ID: 1097894361

View in Genome Browser
Species Human (GRCh38)
Location 12:64809727-64809749
Sequence TCACAGATGCAGAGGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 539
Summary {0: 1, 1: 0, 2: 1, 3: 90, 4: 447}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097894361_1097894364 2 Left 1097894361 12:64809727-64809749 CCAGCTTCCCTCTGCATCTGTGA 0: 1
1: 0
2: 1
3: 90
4: 447
Right 1097894364 12:64809752-64809774 CGTGCTCTGCTTCTTGTTTGTGG 0: 1
1: 0
2: 0
3: 10
4: 158
1097894361_1097894365 8 Left 1097894361 12:64809727-64809749 CCAGCTTCCCTCTGCATCTGTGA 0: 1
1: 0
2: 1
3: 90
4: 447
Right 1097894365 12:64809758-64809780 CTGCTTCTTGTTTGTGGCTTTGG 0: 1
1: 0
2: 2
3: 31
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097894361 Original CRISPR TCACAGATGCAGAGGGAAGC TGG (reversed) Intronic
900031131 1:373875-373897 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900031141 1:373914-373936 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051698 1:602124-602146 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
900051708 1:602163-602185 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
900144464 1:1151809-1151831 AGACAGAGGCAGAGGGGAGCGGG - Intergenic
900311957 1:2037777-2037799 ACACAGAGGCAGGGGGAAGAGGG + Intergenic
900533840 1:3167653-3167675 TCACAGAGGCACTGGGAGGCAGG - Intronic
900607527 1:3530536-3530558 TCCCAGCTGCAGAGAGAGGCAGG + Intronic
900874090 1:5329196-5329218 CCACAGATGCAGAGAGAGACAGG + Intergenic
900888419 1:5431818-5431840 TCGCAGATGCAGATGGGTGCAGG - Intergenic
901302916 1:8212639-8212661 TCAAGCTTGCAGAGGGAAGCTGG + Intergenic
901515300 1:9741257-9741279 CTACAGAGGCAAAGGGAAGCGGG + Intronic
903761663 1:25702819-25702841 TCAAAGCTGCCCAGGGAAGCAGG + Intronic
903848201 1:26290830-26290852 TCAGAGATGCAGAGGGTGGGGGG + Intronic
904163520 1:28538069-28538091 TGACAGCTGCAGATGGCAGCGGG + Exonic
904182746 1:28678232-28678254 TTACAGAGACAGAGGGAAGGGGG + Intronic
904285532 1:29451205-29451227 TCACAGATGCTGAGAAAAACAGG + Intergenic
904577210 1:31512692-31512714 TCACAGCTGGAGAGAGAACCTGG - Intergenic
904772875 1:32890695-32890717 TCAGAGATGCAGAAGGAAAGGGG - Intronic
904979224 1:34482844-34482866 AGACAGACGGAGAGGGAAGCAGG + Intergenic
904994880 1:34623819-34623841 GCAAAGAAGCAGAGGGAACCAGG + Intergenic
905008088 1:34727300-34727322 ACCTAGATGCAGAAGGAAGCTGG - Intronic
905174175 1:36125676-36125698 TCACAGAGGCAGGCGGGAGCAGG + Intergenic
905309939 1:37042385-37042407 ACAGAGATGCAGGGAGAAGCGGG - Intergenic
907114017 1:51952824-51952846 TCACAGAAGCTGAGGAAAGAGGG - Intronic
908234636 1:62137700-62137722 ACACAGATTGAGAGGGAAGCAGG + Intronic
908260669 1:62337505-62337527 TCACAGTTAGAAAGGGAAGCTGG + Intergenic
908910001 1:69062271-69062293 ACACAGAGACAGAGGGAGGCGGG + Intergenic
909772629 1:79442742-79442764 ACACAGACGCAGAGGGAAGATGG + Intergenic
910232765 1:85003347-85003369 CCACAGAAGCAGTGGCAAGCTGG + Intronic
910502337 1:87907191-87907213 TGACACACGCAGTGGGAAGCTGG - Intergenic
912567270 1:110597084-110597106 TGAGAGCTGCAGAAGGAAGCAGG - Intronic
913059431 1:115191349-115191371 TCACAGAAGCAAGGGGTAGCAGG - Intergenic
913943896 1:125138764-125138786 TCACAGATCCAGAGAGAAGAGGG - Intergenic
913955300 1:143284990-143285012 TCACAGATCCAGAGAGAAGAGGG + Intergenic
913982134 1:143530454-143530476 TCACAGATCCAGAGAGAAGAGGG - Intergenic
914690707 1:150023940-150023962 TAACATATGCAGGAGGAAGCTGG - Intergenic
914902322 1:151717257-151717279 ATATAGATGGAGAGGGAAGCAGG + Intronic
915528324 1:156489544-156489566 ACAAAGATTCAGAGAGAAGCAGG + Intronic
915606816 1:156957386-156957408 TGACATCTGCAGAGGGGAGCTGG - Intronic
917846960 1:179027089-179027111 TCAAACCTCCAGAGGGAAGCTGG - Intronic
919354067 1:196499063-196499085 ACACATATGCAGAAGGAAGATGG + Intronic
919548060 1:198949014-198949036 ACGCAGATGCAGCGGGAAGGCGG + Intergenic
919752849 1:201048935-201048957 TCACTGAGGCAGAGGGAAACTGG - Intronic
919803780 1:201368830-201368852 TCACTGATGCACTGGGAAGTGGG + Intronic
920428617 1:205899447-205899469 CCACAGAGGGAGAGCGAAGCAGG + Intergenic
920617450 1:207507426-207507448 ACACAGACCCAGAGGGAAGACGG - Intronic
920620110 1:207537228-207537250 ACACAGACCCAGAGGGAAGATGG - Intronic
920621892 1:207555783-207555805 ACACAGACCCAGAGGGAAGATGG - Intronic
920623518 1:207572877-207572899 ACACAGACCCAGAGGGAAGATGG - Intronic
920636084 1:207705128-207705150 ACACAGACCCAGAGGGAAGATGG - Intronic
921163359 1:212488276-212488298 GGACAGAAGCAGAGGGAAGGAGG + Intergenic
921315431 1:213886008-213886030 TCAGAGATGCAGAGAGAGGAAGG - Intergenic
923125094 1:231027775-231027797 TCACAGATGCAGTGGGGATGAGG - Intronic
923796981 1:237166238-237166260 TCAGAGAAGCAGATGGAAGTTGG - Intronic
923872124 1:238006794-238006816 TCAAAAATGAAGAGAGAAGCTGG - Intergenic
1062908815 10:1199219-1199241 TCACAGGAACAGCGGGAAGCGGG - Intronic
1063117026 10:3079002-3079024 TCACAGGTGGAGAGGGAGCCTGG - Intronic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1064796250 10:19014831-19014853 ACACAGACACAGAGGGAAGAAGG + Intergenic
