ID: 1097895844

View in Genome Browser
Species Human (GRCh38)
Location 12:64824507-64824529
Sequence TTCTGGGCACGGGGGAGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 338}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097895829_1097895844 19 Left 1097895829 12:64824465-64824487 CCGAACGCAGTTACGCGCCCACT 0: 1
1: 0
2: 0
3: 1
4: 6
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338
1097895828_1097895844 20 Left 1097895828 12:64824464-64824486 CCCGAACGCAGTTACGCGCCCAC 0: 1
1: 0
2: 0
3: 1
4: 20
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338
1097895832_1097895844 2 Left 1097895832 12:64824482-64824504 CCCACTGGCTCCCTGTCTCTGGC 0: 1
1: 0
2: 3
3: 55
4: 453
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338
1097895833_1097895844 1 Left 1097895833 12:64824483-64824505 CCACTGGCTCCCTGTCTCTGGCG 0: 1
1: 0
2: 6
3: 38
4: 538
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338
1097895827_1097895844 21 Left 1097895827 12:64824463-64824485 CCCCGAACGCAGTTACGCGCCCA 0: 1
1: 0
2: 0
3: 1
4: 7
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338
1097895836_1097895844 -8 Left 1097895836 12:64824492-64824514 CCCTGTCTCTGGCGCTTCTGGGC 0: 1
1: 0
2: 0
3: 12
4: 227
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338
1097895837_1097895844 -9 Left 1097895837 12:64824493-64824515 CCTGTCTCTGGCGCTTCTGGGCA 0: 1
1: 0
2: 0
3: 14
4: 201
Right 1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG 0: 1
1: 0
2: 1
3: 28
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097895844 Original CRISPR TTCTGGGCACGGGGGAGCTG GGG Intronic
900161373 1:1225559-1225581 TTTTGGGGACTGTGGAGCTGAGG - Intronic
900290001 1:1919761-1919783 GTCTGGGCCAGGTGGAGCTGCGG - Intergenic
900430948 1:2603022-2603044 TTCTGGGCAGCGGGGTGTTGGGG + Intronic
900462420 1:2808051-2808073 ATCTAGGCACTGGGGAGCGGGGG - Intergenic
900868604 1:5286114-5286136 TCCTGGGCACTGGGGAGGGGTGG + Intergenic
901630008 1:10643387-10643409 TTCTGGGCATGGGGGCAGTGTGG + Intronic
902219716 1:14957320-14957342 CTCTAGGCACGGGGGCACTGGGG - Intronic
902747605 1:18483769-18483791 TTCTGGGAACTGTGGAGGTGGGG - Exonic
902958224 1:19941599-19941621 TTCTAGGCACTGGCGGGCTGGGG - Intergenic
903264687 1:22150794-22150816 TGCTGGGCAGGGAGGGGCTGGGG - Intergenic
903542287 1:24103300-24103322 TGCTGGGCACTGGGATGCTGTGG - Intronic
903544858 1:24117720-24117742 TGCTGGGCAGGGTGGGGCTGTGG + Intergenic
904494582 1:30879478-30879500 TTCTGGGCAGAGGGGAGCTGGGG - Intronic
905028451 1:34866363-34866385 CTCTGGGCGCGGGGGTGCGGGGG - Intronic
905146821 1:35893593-35893615 TCCTGGGCACGGAGGAGCCCTGG - Intronic
905166150 1:36084391-36084413 CTGTTGGCACTGGGGAGCTGGGG - Intronic
905637123 1:39561832-39561854 GTCTGGGCACTGGGGAGGGGTGG - Intronic
905655178 1:39682298-39682320 TTCTGGCCAAGTGGGAGGTGGGG + Exonic
905883677 1:41480372-41480394 GTCTGTGCCCGTGGGAGCTGTGG - Intronic
906313023 1:44767314-44767336 ATCTGGGCCCAGGGCAGCTGGGG + Exonic
906362618 1:45176675-45176697 TTATTGGCAGGGAGGAGCTGTGG - Intronic
906460879 1:46034566-46034588 AACTGGGCACGCTGGAGCTGGGG - Exonic
907256939 1:53186485-53186507 TTCTGGGCATGGAGGATCAGTGG - Intergenic
910192231 1:84605960-84605982 GTCTGGGCAGTGGGGAGCTTTGG - Intergenic
911525005 1:98973888-98973910 TTCTGGGCAGGGGAGGGGTGGGG + Intronic
912431736 1:109631597-109631619 CTGTGGGCACGGGGCTGCTGAGG + Exonic
912800861 1:112719064-112719086 CTCTGGGCACAGGGGAGCTCTGG - Intergenic
