ID: 1097892842

View in Genome Browser
Species Human (GRCh38)
Location 12:64795244-64795266
Sequence ATCTCCTGCTCGAAGGGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 101}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097892842 Original CRISPR ATCTCCTGCTCGAAGGGTGA AGG Intronic
900223610 1:1522680-1522702 GTCTCCTGCTCTAAGAGGGAGGG + Intronic
902628214 1:17689026-17689048 ATCCCCAGCTCGCAGGGTTAGGG - Intronic
904494103 1:30877150-30877172 GACTCCTGCTCGAAGTCTGAGGG + Exonic
905092614 1:35441421-35441443 ATCCTCTGCTTGAAGGGTGTGGG + Intronic
907211830 1:52830334-52830356 ATGTCCTGGTAGAAGAGTGAAGG + Intergenic
908732635 1:67242150-67242172 ATGCCCTGCTAGAAGAGTGAAGG + Intronic
912506770 1:110161892-110161914 ATCTCCTGCCAGAGGGGTGAGGG - Intronic
914439733 1:147693938-147693960 ATCCCCTGGTGGAAGGCTGAAGG + Intergenic
915444506 1:155967053-155967075 ATTTCCTGCTTGAAGGAAGAGGG - Intronic
917773840 1:178311684-178311706 ATCTCCTGCCTGTAGGGTAAAGG - Intronic
918465314 1:184815818-184815840 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
921359079 1:214313808-214313830 ATTTGCTGCTGGAAGGGTGGAGG - Intronic
922970233 1:229729790-229729812 ATCCCCTCATGGAAGGGTGAGGG - Intergenic
1069832915 10:71291881-71291903 ATCTTCTGCTGGATGGGTGTTGG - Intronic
1072078949 10:92008917-92008939 ATCTCCTGCTAGAATGCAGATGG - Exonic
1076069974 10:127481620-127481642 ACCTCCAGCTCCAAGTGTGAGGG - Intergenic
1078311813 11:10251260-10251282 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1080699750 11:34634580-34634602 TGCTCCTGCTGCAAGGGTGAAGG - Intronic
1082698362 11:56398723-56398745 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1083968373 11:66057181-66057203 CTCTCTTGCTGAAAGGGTGATGG - Intronic
1087226903 11:95611422-95611444 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1087555560 11:99715470-99715492 ATGGCCTGCTCGAATGTTGAAGG - Intronic
1090292885 11:125561329-125561351 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1091049596 11:132355437-132355459 ATGTCCTCCTGGAAGGATGATGG + Intergenic
1091555535 12:1570470-1570492 GTCTCGTGCCTGAAGGGTGAAGG + Intronic
1092666342 12:10803752-10803774 GTCTCCTGCTAGAAGGGTTGAGG - Intergenic
1095701412 12:45194583-45194605 ATCTTCTGCTTGGAGGGTGGAGG + Intergenic
1096108087 12:49010388-49010410 ATTTCATGCTTGGAGGGTGAAGG + Intronic
1096876786 12:54635580-54635602 ATCTCCTGGTCAAAGCATGATGG + Intergenic
1097254578 12:57663910-57663932 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1097892842 12:64795244-64795266 ATCTCCTGCTCGAAGGGTGAAGG + Intronic
1099979105 12:89578241-89578263 ATCTCCAGATCCAAGGGTCAAGG + Intergenic
1101189409 12:102315861-102315883 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
1105465861 13:20639444-20639466 ATCTCCTGCCTGAAGGAGGAGGG + Intronic
1106774983 13:33000070-33000092 ATCTGCTGTCCCAAGGGTGAGGG - Intergenic
1117957273 14:61132228-61132250 AGCCCCTGCTCTCAGGGTGATGG + Intergenic
1121427407 14:93862347-93862369 ATCTCCTTCTAGAGAGGTGATGG + Intergenic
1125198306 15:37073855-37073877 ATCTCCAGCTGGAAGGGTTAAGG + Intronic
1125883788 15:43213797-43213819 ATTTCCTGCTCCAAGGGCGCAGG - Intronic
1127720892 15:61698240-61698262 CTCTCATGCTCCAAGGGAGAAGG - Intergenic
1127919411 15:63481513-63481535 CTATCCTCCTCCAAGGGTGATGG - Intergenic
1132538073 16:493347-493369 ATCTCCTCCACTAAGGGTTATGG - Intronic
1136231189 16:28886455-28886477 AGCCCCTGCTCTTAGGGTGAGGG + Intronic
1139975610 16:70807745-70807767 CTCTCCAGCGCGAATGGTGAAGG + Exonic
1141622709 16:85245492-85245514 AGCTCCTTCTCCAAGGATGACGG - Intergenic
1147625142 17:41895367-41895389 ATCTCCAGCAGGAAGGGTGGAGG + Intronic
1148748845 17:49932994-49933016 AGCTCCTTCTGGAGGGGTGAGGG - Intergenic
1150855647 17:68750027-68750049 ATCTTCTGCTAGAAGGGAGGAGG - Intergenic
1151592255 17:75053182-75053204 ACCTCCAGCTCTAAGGGTAAAGG - Intronic
1151959119 17:77396126-77396148 ACCTCCTGCTCTATGGGTGGGGG + Intronic
1157469047 18:47973723-47973745 AGCTCCTGCTTAAAGGGTGAAGG - Intergenic
