
903205719 1:21781137-21781159 GGCGTGAGCCACCGCCCGCCAGG - Intronic
904030482 1:27530406-27530428 GGCGCGCGCCACTGCGCCCAAGG + Intergenic
904100118 1:28018884-28018906 GGCGTGAGCCACCACGCACCTGG - Intronic
904141530 1:28357365-28357387 GGCGTGAGCCACCGTGCCCCCGG - Intergenic
904240556 1:29141901-29141923 GGCGTGAGTCACCGCGCCCCAGG + Intergenic
904678661 1:32214028-32214050 CGTGTGAGCCATCGTGCCCAAGG - Intronic
904705543 1:32387618-32387640 GGCGTGAGCCACCCAGCCTAAGG + Intronic
905553365 1:38861094-38861116 AGCGTGAGCCACCGCGCGGCCGG - Intronic
905579680 1:39074763-39074785 GGCGTGAGCCACCGTTCCCGGGG + Intergenic
906496855 1:46310786-46310808 GGCATGAGCCACCGCGCCCTAGG - Intronic
906633270 1:47390272-47390294 GGCGTGAGCCACCGCACCCAGGG - Intergenic
907014479 1:50998635-50998657 GTCGTGAGCCACCGCGCACCTGG - Intergenic
907101037 1:51835744-51835766 GGCGTGAGCCACCTCACCCAGGG + Intronic
907883693 1:58574592-58574614 GGTGTGAGCCACTGCACCCAGGG - Intergenic
908537177 1:65089428-65089450 GGCGTGAGCCACCATGCCCAGGG - Intergenic
908849002 1:68355117-68355139 AGGGTGTGCCACCGCACCTAGGG - Intergenic
910995899 1:93104399-93104421 GGCCTGAGCCACAGCGCCCGGGG - Intronic
911925088 1:103819176-103819198 GGCGTGAGCCACCACACCCAGGG - Intergenic
911999053 1:104807174-104807196 GGCGTGAGCCACCACACCCGGGG + Intergenic
913001211 1:114582304-114582326 GGCGTGAGCCACTGCACCCCGGG + Intergenic
914843998 1:151270724-151270746 GGCATGAGCCACCTTGCCCATGG + Intergenic
915059504 1:153169284-153169306 GGCATGAGCCACCGCGACCCCGG - Intergenic
915160353 1:153915145-153915167 GGCGTGAGCCACCGCCTCCCGGG - Intronic
915739439 1:158107341-158107363 GGCGTGAGCCACCGCGTATAGGG + Intergenic
916222338 1:162457436-162457458 GGCGTGAGCCACCGCGCGCGCGG + Intergenic
918452783 1:184675877-184675899 GGCGTGAGCTACCGCGCACCCGG + Intergenic
919828607 1:201522160-201522182 GGCGTGAGGCACTGCGCCCCCGG + Intergenic
920889588 1:209970957-209970979 GGTGTGAGCCACTGCGCCCAGGG + Intronic
921345833 1:214184292-214184314 GGCGTGAGCCACCGCGCGCCCGG + Intergenic
922657699 1:227400621-227400643 GGCGTGAGCCACCACACCCAGGG + Intergenic
923480705 1:234380747-234380769 GGCGTGAGCCACCACTCCCAAGG + Intronic
923716945 1:236433275-236433297 GGCATGAGCCACCGCGCCCAGGG - Intronic
924128778 1:240883794-240883816 GGCATGAGCCACCATGCCCAGGG - Intronic
1065836863 10:29666195-29666217 AGCGTGAGCCACCGTGTACCTGG + Intronic
1067481216 10:46598858-46598880 GGCGTGAGCCACTGCGCCCGGGG + Intergenic
1067485858 10:46649160-46649182 GGCGTGAGCTACCGTGCCCATGG - Intergenic
1067608898 10:47692493-47692515 GGCGTGAGCTACCGTGCCCATGG + Intergenic
1067613535 10:47742873-47742895 GGCGTGAGCCACTGCGCCCGGGG - Intergenic
1069904525 10:71724579-71724601 GGCGTGAGCCACCGTGCCCCTGG + Intronic
1071624484 10:87154135-87154157 GGCGTGAGCCACCGTGCCCATGG + Intronic
1072707761 10:97694063-97694085 AGCGTGCGCCACCAAGCCCAGGG - Intergenic
1073521827 10:104138394-104138416 AGCCTGAGCCACCGTGCCACCGG - Intronic
1074510284 10:114105151-114105173 GGTGTGAGCCACCGCGCCTGGGG + Intergenic
1075044739 10:119138123-119138145 GGCATGAGCCACCGCGCCCTTGG - Intergenic
1075104873 10:119532433-119532455 GGCATGAGCCACCGCGCCCACGG - Intronic
1075247885 10:120840291-120840313 GATGTGAGCCACCGCGCCCGAGG - Intergenic
1075911903 10:126132250-126132272 GGCGTGAGCCACCGCGCCCCCGG + Intronic
1076023545 10:127093631-127093653 GGTGTGAGCCATCGCACCCATGG + Intronic
1076428888 10:130387974-130387996 GGCGTGAGCCACCGCGCCTGGGG + Intergenic
1077029187 11:456070-456092 AGCCAGAGCCACCGCGCTCCTGG + Intronic
1077258080 11:1598127-1598149 AGCCAGAGCCACAGCCCCCACGG + Exonic
1078251179 11:9617719-9617741 GACGTGAGCCACAGCGCCCTGGG + Intergenic
1078358150 11:10648082-10648104 GGCGTGAGCCACCGGGCCCAGGG - Intronic
1079011135 11:16829292-16829314 AGCGTGAGCCACCCTGCCGGGGG + Intronic
1080302502 11:30799943-30799965 GGCGTGAGCCACCACACCCAGGG + Intergenic
1080986800 11:37477340-37477362 GGTGTGAGCCACCGCGCACGGGG + Intergenic
1081844292 11:46227996-46228018 GGCGTGAGCCACCACGCCCTTGG - Intergenic
1082023277 11:47552754-47552776 AGCGCGTGCCCCCGCGCCCAGGG - Intronic
1083432985 11:62624453-62624475 GGAGTGAGCCACTGCGCCCTGGG - Intergenic
1083546735 11:63554350-63554372 GGTGTGAGCCACCGCCCCCCCGG - Intronic
1083695307 11:64438609-64438631 GGCGTGAGCCACCATGCCCCCGG + Intergenic
1083964361 11:66034293-66034315 GGCGTGAGCCACCACGCCCAAGG + Intergenic
1084395783 11:68909116-68909138 GGCGTGAGCCACCGTGCGCCTGG + Intronic