913210351 1:116577269-116577291 TGTTGGCCACGGAGGAGCTGAGG - Exonic
915473184 1:156137813-156137835 TTTTTGGCACGGGGAGGCTGGGG - Intronic
915976909 1:160397419-160397441 TTCTGGGAAGGTGGGTGCTGGGG + Intergenic
916055988 1:161069302-161069324 TTCTGGGGATGGGGTGGCTGAGG - Intronic
916415926 1:164591911-164591933 TTCTGTGAACAGGGGTGCTGTGG + Intronic
918983801 1:191596722-191596744 TTCTGAGCCTGAGGGAGCTGGGG + Intergenic
919820580 1:201469402-201469424 TTCAAGGCCTGGGGGAGCTGCGG - Intergenic
920654613 1:207866538-207866560 TTCTGGGCTGGTAGGAGCTGAGG - Intergenic
920677524 1:208048506-208048528 TTCTGCCCTCTGGGGAGCTGGGG - Intronic
922473040 1:225888308-225888330 CTCTGGGCACTGAGGAGCTAGGG + Intronic
922481043 1:225940278-225940300 CTCTGGGCACTGAGGAGCTAGGG + Intronic
922724157 1:227914792-227914814 TTCTGGGCAGGGGTCTGCTGTGG - Intergenic
923224959 1:231930675-231930697 TCCTGAGCAGGGGGCAGCTGGGG + Intronic
924797383 1:247301925-247301947 TACTGGGAGCCGGGGAGCTGTGG - Intronic
1067945657 10:50686644-50686666 TCCAGGGCCCGGAGGAGCTGGGG + Intergenic
1069774714 10:70919622-70919644 CTCTGGGCCTGGGGGAGGTGTGG + Intergenic
1070867170 10:79713517-79713539 TCCAGGGCCCGGAGGAGCTGGGG + Intronic
1070880962 10:79851641-79851663 TCCAGGGCCCGGAGGAGCTGGGG + Intergenic
1070923886 10:80205481-80205503 CTCGGGGCACTGGGGAGCCGCGG + Exonic
1071518257 10:86313501-86313523 TTCTGGGGAGTGGGGATCTGAGG - Intronic
1071634085 10:87235741-87235763 TCCAGGGCCCGGAGGAGCTGGGG + Intronic
1071647533 10:87367958-87367980 TCCAGGGCCCGGAGGAGCTGGGG + Intronic
1072223797 10:93349397-93349419 GTCTGGGGAAGGGGCAGCTGTGG - Intronic
1073782721 10:106857125-106857147 TCCTGGGGACTGGGGATCTGGGG - Intronic
1074110787 10:110421424-110421446 TGCTGGGCATGGGGGAACTCAGG - Intergenic
1074121327 10:110496344-110496366 CTCTGGGCTGGGGGCAGCTGGGG + Intergenic
1074380920 10:112979639-112979661 TTCCGGCTACTGGGGAGCTGAGG + Intronic
1075307670 10:121382450-121382472 GACTGGGCACGGTGGAGCAGGGG - Intergenic
1075838801 10:125479514-125479536 TTCTGGGCAAGTGGGAGCCTGGG + Intergenic
1076534880 10:131170518-131170540 TGAAGGGCACTGGGGAGCTGGGG - Intronic
1076545786 10:131245004-131245026 TGCTGGGCACAGGGGAGTGGGGG + Intronic
1076713762 10:132353102-132353124 TGAGGGGCACGGGGGTGCTGTGG - Intronic
1076821307 10:132941313-132941335 GAGTGGGCACAGGGGAGCTGGGG - Intronic
1076859303 10:133133076-133133098 ATCTGGGCACTGGGTAGGTGTGG - Intergenic
1077209265 11:1360934-1360956 TGCTGTGCACGTGGGTGCTGTGG + Intergenic
1077215165 11:1392354-1392376 ACCTGGCCACAGGGGAGCTGTGG + Intronic
1077311119 11:1889508-1889530 CTCTGGGCACGGAGGCTCTGGGG + Exonic
1077490868 11:2860370-2860392 TTCTGGGGATGGGTGGGCTGTGG - Intergenic
1078144435 11:8713258-8713280 CTCTGGGGACAGGGGAGATGGGG + Intronic
1078360422 11:10663515-10663537 TGCTGGGCACTGGGGCTCTGGGG + Intronic
1080906405 11:36550109-36550131 TGCTGGGGACTGGGGAGCTGGGG + Intronic
1083622271 11:64055147-64055169 TGCTGGGCATGGTGGATCTGGGG - Intronic
1083738739 11:64696570-64696592 TGCTGGGCCCTGGGGACCTGAGG + Intronic
1083903252 11:65654148-65654170 CTCTGGAAAGGGGGGAGCTGGGG - Exonic
1083994783 11:66266507-66266529 GTCTGGGCACTGGGCAGCTGCGG + Intronic
1084246023 11:67857646-67857668 TTCAGTGAACGGGGAAGCTGGGG - Intergenic
1084468809 11:69343168-69343190 TTCTGGTCCCCAGGGAGCTGAGG - Intronic
1084482483 11:69429993-69430015 TGCTGGGCACGGGATAGCTGTGG + Intergenic
