ID: 1097889230

View in Genome Browser
Species Human (GRCh38)
Location 12:64760288-64760310
Sequence AGCGTGAGCCACCGCGCCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 514
Summary {0: 1, 1: 6, 2: 50, 3: 148, 4: 309}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097889230_1097889235 4 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889235 12:64760315-64760337 ATCCCAGCACTTTGGGAGGCGGG 0: 2878
1: 3400
2: 2456
3: 2522
4: 3989
1097889230_1097889240 23 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889240 12:64760334-64760356 CGGGTGGATCACCTGAGGTCAGG 0: 13130
1: 55640
2: 86423
3: 98097
4: 93725
1097889230_1097889232 -3 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889232 12:64760308-64760330 GCTTGTAATCCCAGCACTTTGGG 0: 8256
1: 229629
2: 273895
3: 182802
4: 143013
1097889230_1097889239 18 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889239 12:64760329-64760351 GGAGGCGGGTGGATCACCTGAGG 0: 170
1: 10756
2: 46492
3: 81402
4: 95133
1097889230_1097889231 -4 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889231 12:64760307-64760329 CGCTTGTAATCCCAGCACTTTGG 0: 4214
1: 133667
2: 277190
3: 221574
4: 152657
1097889230_1097889233 0 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889233 12:64760311-64760333 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1097889230_1097889234 3 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889234 12:64760314-64760336 AATCCCAGCACTTTGGGAGGCGG 0: 3798
1: 3826
2: 2729
3: 1935
4: 2347
1097889230_1097889238 7 Left 1097889230 12:64760288-64760310 CCGTGGGCGCGGTGGCTCACGCT 0: 1
1: 6
2: 50
3: 148
4: 309
Right 1097889238 12:64760318-64760340 CCAGCACTTTGGGAGGCGGGTGG 0: 117
1: 639
2: 4081
3: 5478
4: 4498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097889230 Original CRISPR AGCGTGAGCCACCGCGCCCA CGG (reversed) Intergenic