1084915303 11:72424614-72424636 GGCGTGAGCCACCACGCCCAGGG - Intronic
1085668540 11:78439316-78439338 GCCGTGAGCCACCGCACCCACGG + Intronic
1087494106 11:98867303-98867325 GGCATGAGCCACCATGCCCAGGG - Intergenic
1087800032 11:102493522-102493544 GGCGTGAGCCACTGCGCCTGGGG + Intronic
1088339041 11:108742286-108742308 GGCATGAGCCACCATGCCCAGGG - Intronic
1088481809 11:110301669-110301691 GGTGTGAGCCACCACACCCATGG - Intergenic
1088638822 11:111851197-111851219 AGCATGAGCCACCACGCCCAGGG - Intronic
1089203121 11:116737296-116737318 GGTATGAGCCACCGTGCCCAGGG - Intergenic
1089481502 11:118809223-118809245 AGCGTGAGCCACTGCACACCTGG - Intergenic
1090529649 11:127577295-127577317 GGCATGAGCCACTGCGCCCAGGG + Intergenic
1090890253 11:130916614-130916636 AGCGTGAGCCTGAGCGCGCACGG + Intergenic
1093653731 12:21673197-21673219 AGTGTGTCCCACCGCTCCCAGGG - Intronic
1093931320 12:24957384-24957406 GGCGTGAGCCACCGCGCCCGAGG + Intergenic
1094652745 12:32393506-32393528 GACATGAGCCACTGCGCCCAGGG - Intergenic
1095557622 12:43526175-43526197 GGCGTGAGCCACTGCGCGCCTGG - Intronic
1095773886 12:45991283-45991305 GGCGTGAGCCACCGCGCACCTGG - Intronic
1096623939 12:52881623-52881645 AACGTGAGCCACCCCGTCCCTGG + Intergenic
1097294372 12:57946733-57946755 GGCGTGAGCCACCGCGCCTGGGG + Intronic
1097889230 12:64760288-64760310 AGCGTGAGCCACCGCGCCCACGG - Intergenic
1099234753 12:80070607-80070629 GGTGTGAGCCACTGTGCCCAGGG - Intergenic
1100045484 12:90375465-90375487 GGTGTGAGCCACCATGCCCATGG - Intergenic
1101617526 12:106352876-106352898 GGCGTGAGCCAGTGTGCCCATGG - Intergenic
1103419081 12:120765555-120765577 GGCGTGAGCCACCATGCCCCTGG + Intronic
1103490607 12:121316452-121316474 GGCGTGAGCCACCGCGCCCGGGG - Intronic
1103641458 12:122355859-122355881 GGTGTGAGCCACCGCGCCAAAGG + Intronic
1103907644 12:124335653-124335675 AGAGTCAGGCACCGGGCCCAGGG + Intronic
1103964440 12:124629746-124629768 GGCATGAGCCACCGTGCCCCGGG + Intergenic
1104450841 12:128867112-128867134 GGCGTGAGCCACTGCGCCCAAGG - Intronic
1104695232 12:130858508-130858530 CGCGTGAGCCACCACACCCAGGG + Intergenic
1104709248 12:130973806-130973828 GGTGTGAGCCACCGCACCCCCGG - Intronic
1104991124 12:132624418-132624440 TGCGTGAGAAACGGCGCCCAGGG + Exonic
1105481120 13:20776706-20776728 GGCGTCAGCCACCGCGCGCCCGG + Intergenic
1106635557 13:31525195-31525217 GGCGTGAGCCACTGCACCCTTGG - Intergenic
1107505558 13:41029659-41029681 GGCGTGAGCCAAAGTGCCCAGGG + Intronic
1108348905 13:49572657-49572679 AGCGTGCGCCACCACACCCGGGG - Intronic
1108366491 13:49720937-49720959 GGTGTGAGCCACTGCCCCCACGG - Intronic
1108547204 13:51507962-51507984 GGCATGAGCCACCGTGCCCAGGG - Intergenic
1108560163 13:51635220-51635242 AGCGTGAGCTACTGCACCCCCGG + Intronic
1110185399 13:72668344-72668366 GGCGTGAGCCACCATGCCCTGGG - Intergenic
1112198322 13:97248412-97248434 GGCGTGAGCCACCGCACCCGGGG + Intronic
1112557585 13:100482739-100482761 GGCGTGAGCCACTGCACCCGTGG - Intronic
1112955628 13:105054454-105054476 GGCATGAGCCACCAGGCCCATGG + Intergenic
1113631280 13:111886370-111886392 GGTGTGAGCCACCGTGCCCCCGG - Intergenic
1116802248 14:49454901-49454923 GGCGTGAGCCACCCGGCCCCGGG + Intergenic
1116875540 14:50107574-50107596 GGCGTGAGCCACCGCGCGTGGGG + Intergenic
1116898725 14:50341497-50341519 AGTGTGAGCCGCTGTGCCCAGGG - Intronic
1117922665 14:60741636-60741658 GGCGTGAGCCACTGCGCCTGGGG + Intronic
1118289849 14:64509690-64509712 AGCGTGAGCCACCACACACCCGG - Intronic
1118928405 14:70215356-70215378 GGCGTGAGCCACCGCACCTGGGG + Intergenic
1118981178 14:70718297-70718319 GGCGTGAGCCACGGCACCCATGG + Intergenic
1119695451 14:76709643-76709665 GGCGTGAGCCACCGCACCAAGGG - Intergenic
1120224574 14:81776274-81776296 GGCGTGAGCTACCGCTCCCGGGG + Intergenic
1121507630 14:94488813-94488835 GGCGTGAGCCACCGCGCCCAAGG - Intronic
1123665123 15:22602907-22602929 GGCATGAGCCACTGCGCCCCTGG - Intergenic
1123752637 15:23369746-23369768 GGCATGAGCCACTGCGCCCCTGG + Intergenic
1123782400 15:23641527-23641549 GGCGTGAGCCACCGCACCCCCGG + Intergenic
1123911047 15:24967358-24967380 AGCGTGAGCCACCACGCCCAGGG - Intronic
1124318955 15:28697329-28697351 GGCATGAGCCACTGCGCCCCTGG - Intergenic
1124322693 15:28726763-28726785 GGCATGAGCCACCGCGCCCCCGG + Intronic
1124523524 15:30426897-30426919 GGCGTGAGCCACCGCGCCCCCGG + Intergenic
1124523602 15:30427341-30427363 GGCGTGAGCCACCGCGCCCCCGG + Intergenic
1124535065 15:30538874-30538896 GGCGTGAGCCACCGCGCCCCCGG - Intergenic
1124535143 15:30539317-30539339 GGCGTGAGCCACCGCGCCCCCGG - Intergenic