1084826652 11:71736854-71736876 TTCAGTGAACGGGGAAGCTGGGG + Intergenic
1086458533 11:86983074-86983096 TTCTGGGCAGTGGGGAGTGGCGG + Intergenic
1086947674 11:92859440-92859462 TTCTGGGCAAAGGGGAGCAGCGG + Intronic
1087644305 11:100789476-100789498 CTCTGGGCATGAGTGAGCTGTGG + Intronic
1089096263 11:115922558-115922580 TACTGGGCACTGGGGACATGGGG - Intergenic
1090583981 11:128190410-128190432 TTCTGAGAACAGGCGAGCTGTGG + Intergenic
1090599096 11:128351294-128351316 TACCTGGCACAGGGGAGCTGCGG - Intergenic
1090775781 11:129964186-129964208 TGCTAGGCACTGGGGTGCTGCGG + Intronic
1091407820 12:220191-220213 GGCTGGGCACGGGGGACGTGGGG - Intergenic
1092416603 12:8294771-8294793 TTCAGTGAACGGGGAAGCTGGGG - Intergenic
1094574399 12:31670786-31670808 TTCTAGGCACTGGGGATATGGGG + Exonic
1095942069 12:47733826-47733848 TGCAGGGCTCAGGGGAGCTGGGG + Intergenic
1096804136 12:54129921-54129943 TTCCGGGCTCGGGGGTGCTCTGG + Intergenic
1097895844 12:64824507-64824529 TTCTGGGCACGGGGGAGCTGGGG + Intronic
1101507474 12:105360578-105360600 TGATGGGCATGGGGGAACTGAGG - Intronic
1101990294 12:109478307-109478329 TTCTGTGAACGGGGGAGCCCTGG + Intronic
1102436079 12:112925029-112925051 TTCTCGGCAGGGAGGAGCTGAGG - Intronic
1102564562 12:113787100-113787122 TTTTGGGATTGGGGGAGCTGTGG + Intergenic
1102573613 12:113842554-113842576 TGCTGGGCACGGGGGACCCAGGG + Intronic
1102657026 12:114490664-114490686 TTCTAGGGACTGGGGAGCGGGGG + Intergenic
1102983758 12:117262670-117262692 TTCTGGACCTGAGGGAGCTGAGG + Intronic
1104439701 12:128784840-128784862 TGCTGCCTACGGGGGAGCTGGGG + Intergenic
1106435477 13:29720001-29720023 TCCTGGGCATTGGGGAGCTGGGG + Intergenic
1107996417 13:45865439-45865461 TTCTATACACAGGGGAGCTGAGG + Intergenic
1108355514 13:49625754-49625776 TCCTGGGGGTGGGGGAGCTGGGG - Intergenic
1113663117 13:112120442-112120464 GTCTGAGCAGGGGTGAGCTGAGG + Intergenic
1113869059 13:113546932-113546954 TCCTGGGCACTGTGGGGCTGTGG + Intronic
1114399555 14:22396772-22396794 TTCTGGGCAAGGGTAAGGTGAGG - Intergenic
1116653817 14:47626844-47626866 TTCTGGGCGCTGTGGAGCAGGGG - Intronic
1117197678 14:53356575-53356597 TGCTGGGCACGGGGCAGTTGTGG - Intergenic
1119659477 14:76439966-76439988 GGCTGTGCATGGGGGAGCTGAGG - Intronic
1119700628 14:76752112-76752134 TTGTGGGGTCGGGGGAGCGGGGG + Intergenic
1119824026 14:77642132-77642154 TTCTGGGAACCCAGGAGCTGGGG + Intergenic
1119858725 14:77921544-77921566 CTCTGGGCATGGGAGATCTGGGG - Intronic
1122812326 14:104295221-104295243 TCCTGGGCACGGTGCAGGTGTGG + Intergenic
1123037941 14:105478901-105478923 TTGTGGGCACGCGCGGGCTGGGG + Intronic
1202904463 14_GL000194v1_random:60237-60259 TTCTGGCCACGGGAGAGGTCAGG - Intergenic
1124991159 15:34675012-34675034 TTCTAGGCACGGGGGATATACGG + Intergenic
1125594187 15:40873866-40873888 GGCTGTGCACCGGGGAGCTGGGG - Intronic
1125926706 15:43568946-43568968 TTCTTTGCATGGGAGAGCTGTGG + Intronic
1125939850 15:43668511-43668533 TTCTTTGCATGGGAGAGCTGTGG + Intergenic
1126141833 15:45445445-45445467 TTCTGGGCCGGAGGGCGCTGTGG - Intronic
1126515042 15:49524599-49524621 TTCTGGGGACTGGAGAGCAGTGG - Intronic
1127397701 15:58555849-58555871 TCCAGAGCACGGGGGAGCAGAGG + Intronic
1128342860 15:66834907-66834929 TTGTGGGCAGGGGGCAGCTGTGG - Intergenic
1128343562 15:66839723-66839745 CTATGGGCACTGGGGAGGTGGGG - Intergenic
1129450890 15:75650619-75650641 TGCTGGGCCCTGGGGAGATGGGG + Intronic
1129459054 15:75690780-75690802 TTCTGGGCCAGGAGGAGCTGAGG - Exonic