1159209742 18:65302277-65302299 ATCTCCTGCTAGATGGGTGGAGG - Intergenic
1162526242 19:11208597-11208619 ATCCCCTGCTGGAAGGGTCTAGG + Intronic
1164737324 19:30551524-30551546 ATCTGCTGCCCAAAGGCTGAAGG - Intronic
1168054511 19:53854570-53854592 ATCTCCTCCTGGAAGCTTGATGG + Intergenic
927708128 2:25309572-25309594 GTCTCCTGCGTGAAGGGGGATGG - Intronic
928214496 2:29350054-29350076 AACTGCTGCTCTCAGGGTGAAGG + Intronic
929114754 2:38434741-38434763 ATCCCATGGTGGAAGGGTGAAGG - Intergenic
929373347 2:41253695-41253717 GTCTTCTGCTGGAAGGGTGTTGG - Intergenic
933893611 2:86791392-86791414 ATCTCCTGGGGGAAGGGAGAGGG - Intronic
936166216 2:110122053-110122075 AGCTCCTGCTCCCAGGGAGAGGG - Intergenic
936595646 2:113844893-113844915 ATGTCCTGCCTGGAGGGTGAAGG - Intergenic
937037359 2:118793190-118793212 ATCTCCTGGTTGAAGTTTGAAGG + Intergenic
945368631 2:208988877-208988899 AACTCCTGCTCACAGGGTTAGGG - Intergenic
946923709 2:224604810-224604832 CTTTCCTGCTTGAGGGGTGAGGG + Intergenic
948753773 2:240146869-240146891 TTCTCTTGCTCCAAGGGTGTGGG - Intergenic
1168862403 20:1055236-1055258 CTCTCCTGCCTGAATGGTGAGGG + Intergenic
1169428160 20:5512152-5512174 GTCTCCTTCTCCCAGGGTGATGG + Intergenic
1172090850 20:32431431-32431453 AGCTGCTGCTGGAAGTGTGATGG - Exonic
1184636507 22:45836440-45836462 AGCTCCCGCTCGCAGGGTGCTGG - Intronic
951250336 3:20386953-20386975 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
953900458 3:46838092-46838114 GTCTACTGCTGGAAGAGTGAGGG + Intergenic
955689763 3:61579357-61579379 ATCTCCTTCACCAGGGGTGAGGG + Intronic
956713910 3:72061803-72061825 GTATCCTGCTCCAAGGGTGAGGG + Intergenic
960874934 3:122286760-122286782 ACCTCCTGCTAGACTGGTGATGG - Intergenic
964987905 3:162767207-162767229 ATCCACTGGTGGAAGGGTGAGGG + Intergenic
966536207 3:181037152-181037174 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
972819190 4:42680004-42680026 ATGTCCTGCTAGAAGAGTGAAGG - Intergenic
978451554 4:108839838-108839860 ATCTCCTAATCCAATGGTGATGG + Intronic
979206486 4:118044778-118044800 ATCTCATGGTGGAAGGTTGAAGG + Intronic
986148797 5:5107622-5107644 ATCTCATGCTGGAAAGGCGAGGG - Intergenic
987031741 5:13982814-13982836 TCTTCCTGCTCCAAGGGTGAGGG - Intergenic
989336791 5:40327096-40327118 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
990290870 5:54350119-54350141 ATGTCCTTCTAGAAGAGTGAAGG - Intergenic
994356698 5:98801116-98801138 ATCTCCAGCATGAAGGGAGAAGG + Intergenic
997402504 5:133613114-133613136 ATATCCTGTTCTAAGGGAGAAGG - Intergenic
997426141 5:133803987-133804009 ATCTCCTGCTTCAAGGCTGGAGG + Intergenic
1003169509 6:3710040-3710062 ATCTCCTGCTCGAAGCTTTTGGG - Intergenic
1003234500 6:4283508-4283530 AGCTCCATCTCTAAGGGTGAGGG - Intergenic
1006562615 6:34926705-34926727 TTCTCCTCCTGGAAGAGTGAGGG - Intronic
1014194760 6:118541723-118541745 TGCTCCTGCTCTAAGGATGAGGG - Intronic
1016584822 6:145672802-145672824 AACTCCTGCCTGGAGGGTGAAGG - Intronic
1020899209 7:13983099-13983121 AACTCCTACTCGAAGTGTGGAGG + Intronic
1021115600 7:16743211-16743233 ATTTCCTGCTAGAAGTTTGAGGG - Intergenic
1023218566 7:37893831-37893853 CTCTCCTGCTGGAAGGGAGGTGG - Intronic
1026795427 7:73363431-73363453 ACCTCCTGCGCGATGGGTTAGGG - Intergenic
1029810797 7:103046421-103046443 ATGTCCTTCTAGAAGAGTGAAGG + Intronic
1029907264 7:104104364-104104386 AACTCCTGGCAGAAGGGTGAAGG - Intergenic
1038549743 8:28456821-28456843 ATCCCCTGCTCAAAGGGAGTTGG + Exonic
1040793966 8:51269114-51269136 TTCTCCTGCTGGAAGTATGAGGG + Intergenic
1042316559 8:67432204-67432226 CTCTCCTCCTCAGAGGGTGAAGG - Intronic
1048688852 8:136935769-136935791 ACCTCCTGCTCTCAGGGTCAGGG + Intergenic
1050658085 9:7851524-7851546 ATGTCCTTCTAGAAGAGTGAAGG - Intronic
1051543212 9:18244585-18244607 AGTTCATGCTTGAAGGGTGAAGG - Intergenic
1055970596 9:81908193-81908215 ATGTCCTTCTAGAAGAGTGAAGG + Intergenic
1057744227 9:97738871-97738893 CTTTCCTGCTCTAAGGGAGATGG + Intergenic
1061015967 9:127980904-127980926 CGCTGCTGCTCGAAGGGTGCCGG - Intergenic
1193782551 X:85721344-85721366 ATCTCCTACTAGAGGGCTGATGG - Intergenic