1124763510 15:32468280-32468302 GGCGTGAGCCACCGCGCCTCCGG + Intergenic
1124763585 15:32468727-32468749 GGCGTGAGCCACCGCGCCCCCGG + Intergenic
1124775041 15:32580324-32580346 GGCGTGAGCCACCGCGCCCCCGG - Intergenic
1124775118 15:32580769-32580791 GGCGTGAGCCACCGTGCCCCCGG - Intergenic
1125557413 15:40597890-40597912 GGCGTGAGCCACCGCGCCCAGGG - Intronic
1125835626 15:42748175-42748197 GGTGTGAGCCACCGTGCCCTGGG - Intronic
1125924194 15:43548745-43548767 GGCGTGAGCCACTGCACCCGGGG - Intronic
1126063486 15:44806572-44806594 AGCTTCAGCCACCTCTCCCAAGG + Intergenic
1126480814 15:49117965-49117987 GTCGTGAGCCACGGTGCCCAAGG - Intronic
1127529413 15:59829135-59829157 GGCGTGAGCCACCGCACCCGGGG - Intergenic
1127926503 15:63548605-63548627 GGCGTGAGCCACCTTGCCCAGGG + Intronic
1128119568 15:65135415-65135437 GGCGTGAGCCACCGTGCCCGTGG + Intergenic
1128320105 15:66687383-66687405 GGCGTGAGCCACCGCGCCCGGGG + Intergenic
1128680290 15:69646616-69646638 GGCGTGAGCCACCGCGCGCCCGG + Intergenic
1128834181 15:70795761-70795783 GGCATGAGCCACCGCGCCTGTGG - Intergenic
1129102543 15:73279626-73279648 GGCGTGAGCCACCACGCCCGGGG + Intronic
1129320597 15:74772597-74772619 GGTGTGAGCCACCGAACCCAGGG - Intergenic
1129353907 15:74974867-74974889 AGCGTGAGCCACCACACCCACGG - Intronic
1129440991 15:75580493-75580515 GGCGTGAGCCACCGCGCGCCTGG + Intergenic
1129986698 15:79924609-79924631 GGCGTCAGCCACCGCGCGCCCGG + Intergenic
1130073241 15:80666715-80666737 GGCTTGAGCCACCGCGCCCAGGG - Intergenic
1130118051 15:81022857-81022879 GGTGTGAGCCAACGCGCCTAGGG - Intronic
1130236642 15:82141388-82141410 GGCGTGAGCCACCGCTCTCCTGG - Intronic
1130942451 15:88522795-88522817 GGCATGAGCCACCGCGCACCCGG + Intronic
1131749098 15:95486864-95486886 GGCGTGCGCCACCACGCCCCGGG + Intergenic
1131822879 15:96291009-96291031 GGTGTGAGCCATCGTGCCCAGGG - Intergenic
1131936967 15:97517220-97517242 GGCGTGAGCCATTGTGCCCAGGG - Intergenic
1132030529 15:98435333-98435355 GGCGTGAGCCACCGCGCCCGGGG - Intergenic
1132243060 15:100275771-100275793 AGCGTCAGCCACTGGCCCCAAGG - Intronic
1132998645 16:2837924-2837946 GGCGTGAGCCACCGTGCCCAAGG - Intronic
1133133388 16:3692254-3692276 GGCGTGAGCCACCGCACCCCTGG - Intronic
1134125816 16:11615255-11615277 GGCGTGAGCCACCGCACCCAAGG - Intronic
1135407480 16:22208241-22208263 GGCCTGAGCCACCACGCCCCTGG - Intronic
1135680031 16:24448449-24448471 GGCGTGTGCCACAGCGCCCAGGG - Intergenic
1135957233 16:26966024-26966046 GGCGGGAGCCACCGCGCCCCAGG - Intergenic
1136154487 16:28374088-28374110 GGCGTGAGCCACCTCGCACCCGG + Intergenic
1136208604 16:28741176-28741198 GGCGTGAGCCACCTCGCACCCGG - Intergenic
1136343041 16:29657380-29657402 GGAGTGAGCCACTGTGCCCAGGG + Intergenic
1136473208 16:30495548-30495570 GGCATGAGCCACCGCACCCCAGG - Intronic
1137819331 16:51428558-51428580 GGCATGAGCCACTGCGTCCAGGG + Intergenic
1137892864 16:52180685-52180707 GGCGTGAGCCACCGCGCCAGGGG - Intergenic
1138566147 16:57834138-57834160 GGCGTGAGCCACCGCGCCCCGGG + Intronic
1138909557 16:61380112-61380134 GGCGTGAGCCTCCGCGCCTGGGG - Intergenic
1139521582 16:67485771-67485793 GGCGTGAGCCACCACCACCATGG - Intergenic
1139744267 16:69061738-69061760 GGCGTGAGCCACCGCGCGCCCGG - Intronic
1141085546 16:81092765-81092787 GGCATGAGCCACCACGCCCAGGG - Intronic
1142067946 16:88073416-88073438 TGCGGGGGCCACCGCGCCCATGG - Intronic
1142140677 16:88471440-88471462 AGCAGGAGCCACCGCAGCCATGG - Intronic
1142140705 16:88471547-88471569 AGCAGGAGCCACCGCAGCCATGG - Intronic
1142140732 16:88471654-88471676 TGTGGGAGCCACCGCGGCCACGG - Intronic
1142588821 17:991772-991794 GGTGTGAGCCACCGTGCCCCGGG - Intergenic
1142588846 17:991913-991935 GGTGTGAGCCACCGTGCCCCGGG - Intergenic
1142860403 17:2757399-2757421 GGCATGAGCCACCGTGCCCCTGG + Intergenic
1142945117 17:3420044-3420066 GGCATGAGCCACTGCGCCCGGGG + Intergenic
1143253139 17:5537312-5537334 AGTGAGAGCCACCTCACCCAAGG - Intronic
1144387066 17:14758623-14758645 GGCGTGAGCCACCGCGCACCCGG - Intergenic
1147689549 17:42306997-42307019 GGCGTGAGCCACCACGCCTGTGG + Intronic
1148116798 17:45180422-45180444 GGCGTGAGCCACCATGCCCGGGG - Intergenic
1148116874 17:45181031-45181053 GGCGTGAGCCACCATGCCCGGGG - Intergenic
1148843257 17:50512792-50512814 GGCATGAGCCAGTGCGCCCAGGG - Intronic
1149269890 17:54966894-54966916 GGCGTGAGCCACCATGCCCGTGG - Intronic
1149753164 17:59165297-59165319 GGCGTGAGCCACCGCGCGTCCGG + Intronic
1149895334 17:60424603-60424625 GGCATGAGCCACCGCACCCAGGG - Intronic