1065286560 10:24192684-24192706 TCACACATGCAGAGTGAATTGGG - Intronic
1066779431 10:38927736-38927758 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1066951794 10:42125885-42125907 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1067166959 10:43873117-43873139 TCACAGATGCAGAGATGTGCAGG + Intergenic
1068177631 10:53482321-53482343 ACACAGATGCACAGGGAAGAAGG + Intergenic
1068962016 10:62876679-62876701 TCACAGAGGGAAAGGGAAGATGG + Intronic
1069021635 10:63494946-63494968 TCTCACATACAGAGGGAAGTGGG - Intergenic
1070483906 10:76911697-76911719 CAAGAGAGGCAGAGGGAAGCTGG - Intronic
1071808595 10:89152658-89152680 CCACAGATGCAGAGGGACAAAGG - Intergenic
1071833507 10:89395425-89395447 TTACAGATCCAGAGAGAAGAGGG - Intronic
1072323675 10:94275211-94275233 GTACAGCTGCAGAGGGAAGAGGG - Intronic
1074876658 10:117618889-117618911 ACACAGACACAGAGGGAAGAAGG + Intergenic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075323652 10:121512465-121512487 TAACAGAAGCAGAGGAAAGGGGG - Intronic
1075951601 10:126482509-126482531 TCACAGAAGCACAGGTGAGCAGG + Intronic
1076160161 10:128237535-128237557 TTACAGATGCTGAAGGAAGATGG + Intergenic
1076479766 10:130777503-130777525 ACACAGAACCAAAGGGAAGCTGG + Intergenic
1076590374 10:131578314-131578336 CCAGGGATGCAGAGAGAAGCGGG + Intergenic
1076700574 10:132270695-132270717 TTACAGACGCAGAGGGAGGGAGG - Intronic
1077383926 11:2260204-2260226 CCAAAGATGCAGAGGGATGTCGG + Intergenic
1077493051 11:2870947-2870969 CCAAAGGTGCAGAGGGAAGAGGG - Intergenic
1077590927 11:3490481-3490503 TCACAGAGACACAGGGAAGAAGG + Intergenic
1077621925 11:3733196-3733218 TCATAGTTGCAAAGGGAAGAGGG - Intronic
1079401750 11:20111568-20111590 TGACAGCTCCAAAGGGAAGCAGG - Intronic
1081027578 11:38035057-38035079 TCCCGGATGCTGAGCGAAGCAGG + Intergenic
1081265869 11:41020519-41020541 ACAGACATGCAGAGGGAAGATGG + Intronic
1081635471 11:44718657-44718679 TAACAGAAGGAGAGGGAAGGAGG + Intergenic
1081907693 11:46679911-46679933 TCACAGAGGAAGAGGGAGGCAGG - Intronic
1082753565 11:57048894-57048916 CCACAGATGCTGAAGGGAGCAGG + Intergenic
1082824236 11:57566682-57566704 TCTCAGAGGCTGAGGGTAGCAGG + Intronic
1084004129 11:66314339-66314361 TCAGAGATTCTCAGGGAAGCAGG - Intergenic
1084007759 11:66332291-66332313 AACCAGAGGCAGAGGGAAGCCGG - Exonic
1084246646 11:67862231-67862253 TCACAGAGACACAGGGAAGAAGG + Intergenic
1084473071 11:69374525-69374547 TTACAGCTGCAGAGGAAAACAGG + Intergenic
1084687207 11:70703675-70703697 TCACTGGTGCACAGGGAGGCTGG - Intronic
1084706361 11:70818360-70818382 TCACACATGAACAGGGAAACAGG + Intronic
1085528948 11:77180360-77180382 CCACAGATACTGAGGGAAGGGGG - Exonic
1085793015 11:79512351-79512373 TCACAGCTGTAGAGGGAGGGAGG + Intergenic
1086452032 11:86926633-86926655 TAAGAGATGCATAGAGAAGCAGG - Intronic
1086855751 11:91863336-91863358 ACAAAGATGCAGAGAGAAACAGG - Intergenic
1086974295 11:93114825-93114847 TTACAGATGTAGAGGGCAGAGGG - Intergenic
1089296824 11:117474341-117474363 GCACAGAGACAGAGAGAAGCTGG - Intronic
1089898948 11:121961417-121961439 TCACTGATGCTGCGGGCAGCAGG - Intergenic
1090072631 11:123557581-123557603 TGTCAGATGCAGTGAGAAGCAGG + Intronic
1090516405 11:127432878-127432900 TCACAGAAGCAAGGGGAAACTGG - Intergenic
1092288099 12:7141503-7141525 GCACAGCTGCAGAGAGATGCAGG - Intronic
1092834479 12:12474652-12474674 TCACAGTTCCAGAAGGAAGGGGG + Exonic
1092959138 12:13579237-13579259 ACACAGCTGAAGAAGGAAGCAGG + Intronic
1092986192 12:13848409-13848431 TGCCAGGAGCAGAGGGAAGCAGG + Intronic
1094146536 12:27234200-27234222 TCACATATGCAGAGGGATTGTGG - Intergenic
1096799041 12:54097239-54097261 CCACAGGTGTAGAGGGAAGGAGG - Intergenic
1097059866 12:56274838-56274860 ACACAGCTGCAGAAGGAAGTTGG - Exonic
1097894361 12:64809727-64809749 TCACAGATGCAGAGGGAAGCTGG - Intronic
1098902118 12:76123459-76123481 TCACAGATTAAGAGGGAAACGGG - Intergenic
1099970460 12:89494850-89494872 TTACACATGCAGAGGAAAGATGG - Intronic
1101300302 12:103472797-103472819 ACACACATTCAGAGAGAAGCAGG + Intronic
1102002175 12:109564056-109564078 TGCCCGATGCAGAGGGAACCTGG - Intronic
1102148451 12:110671950-110671972 TGACAGAGGCAGAGGGAAGTGGG + Intronic
1102450769 12:113040410-113040432 TCATAGATGCAGAGAGTAGAAGG - Intergenic
1103522951 12:121548629-121548651 TCACAGATCCCCAGGGGAGCTGG + Intronic
1104433246 12:128733895-128733917 TGACATATGCAGAGGAAAGACGG + Intergenic
1105233498 13:18523156-18523178 TTACAGATCCAGAGAGAAGAGGG - Intergenic
1105408380 13:20150335-20150357 ACAGAGATGAAGAGGGAGGCAGG + Intronic
1105644890 13:22306531-22306553 CAACAGATGTAGAGGGAAGATGG - Intergenic
1106079051 13:26485462-26485484 ACACATATCAAGAGGGAAGCTGG + Intergenic
1106743962 13:32679862-32679884 TCACAGACGAAGAGGAAAGGAGG - Intronic
1107298239 13:38937504-38937526 TTACAGATCCAGAAAGAAGCTGG + Intergenic
