ID: 1097892360

View in Genome Browser
Species Human (GRCh38)
Location 12:64790832-64790854
Sequence GTTTTAGTGCCACCAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097892360 Original CRISPR GTTTTAGTGCCACCAAACTC AGG (reversed) Intronic
901309654 1:8259201-8259223 GGTTTAGTGCTTCCAAACACAGG + Intergenic
906439750 1:45830985-45831007 GTGATTGTGCCACCACACTCTGG + Intronic
911097891 1:94070237-94070259 GTTTTACTGCCAGAAAACTGAGG - Intronic
917719461 1:177773063-177773085 GTCTTTGTGCCACCTAAATCAGG + Intergenic
1070498833 10:77051196-77051218 GTTTTAGTGACAGCAGATTCTGG + Intronic
1073314550 10:102569811-102569833 GTTTGAATGCCACCATTCTCTGG - Intronic
1076051040 10:127333361-127333383 GTTTTATTGGCAGCAAACACTGG + Intronic
1083090714 11:60197305-60197327 GTTTCAGTGCCCTCAAATTCTGG - Intergenic
1086901106 11:92368671-92368693 ATTCTAGTGCCACCCACCTCAGG + Intronic
1088765557 11:112972445-112972467 GCTTTTGTGCCACTAAGCTCTGG - Intronic
1091257675 11:134204600-134204622 GTTTAAGTGACACAAAACTGTGG + Intronic
1091651181 12:2311258-2311280 ATTTTATTGCCCCCAAACTGTGG + Intronic
1092162918 12:6325861-6325883 GATTTGGTGGCACCAAACTCTGG - Intronic
1092513494 12:9183722-9183744 AATTGAGTGCCACCAATCTCAGG - Intronic
1095166949 12:38984153-38984175 ATTATCATGCCACCAAACTCTGG - Intergenic
1097892360 12:64790832-64790854 GTTTTAGTGCCACCAAACTCAGG - Intronic
1103315983 12:120056125-120056147 GTATTAGTGCCACCCACCACAGG - Intronic
1111606845 13:90549437-90549459 GTTATAGTGCCCCCAAATTAAGG + Intergenic
1112556534 13:100473402-100473424 TTTTGAGTGTCCCCAAACTCTGG + Intronic
1115890438 14:38021289-38021311 GTTTTAGTGCAATCAAAATGTGG + Intronic
1117929802 14:60829105-60829127 CTTTCAGTTCCACCAACCTCTGG - Intronic
1118851929 14:69590669-69590691 GACTTAGTGGCACCAAAATCAGG + Intergenic
1120485600 14:85109806-85109828 GATATAGTGCCACTACACTCAGG + Intergenic
1126307040 15:47271680-47271702 GTTTTAGAGCCCCCCAAATCAGG + Intronic
1127600760 15:60534323-60534345 GTCACAGTGGCACCAAACTCTGG - Intronic
1130989953 15:88870282-88870304 GATTGGGTGCCACCATACTCTGG - Intronic
1135019559 16:18952064-18952086 TTTTAAGTGCCACTTAACTCAGG + Intergenic
1142758054 17:2027191-2027213 GCTTCAGTGCCACCAAATGCAGG - Intergenic
1148583544 17:48760514-48760536 TTTTTAGTGGCACTTAACTCAGG + Intergenic
1155839570 18:30629463-30629485 GTTTTCGTACCACCAATATCGGG + Intergenic
1158161323 18:54487533-54487555 GGTTTAATGCAATCAAACTCTGG + Intergenic
1158341311 18:56469560-56469582 AGTTTAGTGTCACAAAACTCAGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1168477579 19:56688083-56688105 GTGTGAGTCCCACAAAACTCAGG + Intergenic
1168477597 19:56688269-56688291 GTGTGAGTCCCACAAAACTCAGG + Intergenic
931027378 2:58127272-58127294 ATTTTCGTGCTACCAAACTTGGG + Intronic
934167390 2:89306790-89306812 TATTTAGTGCAACCAAACTGAGG + Intergenic
934199885 2:89875654-89875676 TATTTAGTGCAACCAAACTGAGG - Intergenic
935465273 2:103389410-103389432 GTGATAGTGCCACCACATTCTGG - Intergenic
937437164 2:121890116-121890138 CTTTTGCTGCCACCAAACCCAGG - Intergenic
939784144 2:146487801-146487823 CCTTTAGTAGCACCAAACTCTGG - Intergenic
941106104 2:161354925-161354947 GCTGTAGGGCCACCAAACTTAGG + Intronic
942831553 2:180242444-180242466 GTTTAAGTTCCTCAAAACTCAGG + Intergenic
942893480 2:181020362-181020384 GATTAAGGGCCACCATACTCTGG + Intronic
948109937 2:235446277-235446299 GATTTAGTGCCACCACTCACAGG - Intergenic
1172057775 20:32166231-32166253 GTTTTTGTGCCAAGAAACCCTGG + Exonic
950076060 3:10188147-10188169 GATTAAGTGCCACCAAAGGCTGG + Intronic