1149903810 17:60506756-60506778 GGCGCGAGCCACCGCGCCCGGGG - Intronic
1150009580 17:61491524-61491546 GGTGTGAGCCACTGCGCCCGTGG + Intergenic
1150589931 17:66553258-66553280 AGCGTGAGCCACCCTGCACCTGG + Intronic
1150658981 17:67059257-67059279 GGCGTGAGCCACCATGCCCGGGG + Intergenic
1150795232 17:68231348-68231370 GGCGTGAGCCACTGTGCCCAGGG + Intergenic
1151096487 17:71504771-71504793 AGAATGAGCCACCATGCCCAGGG + Intergenic
1151281455 17:73077957-73077979 GGCGTGAGCCACTGTGCCCTAGG - Intronic
1151547212 17:74800471-74800493 AGCGTCAGCCACTGTGCCCTGGG + Intronic
1151629836 17:75302981-75303003 GGCATCAGCCACCTCGCCCAAGG + Intergenic
1151774093 17:76186658-76186680 GGCGTGAGCCACTGCCCCCCCGG - Intronic
1152048401 17:77954022-77954044 ATTGTGAGCCACCACACCCAAGG - Intergenic
1152137172 17:78511385-78511407 GGCATGAGCCACCGCACCCCCGG + Intronic
1152277517 17:79366911-79366933 AGAGAGAGCCACCTCGCCCAAGG + Intronic
1153274406 18:3353643-3353665 AGCATGAGCCGCTGCGCCCGGGG + Intergenic
1153801562 18:8675592-8675614 GGCATGAGCCACCGCGCCTGGGG + Intergenic
1155114015 18:22746945-22746967 CACGTGAGCCACCGTGCCTAGGG - Intergenic
1155191181 18:23432401-23432423 GGCGTGAGCCACCGCGCATGGGG - Intronic
1155474836 18:26227055-26227077 AGCCTTAGTCACGGCGCCCAGGG - Exonic
1155969078 18:32064262-32064284 GGCATGAGCCACGGCGCCCAGGG + Intronic
1157262576 18:46188933-46188955 GGCGTGAGCCACCCCGCACCCGG - Intronic
1158044418 18:53138105-53138127 AGCATGAGCCATTGTGCCCAGGG + Intronic
1158587319 18:58752497-58752519 GGTGTGAGCCACCATGCCCAGGG - Intergenic
1160455048 18:78993826-78993848 AGCGCTAGCCTGCGCGCCCACGG - Exonic
1160658099 19:284074-284096 GGAGTGAGCCACCGCACCCCCGG - Intronic
1160734191 19:654361-654383 GGCCTGAGCCACCGCGCCCCCGG - Intronic
1160790590 19:921328-921350 GGCGTGAGCCACCGCGCCCGGGG + Intergenic
1160817891 19:1044663-1044685 AGCTGTAGCCACCGCTCCCAGGG - Exonic
1161155283 19:2729354-2729376 GGCGTGAGCCACCGCGCCTGGGG - Intronic
1161787377 19:6335549-6335571 GGCGTGAGCCACAGCACCCGGGG - Intergenic
1162031380 19:7918896-7918918 AGCCTCAGCCACCCCTCCCAGGG + Exonic
1162143235 19:8597044-8597066 ATCGTGAACCACAGCGGCCATGG - Exonic
1162366584 19:10253195-10253217 GGCGTGAGCCACTGCGCCCAGGG - Intronic
1162433210 19:10641876-10641898 GGCGTGAGCCACCGCACACCCGG - Intronic
1162603792 19:11691717-11691739 GGCGTGAGCCACCCCGCGCCCGG - Intergenic
1162679541 19:12330197-12330219 GGCATGAGCCACCACGCCCGGGG + Intronic
1162741551 19:12776400-12776422 GGCGTGAGCCACCGCTACCTGGG - Intronic
1162752267 19:12836040-12836062 GGCGTGAGCCACCACGCCCTGGG + Intronic
1163098466 19:15078496-15078518 GGCATGAGCCACTGTGCCCAGGG - Intergenic
1163107560 19:15134432-15134454 GGCATGAGCCACCGCGCCCGGGG - Intergenic
1163952960 19:20607671-20607693 GGCGTGAACCACCGCGCCTGGGG + Intronic
1164078081 19:21838677-21838699 GGAGTAAGCCACCGCACCCAGGG + Intronic
1164296212 19:23912337-23912359 GGCATGAGCCACCTCACCCAGGG - Intergenic
1165439901 19:35819322-35819344 GGCATGAGCCACCACGCCCCAGG - Intergenic
1165457254 19:35920018-35920040 GGCGTGAACCACCGTGCCCGCGG - Intergenic
1165685063 19:37812788-37812810 GGCGTGAGCCACCACGCCCGTGG + Intronic
1166696354 19:44853764-44853786 GGCGTGAGCCATTGCGCCCAGGG + Intronic
1166718337 19:44983339-44983361 GGCGTGAGCCACTGAGCCCGGGG - Intronic
1167065923 19:47185958-47185980 GGCATGAGCCACCACGCCCGGGG - Intronic
1167436724 19:49482904-49482926 GGCGTGAGCCACCGCGCCCGGGG + Intronic
1167437097 19:49485795-49485817 GGCATGAGCCACCGCGCCCGGGG + Intronic
1167441876 19:49513422-49513444 AGCAGGAGCCCCAGCGCCCAGGG - Exonic
1167516440 19:49925929-49925951 GGTGTGAGCCACCGTACCCAAGG - Intronic
1167749219 19:51369784-51369806 GGCGTGAGCCACTGCGCACCCGG - Intergenic
1167759760 19:51438561-51438583 GGCGTGAGCCACCGCACCCGGGG - Intergenic
1167936061 19:52909524-52909546 GGCATGAGCCACTGCGCCCGGGG + Intergenic
1168022632 19:53620642-53620664 GGTGTGAGCCACCCCGCCCGGGG + Intergenic
1168349355 19:55667227-55667249 AGCATGAGCCGCTGTGCCCATGG - Intronic
1168711731 19:58504724-58504746 GGCATGAGCCACCGCGCCCAGGG - Intronic
926101241 2:10119785-10119807 GGCGTGAGCCACCGCCCCACCGG - Intergenic
926475739 2:13320094-13320116 GGCATGAGCCACTGCACCCAGGG - Intergenic
927111120 2:19864374-19864396 GGCGTGAGCCACCCCACCCTGGG + Intergenic
927567626 2:24126901-24126923 GGCGTGAGCCACCGGGCGCCCGG + Intronic
927662811 2:25007155-25007177 GGCATGTGCCACCACGCCCAAGG + Intergenic
927710036 2:25319291-25319313 GGCATGAGCCACCACGCCCGGGG + Intronic