1107998954 13:45889126-45889148 TCACAGATGCACAGGGAGCTAGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108117426 13:47144859-47144881 TCACAGTTGCACAGGGAAGGAGG - Intergenic
1108868926 13:54958567-54958589 ACAGAGATGCAGAGAGCAGCAGG + Intergenic
1109222931 13:59658970-59658992 TCACAAGTTCAGAGGGAGGCAGG - Intergenic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1112596992 13:100816399-100816421 TCAGAGATGCTGGGGGAAGTGGG + Intergenic
1114181255 14:20369763-20369785 TCACAGAGGCAAAAGGAATCAGG - Exonic
1115640501 14:35332760-35332782 ACACAGAGGCACAGGGAAGCAGG - Intergenic
1115755676 14:36524522-36524544 TCACAGACGCAGCGGGAGGAAGG + Intergenic
1115906119 14:38205097-38205119 TCACAGAGGCATAGGAAAGATGG + Intergenic
1116464044 14:45211965-45211987 TAAAAGAGGCAGAGGGAGGCTGG - Intronic
1117784366 14:59267165-59267187 TAACAGATACAGAGGTAAGATGG - Intronic
1118054923 14:62069886-62069908 TCTCAGATGCAGAGTGCAGAGGG - Intronic
1118473315 14:66094512-66094534 TCCGAGATGCAGCAGGAAGCAGG + Intergenic
1118995049 14:70827955-70827977 ACACAAATGCAGAGGGCAGTTGG + Intergenic
1119217157 14:72877774-72877796 TCACTTATGCACAGGGTAGCAGG - Intronic
1119235766 14:73017967-73017989 GAAGAGGTGCAGAGGGAAGCAGG - Intronic
1120009731 14:79399971-79399993 ACACATATGCACAGGGAAGAAGG - Intronic
1120997260 14:90426260-90426282 TCCCAGAAGCAGAGGGCAGCGGG - Intergenic
1122337887 14:101005811-101005833 TCACAGATGCAGTGGGCCGGGGG + Intergenic
1202937831 14_KI270725v1_random:108517-108539 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1123395380 15:19929370-19929392 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1123682757 15:22774399-22774421 TCGCAGATGGAGAGAGAAGTAGG + Intronic
1123762726 15:23445169-23445191 TCGCAGATGGAGAGAGAAGTAGG + Intronic
1125170963 15:36766095-36766117 TCATAGAAGCAGAGAGCAGCTGG - Intronic
1125360253 15:38857391-38857413 TCACAGATACTGAGTGAAGAAGG + Intergenic
1125954532 15:43780603-43780625 TCACAGATACAGAAGGCAGAAGG - Intronic
1126050402 15:44680028-44680050 TCCCAGATCCAGAGGGAATTGGG - Intronic
1126333338 15:47557981-47558003 TCAAGGATGCAGAGTAAAGCTGG - Intronic
1127638418 15:60892979-60893001 TCACAGAAGCAGAGGGCAATGGG - Intronic
1127755614 15:62088979-62089001 TCACAGTGGCAAAGGGAAGAGGG + Intergenic
1128079969 15:64851129-64851151 TCAGAGAAGCAGTGGGAAGAGGG + Intronic
1128355140 15:66921074-66921096 CCAGAGACGCAGAGGGAAGATGG + Intergenic
1128379706 15:67103612-67103634 TCACAGCTGGAAAGGGTAGCTGG - Intronic
1128562989 15:68680885-68680907 TCACAAATGCTGTGGGAAGAAGG + Intronic
1129312400 15:74721843-74721865 TTGCAGAGGCAGAGAGAAGCTGG - Intronic
1129875964 15:78975964-78975986 TCACACATGCAGGGTGAAGGGGG - Intronic
1130149170 15:81298364-81298386 TCCCAGGGGCAGAGGGAGGCTGG - Intronic
1131022197 15:89108363-89108385 ACACAGATACAGAGGGGAGGAGG - Intronic
1131371570 15:91886120-91886142 GCAAAAATGCAGAGGTAAGCAGG - Intronic
1131672091 15:94630944-94630966 TCACAAATGAAGAAGGCAGCAGG + Intergenic
1132156805 15:99501646-99501668 CCACAGATACAGGGGGTAGCTGG - Intergenic
1132933393 16:2469761-2469783 CCACAGATGCACAGGGATGGGGG - Intergenic
1133356303 16:5139514-5139536 TCACAGAGACACAGGGAAGAAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1133925304 16:10187423-10187445 TCACCATTGCACAGGGAAGCTGG + Intergenic
1134211282 16:12279606-12279628 TCCCAAGTGGAGAGGGAAGCAGG + Intronic
1135630628 16:24033343-24033365 ACACAGATGCAGGGGAAAGATGG + Intronic
1136697701 16:32100278-32100300 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136701475 16:32147806-32147828 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136766190 16:32779658-32779680 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1136769877 16:32827338-32827360 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1136798198 16:33043560-33043582 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136801908 16:33090720-33090742 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136900719 16:34034653-34034675 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136940035 16:34515092-34515114 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1136945725 16:34648697-34648719 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136948573 16:34687280-34687302 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136956062 16:34787729-34787751 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136959784 16:34833474-34833496 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1136967961 16:34937846-34937868 TCAAAGATCCAGAGAGAAGAGGG - Intergenic
1137088454 16:36158561-36158583 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1137092969 16:36217799-36217821 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1137220224 16:46441766-46441788 TTACAGATCCAGAGAGAAGAGGG + Intergenic
1137306698 16:47207645-47207667 TAACAGATGCAGAGTTAAGAAGG + Intronic
1137507168 16:49064245-49064267 GCACAGAGGCAGAGGGAACCTGG - Intergenic
1138191378 16:55016776-55016798 ACACAGATGCTTTGGGAAGCGGG - Intergenic