1130272845 15:82461314-82461336 TCCTGGGCCAGGAGGAGCTGAGG + Intergenic
1130465195 15:84188667-84188689 TCCTGGGCCAGGAGGAGCTGAGG + Intergenic
1130487493 15:84406135-84406157 TCCTGGGCCAGGAGGAGCTGAGG - Intergenic
1130499070 15:84484869-84484891 TCCTGGGCCAGGAGGAGCTGAGG - Intergenic
1130587486 15:85193280-85193302 TCCTGGGCCAGGAGGAGCTGAGG + Intergenic
1131456445 15:92585940-92585962 TTGTGGGCAACGGGAAGCTGTGG + Intergenic
1132758455 16:1497227-1497249 TCCTGGGCCCGTGGGATCTGGGG + Intronic
1132801903 16:1758679-1758701 TTCTGGGCTGGGTGGGGCTGAGG - Intronic
1134041655 16:11073417-11073439 TACTGGGCAGGGGAGAGGTGTGG - Intronic
1134066914 16:11234182-11234204 TTCTGTGAACTGGGGAACTGAGG - Intergenic
1134271204 16:12734923-12734945 TGATGGGCATGGGAGAGCTGGGG - Intronic
1135196769 16:20401525-20401547 TTCTGGGCACCGAGGAGGTTTGG - Intronic
1135639262 16:24106402-24106424 TTATGGGCACTGGGAATCTGGGG - Intronic
1136073843 16:27804943-27804965 TTGGGGGCACGGGAGCGCTGTGG + Intronic
1137009372 16:35308332-35308354 TTCTGAGGACAGAGGAGCTGGGG - Intergenic
1137023253 16:35451090-35451112 TTCTGAGCACGGATGAGTTGGGG - Intergenic
1137402549 16:48165156-48165178 TTCTGGGAATGGGGAAGCAGAGG + Intergenic
1137446826 16:48537017-48537039 TTCAGGGCACAGGGAGGCTGCGG - Intergenic
1137499724 16:49001206-49001228 TTGTGGGCAGGGTGGGGCTGCGG - Intergenic
1138223413 16:55272309-55272331 TTCTGGGCACAGGGGTGAGGGGG - Intergenic
1140045670 16:71439066-71439088 TGCTGGGCACTGAGGAGATGAGG + Intergenic
1140194953 16:72848136-72848158 TCCTGGGGATGGGGGTGCTGAGG + Intronic
1141151471 16:81567402-81567424 TCCTGGGCCCGGGGAAGGTGAGG - Intronic
1141252655 16:82372399-82372421 TTCTGAGCACCCTGGAGCTGGGG + Intergenic
1142089073 16:88200431-88200453 TGCTGGCCACGGGGCAGGTGCGG - Intergenic
1142128114 16:88420154-88420176 TTCCAGGCGAGGGGGAGCTGCGG - Intergenic
1142160040 16:88552584-88552606 TTCTCGGCACGGAGGGGCTGGGG + Intergenic
1143253054 17:5536988-5537010 TTCTGGGCCCTGGGGACCTGGGG - Intronic
1145993223 17:29091511-29091533 TACTGGGCTGTGGGGAGCTGGGG + Intronic
1146161351 17:30560812-30560834 TTCTGGCCAAGGGGGAGGTCTGG + Intronic
1146184530 17:30716471-30716493 GTCTCTCCACGGGGGAGCTGGGG - Intergenic
1146507863 17:33421159-33421181 TTCTGTGAGCTGGGGAGCTGGGG + Intronic
1146969467 17:37061156-37061178 ACCTGGGCAGGGTGGAGCTGTGG - Intergenic
1147638384 17:41978266-41978288 CTCTGGGCACGAGGTGGCTGTGG - Intronic
1147746860 17:42700142-42700164 ATCTGGGAAAGGGGGAGATGGGG - Intergenic
1147896267 17:43753411-43753433 TCCTGGGCAAGGGGGAGCTATGG + Intergenic
1147951019 17:44108086-44108108 CACTGTGCACTGGGGAGCTGTGG + Intronic
1149557673 17:57585741-57585763 TTCTGAGCTCAGGGGAGATGGGG - Intronic
1150220723 17:63494387-63494409 TCCTGGGCACTGGGGGGCAGAGG - Exonic
1151501458 17:74492399-74492421 TTCAGGGAATGGGTGAGCTGAGG + Intergenic
1151693869 17:75704106-75704128 TGCTGGGTACAGGGGAGCTTTGG + Intronic
1152192379 17:78896684-78896706 TTCTGCGGAGGGGGGAGCTGTGG - Intronic
1152215025 17:79027074-79027096 TCCTGGGCGGGGGGGGGCTGTGG + Intronic
1152364007 17:79844825-79844847 TTGGGGGCTCGGGGGGGCTGGGG - Intergenic
1152702128 17:81824389-81824411 CTCTGGAGACGGGGGAGCTGGGG + Exonic
1152796532 17:82310371-82310393 TTCTGAGCATGGAGGAGATGAGG + Intergenic
1153964641 18:10168367-10168389 TTCTGGGCCTGGAGGAGCAGAGG + Intergenic
1157815209 18:50725132-50725154 TTCTGGGCAGTGGGAACCTGGGG - Intronic
1158458057 18:57624633-57624655 ATCTGGGCACGGTTTAGCTGAGG + Intergenic