927834041 2:26377348-26377370 GGTGTGAGCCACCGCACCCAGGG - Intronic
927858040 2:26539454-26539476 GGCGTGAGCCACTGCGCCCAGGG - Intronic
927894325 2:26771686-26771708 GGCATGAGCCACTGCACCCATGG - Intronic
927928844 2:27031320-27031342 GGCGTGAGCCACGGCGCCCGGGG + Intergenic
929362415 2:41109615-41109637 GGCATGAGCCACCGCGCCCGGGG - Intergenic
929558911 2:42943362-42943384 GGCATGAGCCACCGCGCCCGAGG - Intergenic
930652022 2:53972325-53972347 GGCGTGAGCCACCACGCGCCTGG - Intronic
931399051 2:61913890-61913912 GGCGTGAGCCACCGCACCCAGGG - Intronic
931780364 2:65574126-65574148 GGCGTGAGCCACCGGGCGCCTGG - Intergenic
932201417 2:69831196-69831218 GGCGTGAGCCACTGCGCACCCGG + Intronic
934587165 2:95511804-95511826 AGTGTGAGCCACTGCACCCCGGG - Intergenic
936771662 2:115920820-115920842 GGTGTGAGCCACCGCGCCTGGGG + Intergenic
937087899 2:119183564-119183586 GGCGTGAGCCACCGTGCACCCGG + Intergenic
939569104 2:143819035-143819057 GGCGTGAGCCACCACGCCCCCGG + Intergenic
940468297 2:154060634-154060656 GGCGTGAGCCACCGCACCTAAGG + Intronic
941972259 2:171364090-171364112 AGCGCGAGCCACTGCGCGCCCGG + Intronic
944522604 2:200586987-200587009 GGCGTGAGCCACAGCTCTCAAGG - Intronic
944575501 2:201087436-201087458 GGTGTGAGCCACCGCACCCAAGG + Intergenic
944854498 2:203753495-203753517 GGCGTGAGCCACCATACCCAGGG + Intergenic
945083217 2:206106758-206106780 GGCGTGAGCCACCACGCGCCCGG + Intergenic
945085643 2:206129539-206129561 AGCATGAGCCACGGCACCCAAGG + Intronic
945629845 2:212260531-212260553 GGCGTGAGCCACTGCGCAGAGGG - Intronic
945879935 2:215314769-215314791 GGTGTGAGCCACCGCACCCGAGG + Intronic
945967964 2:216208843-216208865 GGCGTAAGCCACTGCGCCCAAGG - Intergenic
946080400 2:217113697-217113719 AGAGTGGGCCACTGCTCCCAGGG - Intergenic
947009452 2:225549700-225549722 GGCATGAGCCACCGCCCACATGG - Intronic
947392027 2:229649793-229649815 GGCGTGAGCCACCGCACCCGGGG - Intronic
947542631 2:230989486-230989508 GGCATGAGCCACCGCGCCCGAGG + Intergenic
947622826 2:231601856-231601878 AGGTTGAGCCACCGCGCCCTTGG - Intergenic
947847713 2:233258977-233258999 GGCATGAGCCACCACACCCAGGG + Intronic
948370558 2:237486942-237486964 AGCGGGTCCCACCGTGCCCAAGG + Intronic
948826533 2:240575803-240575825 AGCCTGTGCCACCGGCCCCAGGG - Intronic
1168763614 20:366927-366949 GGCGTGGGCCACCGCACCCGGGG - Intronic
1169222614 20:3834332-3834354 AGCGTGAGCCACCACACACCTGG + Intergenic
1170634491 20:18092773-18092795 GGCGTGAGCCACAGCGCCCGGGG + Intergenic
1171512159 20:25694989-25695011 GGCGTGAGCCACCGCGCGTCAGG - Intronic
1171976746 20:31599899-31599921 GGCGTGAGCCACCGGGCCGGCGG - Intergenic
1172312451 20:33929143-33929165 GGCGTGAGCCACTGTGCCCAGGG + Intergenic
1172433261 20:34910367-34910389 GGCGTGAGCCACCATGCCCAGGG - Intronic
1172499324 20:35413897-35413919 AGAGTGAGCCACCGTGCCCCCGG + Intergenic
1172698861 20:36840445-36840467 GGCATGAGCCACCGTGCCCTTGG + Intronic
1173627860 20:44486999-44487021 GGCGTGAGCCACTGTGCCCCAGG - Intronic
1173996219 20:47340512-47340534 GGCGTGAGCCACCACGCCTCCGG - Intronic
1174256745 20:49261923-49261945 GGCGTGAGCCACTGCGCGCTTGG + Intronic
1174817497 20:53699342-53699364 GGTGTGAGCCACCGTGCCCAGGG + Intergenic
1175268786 20:57719280-57719302 GGTGTGAGCCACCGCGCACCTGG - Intergenic
1175442389 20:59001106-59001128 GGCATGAGCCACCGCGCGCATGG + Intronic
1175574179 20:60048246-60048268 GGCGTGAGCCACCGCGTCTTAGG - Intergenic
1175887570 20:62301425-62301447 AGGGTGAGCCACCAAGCACACGG + Intergenic
1176196909 20:63841247-63841269 GGCGTGAGCCACCACATCCAGGG + Intergenic
1176379556 21:6105292-6105314 GGTGTGAGCCACCGCGCCCTTGG + Intergenic
1176415816 21:6474248-6474270 GGCGTGAGCCACCGTGCCCCTGG + Intergenic
1178367242 21:31998196-31998218 GGCGTGAGCCACCGCTGCCTAGG + Intronic
1178525073 21:33321054-33321076 GGCGTGAGTCACCACGCCCAGGG - Intergenic
1178616362 21:34136425-34136447 GGCGTGAGCCACCACATCCATGG + Intronic
1178901662 21:36604014-36604036 GGCATGAGCCACCACACCCAGGG + Intergenic
1178951631 21:36990301-36990323 AGCGCGCGGCACCGCGGCCAGGG - Intergenic
1179691316 21:43082582-43082604 GGCGTGAGCCACCGTGCCCCTGG + Intergenic
1179743918 21:43432945-43432967 GGTGTGAGCCACCGCGCCCTTGG - Intergenic
1180658648 22:17446436-17446458 GGCAAGAGCCACCGCGCCCTGGG - Intronic
1181065035 22:20301617-20301639 GGCATGAGCCACTGTGCCCAGGG + Intergenic
1181817971 22:25453571-25453593 GGCGGGAGCCACTGTGCCCAGGG + Intergenic
1182187597 22:28423110-28423132 AGTGTGAGCCACGGTGCCCAGGG - Intronic
1183233914 22:36601760-36601782 AGCGTGAGCCACTGCGCCTGGGG + Intronic