951539728 3:23770932-23770954 GTTCTAAAGCCCCCAAACTCTGG + Intergenic
953445085 3:42956641-42956663 TATCTAGTGCCTCCAAACTCAGG - Intronic
955387319 3:58490391-58490413 TTTTCAGTGGCACCAAATTCTGG + Intergenic
955461135 3:59184353-59184375 GTTTTAGTGGAATCAAAATCTGG + Intergenic
956911184 3:73819151-73819173 GTATTAGTCCTACAAAACTCTGG + Intergenic
959155194 3:102658533-102658555 GTTTTTGTCCTACCAAACTCCGG - Intergenic
959358052 3:105356973-105356995 GTTTATCTGACACCAAACTCAGG + Intergenic
960641079 3:119823780-119823802 GTTTCAGTGATACCATACTCAGG - Intronic
963583747 3:147158823-147158845 CTTTTATTGCCAGCTAACTCAGG - Intergenic
971381554 4:26103343-26103365 GCTTTAGTGCCACCCTTCTCTGG + Intergenic
972537321 4:40010402-40010424 ATTTTAGAGCCAGCAAACTCTGG + Intergenic
977323159 4:95545625-95545647 GTGTTAACACCACCAAACTCAGG - Intronic
980651815 4:135726551-135726573 TCTTTAATGCCAGCAAACTCTGG + Intergenic
982193359 4:152881157-152881179 GTTCTAGTGACTTCAAACTCAGG - Exonic
984111715 4:175625131-175625153 GTTTAAGTTTCACCAAACTGTGG + Intergenic
985386910 4:189457169-189457191 GTGGTAATGCCACCAATCTCAGG - Intergenic
987108457 5:14663604-14663626 TATTTAGTGCCACAGAACTCCGG - Intergenic
988468954 5:31518834-31518856 GTTTTATTGCCAAGAAACACAGG + Intronic
989994403 5:50811288-50811310 GTTTCAGTGCCCCCCAACCCTGG - Intronic
992848034 5:80774066-80774088 GTATTATTGCAACCAAATTCAGG - Intronic
998657799 5:144201629-144201651 TTTTTATTGCCACCATACCCTGG + Intronic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1001755679 5:174166768-174166790 CTTTTGGTGACACAAAACTCTGG + Intronic
1006637492 6:35470914-35470936 GTTTTTCTGCCATCAAAATCAGG + Intergenic
1010484876 6:76398321-76398343 CTTTTAGTGCTAACAAACTTTGG - Intergenic
1010929597 6:81784987-81785009 CTTCTAGTGGCACCAGACTCAGG + Intergenic
1013938210 6:115626140-115626162 GTTTTACAGCCAGCAACCTCAGG - Intergenic
1016452536 6:144198036-144198058 GTTTTTATGCTACCAAACACTGG - Intergenic
1017176320 6:151508098-151508120 GCTCTAGTGCCACAAAACTGTGG - Intronic
1018959370 6:168436504-168436526 GTTTCAGTGCCTTCAGACTCTGG - Intergenic
1021467268 7:20959041-20959063 TTTTTATTCCCACCAAACTTGGG + Intergenic
1023277766 7:38538965-38538987 GCTTTACTACCACCATACTCTGG - Intronic
1032276099 7:130456899-130456921 GTGATTGTGCCACCACACTCTGG + Intergenic
1032519047 7:132528807-132528829 GTTTTAGAGCCGCCCAACTTGGG + Intronic
1032692075 7:134297277-134297299 GTTATACTGCCACCAACCTGTGG - Intronic
1033766437 7:144497210-144497232 GTTTTAGTGACACTAAACAGAGG + Intronic
1039302286 8:36222303-36222325 GTGATAGTGCCACCACACTATGG - Intergenic
1041523981 8:58785450-58785472 GGTTGAGTGCAACAAAACTCTGG - Intergenic
1043235938 8:77866800-77866822 ATTTTTGTGCCACCAGACACAGG - Intergenic
1045198774 8:99957351-99957373 GTCTTAGTGCCACAAAGCACTGG + Intergenic
1045792566 8:106001511-106001533 AATTTAGTGCCTCCAAATTCAGG + Intergenic
1047182706 8:122604700-122604722 GTTTTAGTGCAACCAAATAAGGG + Intergenic
1047301970 8:123621363-123621385 TTTTTGGTGCCTCCAAACTCGGG + Intergenic
1051027435 9:12630208-12630230 CTTTTAGTACCACCAGAGTCTGG - Intergenic
1051574523 9:18599640-18599662 GCTTTAGAGCCACGAAACTCAGG - Intronic
1054949353 9:70833297-70833319 GTTTTTGTGCCATCAATCACAGG + Intronic
1057996642 9:99825398-99825420 GTTTTGGTGCCACAAAACGGTGG + Intronic
1059010101 9:110448563-110448585 GTTGTAATGACACCAAACACAGG - Intronic
1060772393 9:126342086-126342108 GGCTTTGTGCCACGAAACTCTGG + Intronic
1061227029 9:129286336-129286358 GTTTTATTGCCTTCAAAGTCTGG + Intergenic