1158592580 18:58790109-58790131 TTCTTGGGAGGGGAGAGCTGGGG + Intergenic
1160512060 18:79458261-79458283 TTCTGGGCATGAGGATGCTGTGG + Intronic
1160922823 19:1528759-1528781 TTGTGGGCAGGTGGGAGGTGTGG - Intronic
1162001364 19:7746821-7746843 TCCTGGGGAGGTGGGAGCTGGGG - Intronic
1162080813 19:8216645-8216667 TTCTGGACATGGTGGAGATGAGG - Intronic
1162412884 19:10517240-10517262 CTCTGGGGAGGGGGAAGCTGGGG - Intronic
1162534298 19:11253873-11253895 TTGGGGGAACTGGGGAGCTGTGG - Intronic
1162767488 19:12928714-12928736 GTCAGGGCAGGTGGGAGCTGGGG - Intronic
1162974247 19:14199203-14199225 GTCTCTCCACGGGGGAGCTGGGG + Intronic
1163029795 19:14536934-14536956 CTCTGGACACGGGGCAGATGTGG + Intronic
1163799199 19:19354833-19354855 ATCTGGAAATGGGGGAGCTGCGG - Intronic
1165683184 19:37795217-37795239 CTCTGGGCAGGGGGGATTTGGGG - Intronic
1165819408 19:38665157-38665179 TTCTGGGCAGTGGGGAGTGGGGG - Intronic
1166668872 19:44698067-44698089 TTCTGAGCACGGAGGGGCAGAGG + Intergenic
1166707542 19:44916338-44916360 CCCAGGGCACGGGAGAGCTGGGG + Intronic
1166990487 19:46689871-46689893 TTCTGGGCACCTGGCAGGTGGGG - Intronic
1167245539 19:48370983-48371005 TTCTGTGCAGGGGACAGCTGGGG - Intronic
1168675981 19:58278557-58278579 TTTTAGGCACCGGGGAGCAGAGG + Intronic
925088648 2:1134753-1134775 GACTGGGCACGGTGGAGCAGGGG + Intronic
925918556 2:8624197-8624219 CCCTGGGCACGGAGGAGCTGAGG + Intergenic
926008852 2:9393037-9393059 TGCTGGGCAGGGTGGATCTGAGG - Intronic
926808343 2:16733886-16733908 TTGTGGGCAAGAGGTAGCTGTGG - Intergenic
927211359 2:20640926-20640948 TTCTGGGCCGGGGAGACCTGAGG + Intronic
927712625 2:25335325-25335347 TTCTGCTCACTGGGGTGCTGGGG + Intronic
928021953 2:27712402-27712424 TACTGGGAACGTTGGAGCTGAGG + Intronic
930004121 2:46882485-46882507 TTCCCGGCAGGTGGGAGCTGAGG - Intergenic
930221985 2:48754965-48754987 ATCTGGGCACGGTGGAGCAGCGG + Intronic
931882067 2:66577986-66578008 TTCTGGGCATGGGTGGGGTGGGG + Intergenic
932068492 2:68591829-68591851 GTCTGGGCACTGGGAATCTGGGG - Intronic
932344087 2:70984538-70984560 TTCTGGGCAAGGAGGTCCTGTGG - Intronic
932380729 2:71279400-71279422 TTCTGGGCAGGTGGGATCTTTGG + Intronic
934988468 2:98903962-98903984 TTCTGGGCACCGAGCAGCTAGGG - Intronic
936982792 2:118279492-118279514 TTGAGGGCTCGGGGGAGCAGGGG + Intergenic
937245909 2:120492854-120492876 TTGTGGGGAGGGGGGAGGTGGGG + Intergenic
938244012 2:129763631-129763653 TGGTGGGCACGGAGGTGCTGAGG - Intergenic
938391831 2:130912674-130912696 CTCTGGGCCTGGGGGAGCTTTGG + Intronic
938524790 2:132119194-132119216 TTCTGACCACTGGTGAGCTGGGG + Intergenic
938594429 2:132772957-132772979 TACTGGACACTGGGGATCTGTGG + Intronic
941124424 2:161568737-161568759 TTCTGGGAACGGATAAGCTGTGG + Intronic
945163609 2:206919227-206919249 TTTTGGGGTGGGGGGAGCTGTGG - Intergenic
946427748 2:219608440-219608462 TTGTGGGCTGGGGCGAGCTGAGG + Intronic
947524888 2:230871846-230871868 GCCTGGGCCCTGGGGAGCTGAGG - Intronic
947791742 2:232872710-232872732 GTCTGGGGAGGGGGGAGATGGGG - Intronic
948251926 2:236536240-236536262 CACTGGGCACTGAGGAGCTGGGG + Intergenic
948266615 2:236639611-236639633 TTCGGGGGAGGGGGGCGCTGGGG + Intergenic
948588333 2:239035079-239035101 TTAGGGCCACGTGGGAGCTGCGG + Intergenic
1169387812 20:5166005-5166027 ATCTAGGTACTGGGGAGCTGTGG + Intronic
1171011191 20:21510341-21510363 TTCTGGGCTCGGGGGAGGGAGGG - Intergenic
1171451064 20:25236719-25236741 TGCTGGGCAGGGAGGAGCTGTGG - Intergenic