1183409953 22:37648980-37649002 GGTGTGAGCCATCGCGCCCCAGG + Intronic
1184145231 22:42606348-42606370 GGTGTGAGCCACCATGCCCAGGG - Intronic
1185106376 22:48872134-48872156 AGTGTGTGCCACCACGGCCATGG + Intergenic
949569735 3:5281399-5281421 GGCATGAGCCACCATGCCCAAGG + Intergenic
949627869 3:5888161-5888183 GGCGTGAGCCACCATGCCAAGGG - Intergenic
951904106 3:27687294-27687316 GGTGTGAGCCACCGCGCCCGGGG - Intergenic
952383713 3:32823811-32823833 GGCGTGAGCCACCGCGCCTTTGG + Intronic
953946951 3:47157592-47157614 GGCATGAGCCACCACGCCCCTGG - Intronic
954552378 3:51492713-51492735 AGCATGAGCCACCGCGCCCGGGG - Intronic
954838518 3:53492473-53492495 GCCGTGAGCCACCGCGCGCCCGG - Intergenic
955018097 3:55091166-55091188 GGAGTAAGCCACCACGCCCAGGG - Intergenic
955820950 3:62894913-62894935 GGCATGGGCCACCGTGCCCAGGG + Intergenic
956136593 3:66105197-66105219 GGAGTGAGCCACCACGCCCAGGG + Intergenic
958639864 3:96792006-96792028 GGCATGAGCCACTGCTCCCAGGG + Intergenic
959089826 3:101889949-101889971 GGCGTGAGCCACTGCGCCCGGGG + Intergenic
959686817 3:109156505-109156527 AGCATGAGCCACCACACTCATGG + Intergenic
959701880 3:109306684-109306706 GGCGTGAGCTACCGCGCCTGGGG - Intronic
959705485 3:109335403-109335425 GGCGCGAGCCACTGCGCCCAAGG + Intronic
960667556 3:120124734-120124756 GGCGTGAGCCACCACACCCCAGG + Intergenic
960851227 3:122056609-122056631 GGCGTGAGCCACCGCGCACCCGG + Intronic
961369077 3:126418772-126418794 AGCGTGAGCCTGCGGGCCCGAGG + Exonic
961768168 3:129228484-129228506 GGCGTGAGCCACCGTGCCGCTGG + Intergenic
963062059 3:141233186-141233208 GGCGTGAGCCACCGCGCCCGAGG - Intronic
965826526 3:172736453-172736475 GGCGTGAGCCACCGTGCCAAGGG - Intergenic
966380708 3:179342170-179342192 GGCGTGAGCCACCGCGCCCAGGG - Intergenic
966786224 3:183625174-183625196 GGCGTGAGCCACAGCGCCGAAGG - Intergenic
966889446 3:184396093-184396115 GGCGTGAGCCACTGCACACATGG + Intronic
967874657 3:194259512-194259534 GGCGTGAGTCACCACGCCCAGGG - Intergenic
968015005 3:195321890-195321912 GGTGTGAGCCACTGAGCCCAGGG + Intronic
968110781 3:196044905-196044927 AGCGTGAGCCACCGCCCGGCCGG - Intronic
968174348 3:196536446-196536468 GGCGTGAGCCACCACGCCCGGGG + Intergenic
968277621 3:197452752-197452774 GGCGTGAGCCACCGCTCCCCAGG + Intergenic
969371137 4:6732402-6732424 GGCATCAGCCACCGCGCCCATGG + Intergenic
970303624 4:14707595-14707617 AGTGTGAGCCACTGTGCCCAAGG + Intergenic
970524742 4:16919645-16919667 GGCGTGAGCCACTGCGCCTGGGG + Intergenic
970562868 4:17300047-17300069 GGCATGAGCCACCGTGCCCGGGG + Intergenic
970820486 4:20205938-20205960 GGTGTGAGCCACTGCTCCCAGGG - Intergenic
970940723 4:21630185-21630207 GGCATGAGCCACCGCGCTGAAGG - Intronic
971333278 4:25700031-25700053 GGCATGAACCACCGCGCCCGGGG + Intergenic
972672762 4:41229526-41229548 GACATGAGCCACCGCACCCAGGG + Intergenic
974894007 4:67916545-67916567 GGCGTGAGCCACCGCGCGCCAGG - Intronic
977027787 4:91842330-91842352 GACATGAGCCACCGCGCCCAGGG + Intergenic
977230372 4:94445343-94445365 AGCGTGAGCCACTGTGCGCCTGG - Intergenic
978030286 4:103933400-103933422 GGCGTGAGCCACCGCGCCCGGGG - Intergenic
978785908 4:112609330-112609352 GGCATGAGCCACCATGCCCAGGG + Intronic
980914000 4:139017505-139017527 GGCGTGAGCCACCGCCCCCCCGG + Intronic
981174541 4:141666260-141666282 GGCGTGAGCCACCACGCCCGGGG - Intronic
981182654 4:141763992-141764014 GGCGTGAGCCACCGAGGCCAAGG + Intergenic
982212651 4:153051558-153051580 GGTGTGAGCCACCCTGCCCAGGG + Intergenic
983937364 4:173511255-173511277 GGCGTGAGCCACCGCGCGCCGGG + Intergenic
984368966 4:178836169-178836191 GGCATGAGCCACTGTGCCCAGGG + Intergenic
985365581 4:189228437-189228459 GGAGTGAGCCACCGCGCCTGGGG - Intergenic
987202575 5:15591987-15592009 GGTGTGAGCCACCGTGCCCGAGG + Intronic
987336589 5:16902779-16902801 GGCGTAAGCCACCGTGCCCAGGG + Intronic
988516949 5:31913194-31913216 GGCATGTGCCACCACGCCCAGGG - Intronic
988585041 5:32500736-32500758 GGCGTGAGCCACCGTGCCCAGGG - Intergenic
990214428 5:53514496-53514518 GGCATGAGCCATCGCGCCCGGGG - Intergenic
990422043 5:55645332-55645354 GGCCTGAGCCACCACGCCCAGGG + Intronic
990581581 5:57171766-57171788 GGCGTGAGCCACCGCGCCCGGGG + Intergenic
992907493 5:81360779-81360801 GGTGTGAGCCACCACACCCAGGG - Intronic
993158870 5:84262948-84262970 GGCATGAGCCACCGCGCCCCTGG + Intronic
997323100 5:132995226-132995248 GGCGTGAGCCACTGTGCCCAGGG + Intergenic
997560890 5:134845544-134845566 GGCGTAAGCCACCACGCCCCAGG - Intronic
998214895 5:140230149-140230171 GGCGTAAGCCACCGCGCACCTGG + Intronic