1138613727 16:58147807-58147829 GGACAGAGGCAGAGGGAAGCCGG - Intergenic
1139291145 16:65859145-65859167 TCACTGATGGGGAGGGAGGCAGG - Intergenic
1139633503 16:68244783-68244805 TTACAGATGCGGGGGGAACCGGG - Intergenic
1140585790 16:76290276-76290298 TCACAGATGCAGGGAGAAGATGG - Intronic
1140796393 16:78442481-78442503 TCACAGAAGCAGAGAGTAGAGGG - Intronic
1141551147 16:84807510-84807532 ACACAGATGCACCGGGAAGGTGG + Intergenic
1142003184 16:87675726-87675748 TCCCAGCTGCAGCAGGAAGCAGG + Intronic
1203068576 16_KI270728v1_random:1041904-1041926 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1203072298 16_KI270728v1_random:1089442-1089464 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1143427885 17:6854351-6854373 TCAGAGAAGCAGGGGAAAGCCGG - Intergenic
1144666849 17:17107854-17107876 TTACAGACACAGAGGGCAGCAGG - Intronic
1145692003 17:26751792-26751814 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1145708737 17:26948405-26948427 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1146469111 17:33110394-33110416 TTCCAGATGCAGAGGGACGAAGG - Intronic
1148989482 17:51652960-51652982 TAGCAGATGTAGAGAGAAGCAGG - Intronic
1148994601 17:51698744-51698766 TCACAGAAGCAGAGAGTAGGTGG - Intronic
1149577855 17:57726857-57726879 CCACAGATGCTGGGGGGAGCTGG + Intergenic
1149798932 17:59548437-59548459 GAACAGAAGCAGAGGGAAGCAGG - Intergenic
1150345625 17:64402693-64402715 CCAGAGAGGCAGAGGGAGGCGGG - Intronic
1150752395 17:67877268-67877290 CCACAGAAACAGAAGGAAGCAGG - Intronic
1151330402 17:73403143-73403165 TCACACAGGTAGGGGGAAGCTGG + Intronic
1152296783 17:79472069-79472091 GCACACCTGCAGAGGGCAGCTGG - Intronic
1152722146 17:81928387-81928409 TCACAGCTGCGAAGGGAAGAGGG - Intergenic
1152948512 17:83211799-83211821 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203183525 17_KI270729v1_random:89330-89352 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1152985778 18:319217-319239 GCACACATGCACAGTGAAGCGGG - Intergenic
1153958626 18:10121240-10121262 TCACAGAAGCAGAGAGCAGAAGG + Intergenic
1154046960 18:10915241-10915263 TCACGTGTGCAGAGGGAAGCAGG + Intronic
1154174702 18:12077787-12077809 TCACGTGTGCAGAGGGAAGCAGG - Intergenic
1155047580 18:22116295-22116317 TCATAGATGCAGAGGAAAGGTGG + Intergenic
1155108201 18:22688060-22688082 TCAAAGCTGCACAGGGCAGCTGG + Intergenic
1156241306 18:35257305-35257327 TCACAGTGGCTGAGGGAAGGAGG - Intronic
1157690929 18:49681205-49681227 CCACAGATTCAGAGCGAAGGGGG + Intergenic
1157741826 18:50100382-50100404 TCACAGATACCAAAGGAAGCTGG - Intronic
1157974396 18:52310436-52310458 TGGCAGCTGCAGGGGGAAGCAGG + Intergenic
1158517577 18:58143581-58143603 TCACAGAGGGAGAGCGCAGCAGG + Intronic
1158878494 18:61754387-61754409 AGACAGATGCACAGGGAAGAAGG - Intergenic
1158878724 18:61755830-61755852 GCAGAGCTGCAGAGGTAAGCTGG + Intergenic
1159595479 18:70378771-70378793 TCATAGAAGCAGAGGGAAAGGGG - Intergenic
1159654989 18:71022621-71022643 TCACAGGGTCAGAGGGAGGCAGG - Intergenic
1160098744 18:75901081-75901103 GCACAGATGCTGAGGGATACAGG + Intergenic
1160322839 18:77912453-77912475 GCACAGCTGGAGAGGAAAGCAGG - Intergenic
1160562526 18:79767693-79767715 TCACAGAAGCTGAGACAAGCAGG + Intergenic
1160729499 19:634525-634547 TCCCAGTTGCAAAGGGGAGCTGG + Intergenic
1160918705 19:1509964-1509986 AAACAGGGGCAGAGGGAAGCAGG - Intronic
1161092856 19:2371337-2371359 TGACAGATGAAGACGGAAGTCGG + Intergenic
1163028390 19:14527698-14527720 TCACTGATTCACAGGGGAGCAGG - Intronic
1163200953 19:15768674-15768696 GCAAAGATGCAGAAAGAAGCAGG - Intergenic
1163562970 19:18031565-18031587 ACACAGCTGCAGAAGGAAGTTGG + Intergenic
1164626255 19:29730315-29730337 TCACAGATGAACAGGGAAGGAGG - Intergenic
1164753783 19:30674722-30674744 TCCCAGCTACAGAGGCAAGCTGG - Intronic
1164840823 19:31390909-31390931 TCACAGATGCTGAGGGTGGCAGG + Intergenic
1166193313 19:41190355-41190377 TCCCAGATGGGGTGGGAAGCTGG + Intergenic
1167165595 19:47797870-47797892 TCACATATGCAGAGAAAATCAGG + Intergenic
1167615649 19:50531431-50531453 ACCCAGCTGCAGAGGGAAGGGGG + Intronic
1167782463 19:51608060-51608082 TCTCAAATGCAGAGGTAAGAAGG - Intergenic
1167787026 19:51645444-51645466 TCACAGCCCCAGAGGGAAGAGGG + Intronic
1168336675 19:55600857-55600879 GCACAGGTGCAGCTGGAAGCAGG - Intronic
1202671645 1_KI270709v1_random:59875-59897 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1202681991 1_KI270712v1_random:14647-14669 TCACAGATCCAGAGAGAAGAGGG - Intergenic
925248875 2:2411730-2411752 TCACAAATCCAGAGGGAGGATGG - Intergenic
925273669 2:2633854-2633876 TCACAGAAGCAGAGAGTAGATGG - Intergenic
925820495 2:7795089-7795111 ACACAGGTGCACAGGGAACCCGG + Intergenic
927085489 2:19671097-19671119 TCTCAGATGCACAGTAAAGCAGG - Intergenic
927399486 2:22694761-22694783 TCACAGATGCTGAGAGCAGAAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
927484107 2:23477241-23477263 CCCCTGCTGCAGAGGGAAGCTGG - Intronic
927542233 2:23923315-23923337 TCACAGAAGCAGAGAGTAGAAGG + Intronic
