ID: 1097889680

View in Genome Browser
Species Human (GRCh38)
Location 12:64765195-64765217
Sequence GAAAATTACTACACAGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097889676_1097889680 -9 Left 1097889676 12:64765181-64765203 CCTGCGTTGAATAAGAAAATTAC No data
Right 1097889680 12:64765195-64765217 GAAAATTACTACACAGGGCCGGG No data
1097889675_1097889680 24 Left 1097889675 12:64765148-64765170 CCTAGATATTCAACAATATGAAA No data
Right 1097889680 12:64765195-64765217 GAAAATTACTACACAGGGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097889680 Original CRISPR GAAAATTACTACACAGGGCC GGG Intergenic
No off target data available for this crispr