998254710 5:140575765-140575787 GGTGTGAGCCACCATGCCCATGG - Intronic
999317488 5:150593737-150593759 GGCATGAGCCACCACGCCCGGGG + Intergenic
999812556 5:155141733-155141755 GGCTGGAGCCACCGCACCCAGGG - Intergenic
1000475864 5:161706272-161706294 GGCGTGAGCCACCAGGCCCCCGG - Intergenic
1000686221 5:164253151-164253173 CGCGTGAACCACTGCGCCCGGGG + Intergenic
1001495976 5:172188045-172188067 AGCCGGCGCCACCGCGCCCCCGG - Exonic
1002839674 6:894933-894955 GGCGTGAGCCACCACACCCCTGG + Intergenic
1003183320 6:3810266-3810288 GACGTGAGCCACCGTGCCCAAGG - Intergenic
1003202317 6:3973292-3973314 GGCATGAGCCACTGTGCCCACGG - Intergenic
1003660109 6:8052244-8052266 GGCGTGAGCCACCGCGCCCGAGG + Intronic
1004515322 6:16317602-16317624 GGTGTGAGCCACCGCGCCCAGGG + Intronic
1005299518 6:24457148-24457170 GGCGTAAGCCACCATGCCCAGGG + Intronic
1005517212 6:26566160-26566182 GGCGTGAGCCACCGCGCCCGGGG + Intergenic
1005676470 6:28160676-28160698 AGCATAAGCCACTGCACCCAGGG - Intergenic
1006027060 6:31153855-31153877 GGCGTGAGCCACTGCGCCCAGGG + Intronic
1006140957 6:31929439-31929461 GGCGTGAGCCACCGCACTCCAGG - Intronic
1006644049 6:35504034-35504056 AGCTTGAGCCACCATGCCCTGGG - Intronic
1007904252 6:45443328-45443350 GGTGTGAGCCACTGCACCCAAGG + Intronic
1008277232 6:49555785-49555807 GGCGTGAGCCACCGCGCACCTGG + Intronic
1010792884 6:80085214-80085236 GGCGTGAGCCACCGCGCGCCCGG - Intergenic
1010804536 6:80219484-80219506 GGCATAAGCCACCGCACCCAGGG + Intronic
1010816894 6:80368729-80368751 GGTGTGAGCCACCATGCCCAGGG - Intergenic
1012060435 6:94471869-94471891 GGCGTGAGCCACCGCGCCCGAGG - Intergenic
1013264857 6:108485950-108485972 GGCATGAGCCACCATGCCCATGG + Intronic
1013407386 6:109855696-109855718 GGTGTGAGCCATCACGCCCAAGG - Intergenic
1013418326 6:109944414-109944436 AGGGTGAGCCACCGAGCCTTAGG - Intergenic
1015163482 6:130178253-130178275 GGCGTGAGCCACCACGCGCCCGG + Intronic
1016093898 6:140013030-140013052 GCCGTGAGCCACCGCGCGCCTGG + Intergenic
1018389788 6:163333359-163333381 GGCGTGAGCCACGGCACCCCTGG - Intergenic
1019411523 7:908850-908872 AGTTTGGGCCACCTCGCCCACGG + Intronic
1020113831 7:5464015-5464037 GGTGTGAGCCACCGCGCACCTGG + Intronic
1020229809 7:6309498-6309520 GGCGTGAGCCACCCCGCGCCTGG - Intergenic
1021008148 7:15426467-15426489 AGCATGAGCCACCGCGCCTGGGG - Intronic
1021300646 7:18968678-18968700 GGCGTGAGCCACTGCGTCCAGGG - Intronic
1021884640 7:25126454-25126476 GGTGTGAGCCACCACGCCCAGGG + Intergenic
1021973051 7:25984137-25984159 GGCATGAGCCACCGTGCCCAGGG - Intergenic
1022429145 7:30299146-30299168 GGCGTGAGCCACCACGCCCAGGG - Intronic
1023178474 7:37456885-37456907 GGCATGAGCCACCACACCCAGGG - Intergenic
1023571773 7:41579857-41579879 GGCATGAGCCACCCCACCCAGGG + Intergenic
1023785958 7:43707967-43707989 GGCATGAGCCACCATGCCCAAGG - Intronic
1024461181 7:49661158-49661180 GGCGTGAGCCACCGCGCCCCCGG + Intergenic
1025932810 7:66010113-66010135 GGCATGAGCCACCGCGCCCGGGG + Intergenic
1025933278 7:66013406-66013428 GACGTGAGCCACCGCGCACCTGG - Intergenic
1026156689 7:67832298-67832320 GGCGTGAGCCACCACGCCAGGGG + Intergenic
1026691510 7:72553947-72553969 GGCGTGAGCCACTGCGCCGCTGG + Intergenic
1026774467 7:73222835-73222857 GGCGTGAGCCACCGTGCCAGCGG + Intergenic
1026845122 7:73694365-73694387 AGGGAGAGCCACAGCACCCAAGG - Intronic
1027015325 7:74776224-74776246 GGCGTGAGCCACCGTGCCAGCGG + Intronic
1027072706 7:75169731-75169753 GGCGTGAGCCACCGTGCCAGCGG - Intergenic
1027137253 7:75633569-75633591 AGCGTGAGCCACCGCGCACCTGG + Intronic
1028159399 7:87468651-87468673 GGCGTGAGCCACCGCGCCCACGG - Intronic
1029028448 7:97443180-97443202 AGCGTGAGCCACCGTGAACCTGG + Intergenic
1029176434 7:98668094-98668116 GGCATGAGCCATCGCACCCAGGG + Intergenic
1029524416 7:101086279-101086301 GGCGTGAGCCACCATGCCCAGGG - Intronic
1030055424 7:105580265-105580287 GGCGTGAGTCACCGCCCCCAAGG + Intronic
1031143513 7:117972245-117972267 GGCGTGAGCCACCGAGCGCCTGG + Intergenic
1031847219 7:126820819-126820841 GGCATGAGCCACCGTGCCCTAGG - Intronic
1032123443 7:129173468-129173490 AGCGTGAGCCACCACGCGCCTGG + Intergenic
1032276044 7:130456482-130456504 GGCGTGAGCCACTGCGACCAGGG + Intergenic
1032863502 7:135903736-135903758 GGCGTGAGCCACCAAGCCCAGGG - Intergenic
1034300660 7:150012592-150012614 GGCGTGAGCCAACGCACCCAAGG + Intergenic
1034359921 7:150485795-150485817 GGCGTGAGCCACCGCGCCTGGGG + Intergenic
1034805390 7:154084708-154084730 GGCGTGAGCCAACGCACCCAAGG - Intronic