927653401 2:24926387-24926409 TGACGCAGGCAGAGGGAAGCGGG + Intergenic
928083256 2:28328344-28328366 TCACAGCTGCAGAAGAAAACTGG + Intronic
928429418 2:31205408-31205430 TTTCCGATGCAGATGGAAGCTGG - Exonic
930334685 2:50029996-50030018 TCAAAGATGCAAATGCAAGCAGG + Intronic
931431417 2:62211815-62211837 TCAGAAATGTAGAGAGAAGCAGG - Intronic
931982486 2:67709268-67709290 TGCCAGATGCAAAGGGAAGGAGG + Intergenic
932192452 2:69752336-69752358 GAACAGATGCAAAGGGAAGTAGG - Intronic
932481389 2:72041644-72041666 TGAGAGAGGCAGAGGGCAGCAGG + Intergenic
933367008 2:81365597-81365619 TTACAGATGTAGAGATAAGCAGG + Intergenic
933748979 2:85591085-85591107 TCCCAGACGGAGAGGGAAGTTGG + Intronic
933813895 2:86050558-86050580 TCAGGGCTGCAGAAGGAAGCAGG - Intronic
934249783 2:90340446-90340468 TCACAGATCCAGAGAGAAGAGGG + Intergenic
934259792 2:91463000-91463022 TCACAGATCCAGAGAGAAGAGGG - Intergenic
934303095 2:91794929-91794951 TCACAGATCCAGAGAGAAGAGGG - Intergenic
934330164 2:92057827-92057849 TCACAGATCCAGAGAGAAGAGGG + Intergenic
934468387 2:94287736-94287758 TCACAGATCCAGAGAGAAGAGGG + Intergenic
935605089 2:104963981-104964003 CCACAAATGCAGAGGGATGATGG - Intergenic
937289235 2:120772049-120772071 ACACAGATGGAGGGGGATGCAGG + Intronic
937340318 2:121086936-121086958 TCAGGGATGTAGAGGGAAGATGG + Intergenic
937390550 2:121482251-121482273 GTCCAGGTGCAGAGGGAAGCTGG - Intronic
938519507 2:132052929-132052951 TCACAGATCCAGAGAGAAGAGGG + Intergenic
939448304 2:142337888-142337910 TGGGAGATGAAGAGGGAAGCAGG - Intergenic
940972271 2:159906733-159906755 CCACAGAGGCAGAGGGGATCAGG - Intergenic
944177335 2:196847037-196847059 TCACAGATGCAGAAGACAGTAGG + Exonic
945168767 2:206973992-206974014 TCAAAGATGGAGAGCGATGCAGG - Intergenic
946038542 2:216764367-216764389 TCAAAGATGGAGAGGAAAGGGGG - Intergenic
947133121 2:226950225-226950247 TCACAGAAGCAGAGAGCAGAAGG - Intronic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
948301859 2:236913753-236913775 TCTCAGATGCACAAGGAAGGAGG + Intergenic
948703436 2:239775045-239775067 ACATAGAAGCAGAGGGAAGGGGG + Intronic
948792601 2:240386680-240386702 TCACAGAGGCAGAGGGCAGACGG + Intergenic
1169319152 20:4616951-4616973 ACACAGACACAGAGGGAAGATGG - Intergenic
1169413189 20:5392260-5392282 TCAACTATGCAGAGGGAAGAGGG - Intergenic
1170926707 20:20731245-20731267 ACACATATGCAGAGGGACGTGGG + Intergenic
1171415975 20:24980664-24980686 TGACAGAGGCTGAGCGAAGCTGG - Intronic
1172593789 20:36135629-36135651 TCAGATATGTAGAGGGAAGCAGG - Intronic
1172700202 20:36848607-36848629 TCAGAGAAGCACAGGGAAGGTGG + Intronic
1174113678 20:48213056-48213078 CCACCGACACAGAGGGAAGCAGG - Intergenic
1174160360 20:48546141-48546163 TGACAGATGCAGATGGATGGAGG - Intergenic
1174168179 20:48599485-48599507 CCACTGACACAGAGGGAAGCAGG + Intergenic
1175213243 20:57375057-57375079 GCACAGAAGCACAGGCAAGCCGG + Intronic
1175930481 20:62491622-62491644 TCACAGCTGAAGTGGGGAGCAGG - Intergenic
1176154668 20:63612651-63612673 CCACAGTTGCAGAGGAAAGTGGG - Intronic
1176777482 21:13151435-13151457 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1177819331 21:26013864-26013886 TGATAGAGGCAGAGTGAAGCAGG - Intronic
1178297778 21:31425217-31425239 GCACAGATGGAAAGGAAAGCAGG + Intronic
1178895935 21:36556978-36557000 TCACAGAAGCAGAGAGTAGATGG - Intronic
1178907873 21:36651239-36651261 TCAAAAATACAGAGAGAAGCAGG - Intergenic
1179038242 21:37778822-37778844 TTACAGAGGCAGAAGGAAGGAGG - Intronic
1179050415 21:37884394-37884416 GCTGAGATGCAGAGAGAAGCTGG - Intronic
1179126868 21:38598738-38598760 CCACAGTCGCAGAGGGGAGCAGG + Intronic
1179174924 21:39001241-39001263 TCAGAGATGCAGAGCAGAGCAGG - Intergenic
1180011036 21:45051698-45051720 CCTCACATGCAGAGGGTAGCTGG - Intergenic
1180139288 21:45881747-45881769 TCACAGAAGCAGAGGGTGGGAGG - Intronic
1180525094 22:16250901-16250923 TCACAGACCCAGAGAGAAGAGGG - Intergenic
1181032326 22:20154586-20154608 TCAGAGATGCAGAGAGCAGGGGG - Intergenic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1182026428 22:27122844-27122866 TCACAGATGCCCCGGGAAACTGG - Intergenic
1182677143 22:32048247-32048269 ACACAGAAGAAGAGGGAAGATGG + Intronic
1182832624 22:33315984-33316006 TAGCAGATGCACTGGGAAGCAGG + Intronic
1182948241 22:34345298-34345320 TCTCATATTCAGAGGAAAGCAGG + Intergenic
1184220317 22:43095511-43095533 TCACAGCTGCCCCGGGAAGCTGG - Intergenic
1184330813 22:43826327-43826349 CCACAGCCTCAGAGGGAAGCTGG - Intronic
1184715256 22:46278340-46278362 ACACAGATGCCGAGGGAAGGCGG - Intronic
1184876152 22:47277062-47277084 TCACAGATGCTGAGGACACCAGG - Intergenic
1184887119 22:47353268-47353290 TCACAGATGCAGAGAAGAGTTGG + Intergenic
1185401339 22:50619492-50619514 TCACAGAATCAGAGGGAATTAGG + Intergenic
1203237355 22_KI270732v1_random:17963-17985 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1203290440 22_KI270735v1_random:32110-32132 TCATAGATCCAGAGAGAAGAGGG + Intergenic
1203323291 22_KI270737v1_random:90131-90153 TCACAGATCCAGAGAGAAGAGGG + Intergenic