1171478566 20:25434276-25434298 TTCTGGGCAGCGGGGAGGTGTGG - Intronic
1171946448 20:31382620-31382642 TTCTGGGCTGGAGGGAGCAGAGG - Intronic
1172100768 20:32483215-32483237 TTCTGGGGAGGGGGGCGCAGGGG - Intronic
1172113799 20:32562370-32562392 ATCTGGGCACTGGGGAGCCCAGG - Intronic
1173744265 20:45424505-45424527 TGCTGGGCACAAGGGCGCTGAGG - Exonic
1174036969 20:47674418-47674440 TTCTGTACACGGGGAAACTGAGG - Intronic
1175869410 20:62201161-62201183 TTGTGGACACGGGGGAGTTGTGG + Exonic
1175883819 20:62276720-62276742 TTCTGGGAAAGGGGAGGCTGAGG + Intronic
1175975203 20:62707554-62707576 TTCTGGGGAGGAGGGAGCAGGGG + Intergenic
1176623833 21:9075004-9075026 TTCTGGCCACGGGAGAGGTCAGG - Intergenic
1178614955 21:34124571-34124593 TTCAGGGCAAGGGAGTGCTGAGG - Intronic
1178694966 21:34784992-34785014 TGATGGGCACTGGGGAACTGAGG - Intergenic
1178734377 21:35135681-35135703 TGGTGGGCCGGGGGGAGCTGTGG + Intronic
1179042700 21:37817989-37818011 TTCTGGGTACGAGGCAGATGGGG - Intronic
1180636932 22:17269131-17269153 TTCTGGGGAGGTGGGTGCTGGGG + Intergenic
1180964937 22:19783185-19783207 TTCTGGGCACGTGGGCTCCGTGG - Intronic
1181427943 22:22856177-22856199 TCCTGGGGAGGGGAGAGCTGGGG + Intronic
1182355988 22:29722420-29722442 TCCTGGGCCCTGGGGAGCTGAGG + Intronic
1182742161 22:32575751-32575773 CTCTGGGCACGGTAGAGATGGGG + Intronic
1183466190 22:37981512-37981534 TTCTGGGCTGGGGGAACCTGGGG + Intronic
1183960678 22:41410213-41410235 TTGGGGGCACAGGGAAGCTGGGG + Intergenic
1184321695 22:43746855-43746877 TTCTTGGCCCGTGGCAGCTGAGG - Intronic
1185066428 22:48634033-48634055 GTCTGTGCACCGGGCAGCTGAGG - Intronic
1185219131 22:49620402-49620424 GGCTGGGCAGGGGGGAACTGGGG - Intronic
950024292 3:9810032-9810054 TCCTGAGCGCGAGGGAGCTGGGG + Exonic
950551327 3:13667911-13667933 GTCTGGGCTCTGAGGAGCTGCGG - Intergenic
953576539 3:44117297-44117319 TTCTGGGCAGGGGTGGGGTGAGG - Intergenic
954867869 3:53744891-53744913 TTCTGGGCAGAGCTGAGCTGAGG + Intronic
954929897 3:54272363-54272385 TTCTGGGCTTGGGGAAGCTGTGG + Intronic
955356940 3:58238837-58238859 TTCTGAGCAGGCGGGAGCAGCGG - Intronic
955403902 3:58613385-58613407 ATCTTGGCACGGGAGGGCTGAGG - Intronic
956181837 3:66524597-66524619 TTGTAGGCAAGGGGCAGCTGGGG + Intergenic
960991481 3:123314405-123314427 GGATGGGCACGGGGGACCTGTGG - Intronic
961056626 3:123794136-123794158 TTCTAGGAAAGGGGAAGCTGGGG + Intronic
961293039 3:125863039-125863061 TTCAGTGAACGGGGAAGCTGGGG + Intergenic
967299601 3:188000070-188000092 TCCTGGGCTTGGGCGAGCTGCGG + Intergenic
968235222 3:197027378-197027400 TTCTGGGGAAGGAGGAGCAGGGG - Intronic
968471498 4:784647-784669 CCCTGGGCCCGGTGGAGCTGAGG + Intergenic
969004240 4:4006447-4006469 TTCAGTGAACGGGGAAGCTGGGG - Intergenic
969059593 4:4424420-4424442 ATCTGGGCATGGGGGAGTAGCGG + Intronic
969459545 4:7321751-7321773 TTGTGGGCAGGGGACAGCTGGGG + Intronic
969498108 4:7537596-7537618 TGCTGGGCACTGGGGAGCAAAGG + Intronic
969748622 4:9093699-9093721 TTCAGTGAACGGGGAAGCTGGGG + Intergenic
969809664 4:9638267-9638289 TTCAGTGAACGGGGAAGCTGGGG + Intergenic
969818456 4:9703576-9703598 TTCTGTGACCGGGGAAGCTGTGG - Intergenic
970897272 4:21118437-21118459 TTGTTGGCACAGGGAAGCTGAGG - Intronic
975253364 4:72205887-72205909 TTCTGAGCACAGTGGAGCAGAGG - Intergenic
976759379 4:88531852-88531874 TTCTTAGCACAGGGCAGCTGTGG + Intronic
976865711 4:89723815-89723837 TTCTGGGGACGGGAGAGAAGAGG - Intergenic
