ID: 1097891367

View in Genome Browser
Species Human (GRCh38)
Location 12:64780812-64780834
Sequence GACGTCCTTCCCACCGGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 37
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 31}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097891358_1097891367 4 Left 1097891358 12:64780785-64780807 CCGGGCAGCCGCGCGCCGGGGAC 0: 1
1: 0
2: 1
3: 23
4: 203
Right 1097891367 12:64780812-64780834 GACGTCCTTCCCACCGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 31
1097891360_1097891367 -4 Left 1097891360 12:64780793-64780815 CCGCGCGCCGGGGACCATGGACG 0: 1
1: 0
2: 0
3: 4
4: 60
Right 1097891367 12:64780812-64780834 GACGTCCTTCCCACCGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 31
1097891350_1097891367 30 Left 1097891350 12:64780759-64780781 CCGCGAGGCGGGAGGAGCAGCGG 0: 1
1: 1
2: 5
3: 19
4: 210
Right 1097891367 12:64780812-64780834 GACGTCCTTCCCACCGGCGGGGG 0: 1
1: 0
2: 0
3: 5
4: 31

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097891367 Original CRISPR GACGTCCTTCCCACCGGCGG GGG Intergenic
901934308 1:12617209-12617231 AACGTCCTCATCACCGGCGGCGG - Exonic
902823162 1:18955890-18955912 GGCGGCCTGCCCCCCGGCGGCGG - Exonic
904396307 1:30224742-30224764 GTCTTCCTTCCCATCAGCGGTGG + Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
915796368 1:158738542-158738564 GACATCTTTCCAACCGGAGGAGG - Intergenic
916260142 1:162833826-162833848 GACTACCTTCCCACCGGTGGTGG + Intronic
917869640 1:179229748-179229770 GCCCTCCTTCCCCGCGGCGGAGG - Intergenic
1076741178 10:132486471-132486493 GACGGCCTCTCCCCCGGCGGCGG - Intergenic
1076850018 10:133088130-133088152 CGCGTCCTTCCCACCTGCTGTGG - Exonic
1088683597 11:112266223-112266245 GGCCTCCTTCCCACCAGCTGGGG + Intronic
1097891367 12:64780812-64780834 GACGTCCTTCCCACCGGCGGGGG + Intergenic
1104903947 12:132203716-132203738 GGCGTCCTTCCCAACGGAAGCGG + Intronic
1105356135 13:19661729-19661751 GTCGTCCTGCCCTCCGGCGGCGG - Exonic
1113831371 13:113297875-113297897 GACGTCCCTGCCACCTTCGGCGG - Intronic
1143419319 17:6776455-6776477 GATGTCCTACCCACCGCGGGAGG - Intronic
1148556592 17:48582219-48582241 GCCGGCCTGCGCACCGGCGGCGG + Intronic
1148698633 17:49575664-49575686 CTCGTCCCTCCCACCGGCGGCGG - Intergenic
1149526146 17:57357341-57357363 GTTGTTTTTCCCACCGGCGGTGG - Intronic
1151662533 17:75526211-75526233 GACCCCCTCCCCACGGGCGGCGG + Intronic
1152554280 17:81045337-81045359 GTGGCCCTTCCCACAGGCGGAGG + Intronic
1152664069 17:81557188-81557210 GACCTCCTTCCCACAAGAGGAGG + Exonic
1160991903 19:1863547-1863569 GGCGTCCGTCCGGCCGGCGGCGG + Exonic
928389807 2:30900566-30900588 GCTGTCTTTCCCACCGGCTGTGG - Intergenic
948763295 2:240205710-240205732 GACTTCCTTCCCACCTGCTGGGG + Intergenic
1176132659 20:63502837-63502859 GCCGCCCTTCCCCCTGGCGGAGG - Intergenic
957826862 3:85458338-85458360 GATATCCTTCCCACAGGCAGAGG - Intronic
968620814 4:1602779-1602801 GACCTCCTTCCCACGGTGGGTGG - Intergenic
981300817 4:143184744-143184766 GACTCCCTTCCCCCCGGCGCTGG - Intergenic
992106325 5:73451589-73451611 GGCGTCCCTCCCACCGGCTGCGG + Intergenic
1001101647 5:168819214-168819236 GAGGTCCTTCCCACCAGCTTAGG - Intronic
1002603713 5:180370026-180370048 GACGTCCCTCCCACTGGCCCAGG - Intergenic
1002925776 6:1604998-1605020 GACGTCCCTCACCCCGGCCGGGG - Intergenic
1019670437 7:2275080-2275102 GGCGTGCTGCCCACCGGGGGCGG - Intronic
1033168450 7:139062428-139062450 GCCCTCCTTCCCACAGGCAGAGG + Intronic
1037581027 8:20246061-20246083 GACGTCCCTTCCACCAGCGAAGG - Intergenic
1041279791 8:56198289-56198311 CACGTCCTTCTCACCGGCCCTGG - Intronic
1049710528 8:144061002-144061024 GACGTCCTTCCCCGTGGAGGGGG + Intronic