949096285 3:89733-89755 ACACAGAGGCAGAAGGGAGCCGG + Intergenic
950544291 3:13629543-13629565 TGACAGAGACCGAGGGAAGCAGG - Intronic
950624160 3:14232031-14232053 TCCCAGCTGCAGAGGTGAGCTGG - Intergenic
950995471 3:17491873-17491895 TCAGAGGTGCAGAAAGAAGCTGG - Intronic
952154314 3:30626539-30626561 TCAAGGAAACAGAGGGAAGCCGG + Intronic
953415355 3:42712497-42712519 AGCCAGGTGCAGAGGGAAGCTGG - Intronic
954544438 3:51420705-51420727 TCACAGATGCAGACCAAATCCGG - Exonic
955780856 3:62483103-62483125 TCTCAGATGCAGAGTTAGGCTGG - Intronic
956906695 3:73773359-73773381 TTACTGACTCAGAGGGAAGCTGG + Intergenic
959874777 3:111369975-111369997 TCAAATATTCAGAGAGAAGCAGG - Intronic
959962981 3:112321756-112321778 TCAAAGTTGTAGAGGTAAGCAGG - Intergenic
960005150 3:112774153-112774175 TCACAGATGTGCAGAGAAGCAGG - Intronic
960822052 3:121744835-121744857 TCAGAGATCCACAGGAAAGCAGG + Intronic
960933618 3:122880776-122880798 ACACAGGTGCAGAGAGGAGCAGG - Exonic
961112537 3:124297297-124297319 GCCCAGTTGCAGAGTGAAGCAGG - Intronic
961597466 3:128029901-128029923 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
961648660 3:128406315-128406337 TCATAGAAGCAGAGGGTAGAAGG + Intronic
961745436 3:129061259-129061281 TCCCAGATGCAGAAGACAGCAGG - Intronic
961811101 3:129522285-129522307 TCACAGACGCAGACTGAGGCTGG - Intergenic
961894761 3:130157969-130157991 TCACAGAGACACAGGGAAGAAGG + Intergenic
962478385 3:135777890-135777912 TCACAGCTGAAGTGGGAAGGAGG - Intergenic
962616664 3:137133551-137133573 TAACAGATCCAGAGGGCAGGAGG + Intergenic
962973953 3:140429921-140429943 TGACAGCTGCAGAGGGAACTGGG - Intronic
963616916 3:147551751-147551773 TCACATATGCGGAGAGAAGAGGG + Intergenic
963842235 3:150119609-150119631 TCAAAGGTGGAGAGGGAAGGTGG - Intergenic
964427639 3:156569871-156569893 TAACTGATGTAGAAGGAAGCTGG - Intergenic
968524599 4:1049574-1049596 ACACAGGTGCAGGGGGAGGCAGG - Intergenic
969004862 4:4011022-4011044 TCACAGAGACACAGGGAAGAAGG + Intergenic
969033525 4:4231935-4231957 GCACAGATGCAGAGGAAAGATGG - Intergenic
969319760 4:6404632-6404654 TCTGAGTTGCAGAGGGATGCTGG + Intronic
969748014 4:9089126-9089148 TCACAGAGACACAGGGAAGAAGG - Intergenic
969809041 4:9633664-9633686 TCACAGAGACACAGGGAAGAAGG - Intergenic
970255330 4:14162976-14162998 ACACAGCTACAAAGGGAAGCTGG + Intergenic
970953921 4:21788565-21788587 TCTCAGATCCAAAGGGTAGCGGG + Intronic
971709657 4:30094284-30094306 GCCCAGATGAAGAAGGAAGCGGG + Intergenic
972305549 4:37826697-37826719 CTACCGCTGCAGAGGGAAGCAGG - Exonic
972734329 4:41826112-41826134 TCACACAGGCAGAGGGCAGTGGG - Intergenic
972885549 4:43481667-43481689 TCACAGATAAAAAGGGAAGCAGG + Intergenic
973998902 4:56490162-56490184 CCACACATGTAGAGGAAAGCAGG - Intronic
975716360 4:77209177-77209199 TGACAGTTGAAGAGGGTAGCTGG - Intronic
979730663 4:124018913-124018935 TCACAGTTTCAGAGAGAAACTGG + Intergenic
981933735 4:150217012-150217034 TCATAGTTGCTGATGGAAGCAGG + Intronic
982243425 4:153323739-153323761 TAACAGATACTCAGGGAAGCTGG + Intronic
983768156 4:171512725-171512747 ATACAGAGGCAGAGGGAAGAGGG - Intergenic
983801264 4:171932436-171932458 GAACAGCTGCACAGGGAAGCTGG + Intronic
984966264 4:185143129-185143151 TCCCAGCTGCAGAGGGCATCGGG - Intergenic
985151789 4:186954751-186954773 CCACAGATGGAGAGGGAAGTGGG + Intergenic
985578741 5:685669-685691 TCCCAGAGGCAGAGGGCACCAGG - Intronic
987926917 5:24353410-24353432 TCAGAGATTCAGAGGCAGGCAGG - Intergenic
988250347 5:28749188-28749210 TCACTGAGGCAGTGGGAAGAGGG - Intergenic
989113537 5:37929940-37929962 TCACAGTGGCAGAGGGAACATGG - Intergenic
989529427 5:42490399-42490421 TCACAAATGCAGAGATAATCAGG - Intronic
991481794 5:67089247-67089269 TTAAACATGCAGAGGGAAGCAGG + Intronic
992725667 5:79604765-79604787 TCACAGATGCACATGGGTGCAGG + Intergenic
994593790 5:101806452-101806474 TCACAGAACCAGAGGGAGCCAGG + Intergenic
999212775 5:149904804-149904826 TCACAGATGGAGAGGAAAGAGGG - Intronic
1001371489 5:171208500-171208522 TCAAAAATCCAGAGGGAAGTTGG + Intronic
1001385900 5:171338459-171338481 TTCCAGATGCAGCGGGAAGGTGG - Intergenic
1001658298 5:173371091-173371113 TCACAAATGCAGAAGCAGGCTGG - Intergenic
1001796483 5:174506462-174506484 TCACACAGCAAGAGGGAAGCTGG + Intergenic
1002306530 5:178286912-178286934 TCACAGGTCCAGAGGGGAGAGGG - Intronic
1002376823 5:178794888-178794910 TCACAGAGGCAGAGGGCACAAGG + Intergenic
1002742679 5:181444954-181444976 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1002742689 5:181444993-181445015 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1003308851 6:4951361-4951383 TCACAGATGCCGAGATAAGGCGG - Intronic
1004702088 6:18088773-18088795 TCACTGATGCTGACAGAAGCAGG - Intergenic
1005462527 6:26082788-26082810 TCACAGACACAGAGGGATGATGG - Intergenic
1005955752 6:30662296-30662318 TCACATATTTAGAGGGAACCAGG + Intronic
1006347315 6:33493278-33493300 TCACTGATTCAGAGTGAAGTTGG + Intergenic
1006842066 6:37035196-37035218 TCCCAGATGCAGAGGCGATCAGG + Intergenic