978842363 4:113229664-113229686 TTCTGGTAATGGAGGAGCTGTGG + Intronic
978871948 4:113589316-113589338 TTTTGGCCAAGGGGGTGCTGTGG + Intronic
979765739 4:124462778-124462800 TTCTGGGTGCTGGAGAGCTGTGG + Intergenic
981010817 4:139922988-139923010 TTCTGAGCACTGGGGTGCAGGGG - Intronic
984734569 4:183098326-183098348 TCCTGGCCACGGCGGGGCTGCGG + Intergenic
985515830 5:344131-344153 CTCCGGGCACCGGGGCGCTGCGG - Intronic
987347393 5:16991009-16991031 GACTGGGCACGGTGGAGCAGGGG + Intergenic
989341346 5:40379102-40379124 ACCTGGGCTAGGGGGAGCTGAGG - Intergenic
992795677 5:80253488-80253510 TTCTGAGCAGGGGCGAGCTGTGG - Intronic
994573039 5:101537924-101537946 TTCTGGGCGCGGGGGTGCGGGGG - Intergenic
994824837 5:104699317-104699339 TTCTCTGCACGGGGGTGGTGAGG - Intergenic
996234271 5:121107509-121107531 GACTGGGCACGGTGGAGCAGGGG - Intergenic
996680307 5:126223406-126223428 TTCTGGGCAGGGGAGATTTGAGG - Intergenic
997206059 5:132050861-132050883 TGAAGGGCATGGGGGAGCTGCGG + Intergenic
999131197 5:149284703-149284725 TTCTGGGCCCTGGGGAGCAGTGG + Intronic
999378947 5:151106552-151106574 TTCTGGGAATGGGGGAGCAAGGG - Intronic
1000486341 5:161848785-161848807 TTATTTGCAAGGGGGAGCTGGGG + Intronic
1002533703 5:179864583-179864605 TCCTGGGGAGGGGGGTGCTGGGG + Intronic
1002642721 5:180638097-180638119 TGTTGGGCAGAGGGGAGCTGGGG - Intronic
1003924624 6:10865443-10865465 TTGTGGGCATGGGGGAGAAGAGG - Intronic
1004129202 6:12902878-12902900 TTCTGGGGACCGGGTTGCTGGGG - Intronic
1007360158 6:41349663-41349685 TTCTGGTCTCTGTGGAGCTGGGG - Intronic
1008842399 6:55919725-55919747 ATCTGGGCAGGGAGGGGCTGAGG - Intergenic
1011375124 6:86679279-86679301 TTCTGGGCACGGGAGATTAGAGG + Intergenic
1011724688 6:90198259-90198281 CTCTGGACACACGGGAGCTGTGG - Intronic
1013545401 6:111152018-111152040 TGCTGGGCACTGGGGATCTCAGG - Intronic
1016303194 6:142654768-142654790 TTCTGGGCTGAGGGGAGCAGAGG - Intergenic
1018580076 6:165301096-165301118 TTCTGGGAACTGGTCAGCTGGGG - Intronic
1018593562 6:165453997-165454019 TTCTGGGCACACTGGAGTTGGGG - Intronic
1018672347 6:166189959-166189981 TTCCAGGGACAGGGGAGCTGCGG + Intergenic
1018758142 6:166867206-166867228 TTCTGGTCACGACAGAGCTGTGG - Intronic
1018867347 6:167756524-167756546 TGCTGGTCCTGGGGGAGCTGTGG - Intergenic
1018932012 6:168246627-168246649 TTCTGGGCATCTGAGAGCTGAGG - Intergenic
1019144227 6:169966556-169966578 TTCCTGTCACAGGGGAGCTGAGG - Intergenic
1019328768 7:452594-452616 TACTGTGCACCGCGGAGCTGGGG - Intergenic
1019415881 7:926346-926368 TTCTGGGGCGGGGGGCGCTGGGG - Intronic
1019552220 7:1608680-1608702 TTGTGGGCACTGGGGAGCCTTGG + Intergenic
1019704052 7:2489014-2489036 TTCCGGGCAGGGGTGAGCTGGGG - Intergenic
1019994471 7:4715175-4715197 TACGGGGCACGGTGGAACTGTGG + Intronic
1020044438 7:5030681-5030703 TGCTGGGCCCAGGGGAGATGCGG - Intronic
1020324374 7:6962948-6962970 TTCAGTGAACGGGGAAGCTGGGG - Intergenic
1023177468 7:37448251-37448273 TACTGGGGACGGGGGATGTGGGG - Intronic
1023768846 7:43536515-43536537 TGCTGGGTACCTGGGAGCTGAGG + Intronic
1023844257 7:44112222-44112244 CTCTGTGCTCTGGGGAGCTGAGG + Exonic
1024428206 7:49254127-49254149 TTCTGGCAAAGGGGGAGATGAGG + Intergenic
1024942784 7:54779809-54779831 TGGTGGGGACGGAGGAGCTGTGG - Intergenic
1027362629 7:77425266-77425288 TTCAGGGAAAGTGGGAGCTGGGG - Intergenic
1028394217 7:90349410-90349432 TTCTGGGTAGCGGGGAGGTGGGG + Intronic
1029530702 7:101123386-101123408 CCTTGGGCACGGGAGAGCTGGGG - Intergenic