1035427726 7:158792242-158792264 GGCGTGAGCGACTGCACCCAGGG - Intronic
1036234501 8:7026638-7026660 AGCGTGAGCCCCAGAGCCCCGGG - Intergenic
1036417030 8:8560328-8560350 GGCGTGAGCCACTGCGCCCAGGG - Intergenic
1036470119 8:9045515-9045537 GGCATGAGCCACCATGCCCAGGG - Intronic
1036529644 8:9571741-9571763 GACGTGAGCCACCGCGCCCGGGG + Intronic
1037499168 8:19469108-19469130 AGTATGAGCCACCGCACTCAGGG - Intronic
1037855416 8:22367663-22367685 AGCGTGGGTCGCCGCGCCGAAGG + Intronic
1038568556 8:28639821-28639843 GGCATGAGCCACTGCGCCCATGG - Intronic
1039496701 8:37985909-37985931 AGGCTGAGCCACCTGGCCCAGGG + Intergenic
1039978875 8:42390171-42390193 GGCGTGAGCCACCGCGCCCGGGG + Intergenic
1039985730 8:42446098-42446120 GGCATGAGCCACCTGGCCCAAGG + Intronic
1040076410 8:43236395-43236417 GGCGTGAGCCACCGCGTGCCCGG + Intergenic
1041923065 8:63204639-63204661 GGCATGAGCCACCGCGCACCTGG + Intronic
1043482166 8:80664549-80664571 GGCGTGAGCCACTGTGCCCAAGG + Intronic
1044064281 8:87680837-87680859 GGTGTGAGCCACCGTGCCCATGG - Intergenic
1044701296 8:94967659-94967681 GACGTGAGCCACCGCGCCCGTGG - Intronic
1044709579 8:95043366-95043388 GGCTTGAGCCACCGCGCCCTAGG + Intronic
1045306430 8:100960562-100960584 GGCGTGAGCCACCGTGCCGGCGG + Intergenic
1045539371 8:103067862-103067884 GGCGTGAGCCACCTTGCCCCCGG + Intronic
1046316671 8:112511667-112511689 GACGTGAGCCACCACGCCCGGGG + Intronic
1046666294 8:117007083-117007105 AGCGTGAGCCACCGCGCCCCGGG + Intronic
1047368627 8:124236328-124236350 GGCATGAGCCACTGCACCCAGGG - Intergenic
1049691165 8:143960001-143960023 GGCGTGAGCCACCGCGTGCCTGG - Intronic
1049831315 8:144703010-144703032 GGCATGAGCCACCGTGCCCGGGG - Intergenic
1052184494 9:25575238-25575260 GGCGTGAGCCACCGCGCCCGGGG + Intergenic
1052293053 9:26866124-26866146 AGCGTGAGCCACCACACACATGG + Intronic
1055592623 9:77833245-77833267 GGCGTGAGCCACCCCGCACCTGG + Intronic
1055713934 9:79096669-79096691 GGCGTGAGCCTCCGCGCCCAGGG + Intergenic
1056245690 9:84692744-84692766 GGCATGAGCCACCGCGCCCAGGG + Intronic
1056650306 9:88453803-88453825 GGCGGGAGCCACCGCGCCCGCGG + Intronic
1057562432 9:96139135-96139157 GGCGTGAGACGCCGTGCCCAAGG - Intergenic
1057634385 9:96749644-96749666 GGTGTGAGCCACCCGGCCCATGG + Intergenic
1058136756 9:101316155-101316177 GGCGTGAGCCACCGCGCCCGAGG - Intronic
1058871565 9:109206460-109206482 GGCATGAGCCACTGTGCCCAGGG + Intronic
1058910994 9:109519877-109519899 GGCGTGAGCCAGCGTGCCCTTGG - Intergenic
1059010498 9:110453586-110453608 GGCCTGAGCCACCCCGCCCCTGG - Intronic
1060638545 9:125219680-125219702 AGCGTGAGCCACTGCACCCCTGG + Intronic
1061121126 9:128643103-128643125 GGCGTGAGCCACGGCGCTCAGGG - Intronic
1061262858 9:129489605-129489627 GGCGTGAGCCACCGCGCCTGGGG + Intergenic
1061409602 9:130412249-130412271 GGAGTGAGCCACTGCACCCAGGG + Intronic
1062344683 9:136109345-136109367 GGGGTGAGCCACAGCCCCCAGGG - Intergenic
1062564248 9:137156920-137156942 GGCCTGGGCCACCACGCCCACGG - Exonic
1185555407 X:1017137-1017159 GGCGTGAGTCACCGCGCGCCCGG + Intergenic
1185891079 X:3822597-3822619 AGCATGAGCCGCTGCCCCCAAGG + Intronic
1185896183 X:3861013-3861035 AGCATGAGCCGCTGCCCCCAAGG + Intergenic
1185901302 X:3899439-3899461 AGCATGAGCCGCTGCCCCCAAGG + Intergenic
1186497730 X:10025077-10025099 GGCATGAGCCACCGTGCCCAAGG - Intronic
1188372388 X:29385173-29385195 GGCTTGAGCCACTGCGCCCATGG - Intronic
1188492199 X:30749451-30749473 GGCGTGAGCCACCCCGCGCCCGG + Intergenic
1188899130 X:35708426-35708448 GGCGTTAGCCACCTCGCCCGGGG - Intergenic
1189258453 X:39658997-39659019 GGCGTGAGCCACCGCGCGCCCGG - Intergenic
1189418276 X:40833328-40833350 GGCATGAGCCACCGCGCCAGAGG - Intergenic
1190187501 X:48248564-48248586 GGCCTGAGCCACTGCGCCCAGGG + Intronic
1190321583 X:49183101-49183123 GGCGTGAGCCACCGTGCCCGTGG + Intronic
1192745239 X:73931789-73931811 GGCGTGAGCCACTGCGCCAGGGG + Intergenic
1192790477 X:74377845-74377867 GGCATGAGCCATCGCGCCCGGGG - Intergenic
1193948920 X:87774555-87774577 GGCATGAGCCACTGTGCCCAGGG - Intergenic
1195087123 X:101423187-101423209 GGCGTGAGCCACCATGCCCATGG + Intronic
1196505510 X:116436593-116436615 AGAGTGAGCCACCTTGCCCAGGG - Intergenic
1196891192 X:120292477-120292499 GGCGTGATCCACTGCGCCCTGGG - Intronic
1197936245 X:131742682-131742704 GGCGTGCACCACCACGCCCATGG + Intergenic
1198601834 X:138292194-138292216 GGCGTGAGCCACTGCACCCAGGG + Intergenic
1199356745 X:146871068-146871090 GGCTTGAGCCACCGCGCCCTGGG + Intergenic
1200234736 X:154462748-154462770 AGCTTCAGCCCCCGGGCCCATGG - Intronic