1008565937 6:52768273-52768295 TCAGAGATTCAGAGGTAGGCAGG - Intergenic
1008570126 6:52808606-52808628 TCAGAGATTCAGAGGTAGGCAGG - Intergenic
1011638046 6:89392970-89392992 TCACTGATGAAGAAGAAAGCTGG - Intronic
1013460755 6:110372831-110372853 GCTCAGATGCTGAGGGAAACAGG - Intergenic
1013508865 6:110826639-110826661 ACACAAATACAGAGGGAAGACGG - Intronic
1015036303 6:128659223-128659245 TCACAGATTCAGAGATAAGGAGG - Intergenic
1015545091 6:134353879-134353901 GCACAAAGGAAGAGGGAAGCTGG - Intergenic
1015639408 6:135314843-135314865 TCACAGATGCAAAGATAAGCAGG - Intronic
1016708182 6:147138181-147138203 TCACAGTTCCAGAGGGTAGAAGG - Intergenic
1016995806 6:149961905-149961927 GCACAGGTTCAGAGGGGAGCTGG - Intergenic
1017002775 6:150007263-150007285 GCACAGGTGCAGAGGGGAGCTGG + Intergenic
1017012375 6:150071253-150071275 GCACAGGTTCAGAGGGGAGCTGG + Intergenic
1017429965 6:154361247-154361269 TCAGAGATGGAGAGGGGAGCCGG + Intronic
1017558278 6:155598004-155598026 ACACATATACAGAGGGCAGCTGG + Intergenic
1018090259 6:160340453-160340475 TGAACGATGCAGAGGGAACCGGG + Intergenic
1018211353 6:161484941-161484963 TCAAAGAAGCAGGGGGAAGCCGG - Intronic
1018842255 6:167525795-167525817 ACACAGAAGCAGAGAGAAGGTGG + Intergenic
1019247814 6:170720693-170720715 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019247824 6:170720732-170720754 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1019266189 7:118702-118724 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1019781932 7:2945615-2945637 TAACAGGGGCAAAGGGAAGCAGG - Intronic
1019988865 7:4678670-4678692 GCAGAGAAGCAGAGGGATGCAGG - Intergenic
1020324994 7:6967507-6967529 TCACAGAGACACAGGGAAGAAGG + Intergenic
1021255264 7:18384648-18384670 TCACTGATGCAGAAAGCAGCAGG + Intronic
1021410615 7:20326483-20326505 TCACAGAATCAGCAGGAAGCTGG - Intergenic
1023049076 7:36235515-36235537 ACAGAGATGCAGAGGGGAGCCGG - Intronic
1024047540 7:45595417-45595439 TCACAGAGAGAGAGGGAGGCAGG - Intronic
1024288096 7:47777739-47777761 TCACATAAGCAGGGGGAAGTTGG + Intronic
1024622203 7:51170735-51170757 TCACAGAAGTAGAGAGAAGCTGG + Intronic
1024805635 7:53136017-53136039 TCACAGATCCAGGGAGAAGAGGG + Intergenic
1025009334 7:55383263-55383285 TTACAGAGGCAGAGGGAGGGAGG + Intronic
1025321269 7:58096413-58096435 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1025474284 7:60900392-60900414 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1025480441 7:60976462-60976484 TCACAGATCCAGAGAGAAGATGG - Intergenic
1025512719 7:61589482-61589504 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1025551525 7:62255801-62255823 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1025565371 7:62427870-62427892 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1025837555 7:65109077-65109099 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1025885516 7:65586921-65586943 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1025988486 7:66476182-66476204 ACAGAGATGCAGAGGGAGCCTGG + Intergenic
1026004245 7:66588435-66588457 ACAGAGATGCAGAGGGAGTCTGG + Intergenic
1026740387 7:72975409-72975431 CCACAGATGGAGAGGGATGATGG + Intergenic
1026797689 7:73376895-73376917 CCACAGATGGAGAGGGATGATGG + Intergenic
1027051677 7:75025026-75025048 GGGCAGATGCCGAGGGAAGCCGG + Intergenic
1027103344 7:75389661-75389683 CCACAGATGGAGAGGGATGATGG - Intergenic
1027211464 7:76152031-76152053 ACAGAGATGCAGAGGGAGCCTGG + Intergenic
1028048120 7:86149485-86149507 TTACAGATCCAGAGGGAAGAGGG - Intergenic
1028691749 7:93660617-93660639 TAACAGATACAAAGAGAAGCTGG - Intronic
1029054868 7:97731823-97731845 TCAGATCTGCAGACGGAAGCAGG + Intergenic
1029063506 7:97824330-97824352 TTAAAGAAGCAGAGGGGAGCAGG + Intergenic
1031460964 7:122047984-122048006 TAATAGATGCAGAGGGAAAAGGG + Intronic
1032254858 7:130289042-130289064 TGACAGATGAAGAAGGAAGATGG - Intronic
1032470163 7:132172450-132172472 TCACACTTCCAGAGGTAAGCAGG + Intronic
1032486428 7:132291038-132291060 TCACAGGTGCACACGGAGGCTGG + Intronic
1032525547 7:132576571-132576593 CCACCGAGGCACAGGGAAGCCGG + Exonic
1032890172 7:136185935-136185957 TGCCAGATGCTGAGGGAAGAGGG - Intergenic
1033331080 7:140417426-140417448 CCACAGATGGAGTGGGATGCAGG + Intronic
1034120028 7:148618769-148618791 TGAAAGATACAGAAGGAAGCAGG + Intergenic
1034319889 7:150170246-150170268 TCACTCATTCTGAGGGAAGCCGG - Intergenic
1034929281 7:155148775-155148797 TCACAGTTGGGGAGGGAAGGAGG + Intergenic
1035026756 7:155831344-155831366 TCAGGGAGGGAGAGGGAAGCCGG + Intergenic
1035063126 7:156084123-156084145 TCACAGAAGCAGAGAGCAGAAGG - Intergenic
1035070359 7:156140163-156140185 TGACACAGGCAGAGGGAAGATGG + Intergenic
1035132437 7:156668520-156668542 ACACAGAGGCAGAGGGAAGCAGG - Intronic
1035500293 8:87132-87154 GGACAGCTGCAGAGGGAGGCAGG - Intergenic
1035500303 8:87171-87193 CGACAGCTGCAGAGGGAGGCAGG - Intergenic
1037493755 8:19419720-19419742 TCCCAGTTGCAGACGGAAGAGGG + Intronic