1032021521 7:128409524-128409546 TTCGTTGCACGGGGGAGCGGAGG - Intronic
1032076887 7:128840259-128840281 CTCTGGTCACTGTGGAGCTGTGG - Intronic
1032974786 7:137209969-137209991 TTGTGGGGTCGGGGGAGCGGGGG - Intergenic
1033659108 7:143391581-143391603 GTCTGGGCAGGGGAGGGCTGCGG - Intronic
1034687746 7:152988239-152988261 TCCTGGGGACGGGGGAGATGGGG + Intergenic
1034699855 7:153086453-153086475 CACTGGGCAGGGAGGAGCTGAGG + Intergenic
1035170413 7:157014315-157014337 CGCTGGGCAGGGAGGAGCTGTGG - Intergenic
1035222366 7:157413836-157413858 TTCCGGCCACTGGGGAGGTGAGG - Intronic
1035890434 8:3337033-3337055 TTCTGGGGAGGCTGGAGCTGGGG + Intronic
1036371692 8:8168009-8168031 TTCAGTGAACGGGGCAGCTGGGG + Intergenic
1036480260 8:9133125-9133147 TGTTGGGCACGGGGGAGAGGTGG + Intergenic
1036879211 8:12497635-12497657 TTCAGTGAACGGGGCAGCTGGGG - Intergenic
1038278701 8:26143289-26143311 TGCTGGGCAGGGGGTGGCTGTGG - Intergenic
1038425443 8:27461405-27461427 TTTTGGATACGGAGGAGCTGGGG - Exonic
1038642364 8:29338489-29338511 TTCTGTGCAGGGGGGTCCTGTGG - Exonic
1041029628 8:53723709-53723731 TTCTGGGCAGAGAGGAGATGGGG - Intronic
1041659460 8:60387194-60387216 CTCTGGGCAAAAGGGAGCTGAGG + Intergenic
1044088531 8:87971448-87971470 GACTGGGCACGGTGGAGCAGGGG - Intergenic
1047236048 8:123042633-123042655 TTCTAGACACTGGGCAGCTGCGG + Intronic
1047403495 8:124565678-124565700 TTCTGGACATGGTGGTGCTGGGG + Exonic
1048330350 8:133466692-133466714 TGCTGGGGCCGGGGGAACTGAGG - Intronic
1049256285 8:141615648-141615670 TTCTGTGCACTGTGGAACTGCGG + Intergenic
1049505523 8:142994419-142994441 GGCTGGGCACTGGGGATCTGGGG - Intergenic
1052122851 9:24738868-24738890 TACTGGGCACCGTGGAGCAGGGG - Intergenic
1056773758 9:89497572-89497594 CTCTGGGCGCGGGGGAGCGGGGG - Intronic
1057223010 9:93267900-93267922 GCCTGGGCACCGGGGAGGTGAGG + Exonic
1058612903 9:106794202-106794224 TCCTGGGCAGGGGGGATCGGGGG + Intergenic
1060594458 9:124839991-124840013 TTCAGGGCCTGGGGGAGGTGTGG + Intergenic
1060911687 9:127356182-127356204 TTCTGGGTAGAGGGGAGCTTAGG + Intronic
1061192121 9:129088111-129088133 ATGTGGGGACGTGGGAGCTGGGG + Intronic
1061836724 9:133334345-133334367 TTCTGTGCAGGGCGGGGCTGGGG - Intronic
1061893605 9:133635538-133635560 CTCTGGGCAAGAGGAAGCTGTGG + Intergenic
1061988089 9:134142078-134142100 TGCAGGGCACGGGGCAGGTGCGG + Intronic
1062389786 9:136329391-136329413 TTCTGGGCCAGTGGAAGCTGCGG + Intronic
1203747017 Un_GL000218v1:45432-45454 TTCTGGCCACGGGAGAGGTCAGG - Intergenic
1189381863 X:40507745-40507767 TCCTGGGGGCGAGGGAGCTGAGG + Intergenic
1190066861 X:47247457-47247479 TTCTGGGCAGGGGGGCGATCAGG + Intronic
1190179265 X:48177630-48177652 TGCTGGGCTCAGGGGACCTGTGG + Intergenic
1190222489 X:48521383-48521405 TTCTGAGCACTGAAGAGCTGGGG + Exonic
1190556486 X:51641029-51641051 TTCTGTGCAGTGGGGATCTGGGG - Intergenic
1191053866 X:56222632-56222654 GACTGGGCACGGTGGAGCAGGGG + Intergenic
1191258967 X:58292305-58292327 CACTGGGCCCGGGGGAGTTGTGG + Intergenic
1193896955 X:87126702-87126724 TTCTGGGGTTGGGGGAGCAGTGG - Intergenic
1198266462 X:135013727-135013749 TTCTGGGCACGGGAAATTTGGGG - Intergenic
1199539936 X:148947554-148947576 TTCAGGGGACAGGGGAGATGGGG + Intronic
1199851776 X:151729041-151729063 TGCTGGGGACAGAGGAGCTGGGG + Intergenic
1201323874 Y:12733024-12733046 CTCGGGGCCAGGGGGAGCTGAGG - Intronic
1202370042 Y:24190036-24190058 TCCTGGGCCAGGAGGAGCTGAGG - Intergenic
1202500742 Y:25480081-25480103 TCCTGGGCCAGGAGGAGCTGAGG + Intergenic