1038059039 8:23892032-23892054 TAACTCATGCATAGGGAAGCAGG - Intergenic
1038283322 8:26184908-26184930 TCACAGAAGCAGAGAGTAGAGGG + Intergenic
1038351695 8:26781937-26781959 TCACAGGTGAACAGGGGAGCAGG + Intronic
1038716659 8:29997350-29997372 TCACAGATTCAGAGGGGACCAGG - Intergenic
1041013715 8:53570251-53570273 TCTCAGATGGAGATGGGAGCTGG + Intergenic
1041143132 8:54843798-54843820 GCTCAGGTGCAGAGGGAAGCAGG + Intergenic
1041653776 8:60328124-60328146 TCACAGAAGCAGAGAGTAGAAGG + Intergenic
1041785195 8:61623978-61624000 TCACAGAGGTAGAGGGTAGAAGG + Intronic
1042031231 8:64478209-64478231 TCACAGCTGCAGGGCTAAGCTGG - Intergenic
1043010840 8:74879877-74879899 TAACAGATCCAGAGAGAAGATGG + Intergenic
1043021073 8:75000515-75000537 TCACATCTGCAAAGGGCAGCAGG - Intronic
1043029139 8:75109462-75109484 TCACAGAAGCAGAGAGTAGAAGG - Intergenic
1045055432 8:98364275-98364297 GCACAGATGTGGAAGGAAGCGGG - Intergenic
1045308071 8:100976022-100976044 ACAGAGGTGCAGAGGCAAGCTGG - Intergenic
1046010413 8:108539591-108539613 ACACAGACACAGAGGGAAGATGG + Intergenic
1046046684 8:108973087-108973109 TCACAGAAGGAGTGAGAAGCAGG - Intergenic
1046760553 8:118015888-118015910 GCACAGACACAGAGGGAAGATGG + Intronic
1048723483 8:137355817-137355839 GCACAGATGCACAGGTAAGATGG + Intergenic
1049327433 8:142030254-142030276 TCACACCTGCAGACAGAAGCAGG - Intergenic
1049592604 8:143469399-143469421 CCACAGCTGCAGTGGGCAGCTGG - Intronic
1049596205 8:143484665-143484687 GCACAGGTGCAGAGGGTCGCGGG - Intronic
1049624231 8:143612960-143612982 TCACCGCTGCAGAGGCAGGCAGG + Exonic
1052103684 9:24483834-24483856 TCACAGAGGCAGAAAGAAGGGGG - Intergenic
1052238653 9:26245718-26245740 CCACATATTCAGAGGGAGGCTGG - Intergenic
1052963518 9:34320238-34320260 TCAAAGATGGGGAGGGAAGGGGG + Intronic
1053698791 9:40665761-40665783 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1053944795 9:43295993-43296015 TCACAGATCCAGAGAGAGGAGGG + Intergenic
1054310080 9:63465162-63465184 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1054408868 9:64789314-64789336 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1054442027 9:65273128-65273150 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1054488256 9:65748369-65748391 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1054814724 9:69464128-69464150 TCATCAATGCAAAGGGAAGCTGG - Intronic
1054953821 9:70885140-70885162 TCAAGGATGGAGAGGGGAGCAGG - Intronic
1055179670 9:73369373-73369395 TCACAGATGCAAAAGTAAGATGG - Intergenic
1055554996 9:77464925-77464947 ACACAGACACAGAGGGAAGATGG + Intronic
1056628860 9:88276153-88276175 CAACAGATGCAGAAAGAAGCTGG + Intergenic
1056825537 9:89874056-89874078 TCACAGATGGAAACGGAGGCTGG - Intergenic
1057176597 9:93004748-93004770 CTCCTGATGCAGAGGGAAGCCGG - Intronic
1057408207 9:94792816-94792838 TCACAATTGCAGTGGGATGCTGG + Exonic
1057478126 9:95422009-95422031 TGACAGATGCAGTGGTCAGCTGG - Intergenic
1059687011 9:116647501-116647523 TCAATGATGCTGAGGGAACCTGG + Intronic
1060343974 9:122800803-122800825 TCCCAGAGGCTGAGGGCAGCTGG - Exonic
1061247591 9:129408849-129408871 GCACAAATGCAGAGTGAACCTGG - Intergenic
1062121841 9:134838110-134838132 TCAGCCATGCAGAGGGAACCGGG + Intronic
1202781158 9_KI270717v1_random:38968-38990 TCACAGATCCAGAGAGAAGAGGG + Intergenic
1203581383 Un_KI270746v1:9119-9141 TCACAGATCCAGAGAGAAGAGGG - Intergenic
1203587930 Un_KI270747v1:24571-24593 TCACAGATCCAGAGAGAGGAGGG + Intergenic
1203608586 Un_KI270748v1:76173-76195 CGACAGCTGCAGAGGGAGGCAGG + Intergenic
1203608596 Un_KI270748v1:76212-76234 GGACAGCTGCAGAGGGAGGCAGG + Intergenic
1185445163 X:254025-254047 GCACACCTGCAGAGGGAACCTGG - Intergenic
1186452106 X:9682675-9682697 ATACGGAAGCAGAGGGAAGCCGG + Intronic
1186992159 X:15082025-15082047 TCAAAGATGCTGAGGCAGGCTGG - Intergenic
1187480293 X:19648880-19648902 TTTCAGAGGTAGAGGGAAGCTGG - Intronic
1188429734 X:30092817-30092839 TTACAGAGGCTGAGGGAAGGGGG - Intergenic
1188547480 X:31325180-31325202 GCAAAGATGGAAAGGGAAGCAGG - Intronic
1189701374 X:43718217-43718239 TCACAGAGGCAGGGGGAGACAGG + Intronic
1190155965 X:47992682-47992704 TCACAGGTCCAGACGGAAGAGGG - Intronic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1192806085 X:74510670-74510692 CAATAGCTGCAGAGGGAAGCAGG + Intronic
1193696787 X:84717668-84717690 TCACAGATGCAGAGGCCATGGGG - Intergenic
1195124513 X:101793251-101793273 TTACAAATGCAGAAGGCAGCAGG + Intergenic
1195920095 X:109975050-109975072 TCTGAGATCCAGAGAGAAGCTGG - Intergenic
1196124282 X:112082691-112082713 GAACAGGAGCAGAGGGAAGCCGG - Exonic
1196824723 X:119732099-119732121 TCCCAGAAGCCAAGGGAAGCAGG + Intergenic
1197333436 X:125181700-125181722 CCACAGAAGGAGAGGGAAGGAGG + Intergenic
1197894084 X:131292286-131292308 TCAAAGCTGCAAAGGAAAGCTGG + Intronic
1200069584 X:153521338-153521360 TCACTGGGGCAGAGGGAAGCAGG + Intronic
1200397588 X:156000351-156000373 TCACAGTGGCCCAGGGAAGCAGG + Intronic
1200796308 Y:7344212-7344234 TCACAGATGGATAGGTAAGTAGG - Intergenic