ID: 1097899186

View in Genome Browser
Species Human (GRCh38)
Location 12:64856691-64856713
Sequence CTCTAGACACACCTGGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 560
Summary {0: 1, 1: 3, 2: 43, 3: 119, 4: 394}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097899186_1097899196 2 Left 1097899186 12:64856691-64856713 CCAGGCCCCAGGTGTGTCTAGAG 0: 1
1: 3
2: 43
3: 119
4: 394
Right 1097899196 12:64856716-64856738 TTTTTCTGGGGGCCAGGGATTGG 0: 1
1: 0
2: 7
3: 50
4: 444
1097899186_1097899195 -3 Left 1097899186 12:64856691-64856713 CCAGGCCCCAGGTGTGTCTAGAG 0: 1
1: 3
2: 43
3: 119
4: 394
Right 1097899195 12:64856711-64856733 GAGTTTTTTTCTGGGGGCCAGGG 0: 1
1: 0
2: 1
3: 25
4: 375
1097899186_1097899194 -4 Left 1097899186 12:64856691-64856713 CCAGGCCCCAGGTGTGTCTAGAG 0: 1
1: 3
2: 43
3: 119
4: 394
Right 1097899194 12:64856710-64856732 AGAGTTTTTTTCTGGGGGCCAGG 0: 1
1: 0
2: 3
3: 32
4: 556
1097899186_1097899192 -10 Left 1097899186 12:64856691-64856713 CCAGGCCCCAGGTGTGTCTAGAG 0: 1
1: 3
2: 43
3: 119
4: 394
Right 1097899192 12:64856704-64856726 GTGTCTAGAGTTTTTTTCTGGGG 0: 1
1: 0
2: 4
3: 36
4: 394
1097899186_1097899193 -9 Left 1097899186 12:64856691-64856713 CCAGGCCCCAGGTGTGTCTAGAG 0: 1
1: 3
2: 43
3: 119
4: 394
Right 1097899193 12:64856705-64856727 TGTCTAGAGTTTTTTTCTGGGGG 0: 1
1: 1
2: 5
3: 39
4: 471

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097899186 Original CRISPR CTCTAGACACACCTGGGGCC TGG (reversed) Intronic
900624629 1:3602582-3602604 CTCAGCACACACGTGGGGCCTGG + Exonic
902120261 1:14159205-14159227 TTCTGGACATACCTGGAGCCTGG - Intergenic
902143838 1:14379788-14379810 CTCTAGACTGACCTAGTGCCTGG + Intergenic
902206367 1:14871081-14871103 CTGAAGACACACCTGGGCTCAGG - Intronic
902246157 1:15122185-15122207 CTTTGGACACAGCTGGCGCCAGG + Intergenic
903127216 1:21256258-21256280 CCCAAGACACCCGTGGGGCCAGG + Intronic
903177545 1:21590011-21590033 CTGTAGATGGACCTGGGGCCTGG + Intergenic
904356436 1:29943100-29943122 CTCTCAACACACCTGGTGTCAGG - Intergenic
905092838 1:35443146-35443168 CTCGAGACCCACCTTGGGCATGG + Intronic
905633367 1:39531469-39531491 CTCTGAAAACACCTGGGACCTGG + Intergenic
906878019 1:49558983-49559005 CTCTGGACCCTCCTGGGGCCTGG + Intronic
906906087 1:49893766-49893788 CTCAGGACCCACCTGGGTCCTGG + Intronic
907023841 1:51095419-51095441 CTCTGGGCCCACCTGGGGTCAGG + Intergenic
907638990 1:56166750-56166772 TTCTACACATACCAGGGGCCAGG + Intergenic
907964464 1:59315726-59315748 ATCTAGACATACCTGTGGCTTGG - Intronic
908175497 1:61551951-61551973 CTGTCAACCCACCTGGGGCCAGG - Intergenic
908958836 1:69670608-69670630 CTCTGGACCTCCCTGGGGCCAGG - Intronic
909848741 1:80433677-80433699 CTCTGGACATATCTGTGGCCTGG - Intergenic
910547426 1:88433563-88433585 CTCTAGACCTGCTTGGGGCCTGG + Intergenic
910733200 1:90421305-90421327 CTTTGGACCCACCTGGGGCCTGG + Intergenic
910818968 1:91325298-91325320 CTCTGGACACACCCAGGACCTGG + Intronic
911343922 1:96673944-96673966 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
911669670 1:100593529-100593551 CTCTGGACACACCTGGGGCCTGG - Intergenic
911961008 1:104302084-104302106 CTCTGGACATGCCTGGGGCCTGG + Intergenic
912036523 1:105324075-105324097 CTCTAGACCTACCTGGGGTCTGG - Intergenic
912242730 1:107927824-107927846 CTCTGGACCCACCTGGGGCCTGG + Intronic
912871488 1:113311010-113311032 TTCTAGACACACCCTGGGCCAGG + Intergenic
913416788 1:118618191-118618213 CTCTGGACCCACCTGGGGCCTGG - Intergenic
917003290 1:170385041-170385063 CTCTGGACCCACCTGAGGCCTGG - Intergenic
917226342 1:172788077-172788099 CTCTGGACCTACCTGGGGCCTGG - Intergenic
917737915 1:177937213-177937235 CTGCAGACACACCTGGGCCCTGG - Exonic
917986546 1:180326123-180326145 CTCTGGACCCACCCAGGGCCTGG - Intronic
918358078 1:183724712-183724734 CTCTGGACCTGCCTGGGGCCTGG + Intronic
919067742 1:192714431-192714453 ATCTAGACACACCCTGGGCCAGG + Intergenic
919129863 1:193438287-193438309 CTCTGGACATGCATGGGGCCTGG - Intergenic
919147153 1:193650727-193650749 CTCTGGACACACCTAGGACCAGG - Intergenic
919287662 1:195585246-195585268 CTATGGACCCACCTGGGGCCAGG + Intergenic
920185190 1:204155093-204155115 CACTGGACCCACCTGGGCCCTGG - Exonic
920264745 1:204713439-204713461 CTGTAGGCACACCTGTGCCCAGG - Intergenic
920744989 1:208617697-208617719 CTCTGGACCCACCTGGGGCCTGG + Intergenic
920982373 1:210850201-210850223 ATCTAAAAACATCTGGGGCCAGG + Intronic
921634677 1:217477799-217477821 CTCTGGACCTACCTGGGGTCAGG + Intronic
921929295 1:220742117-220742139 CTCTGAACCCACATGGGGCCTGG - Intergenic
922642335 1:227246356-227246378 CTCTGGACACACCCGGGGCCTGG + Intronic
923022395 1:230175035-230175057 CTAGAGACACAGCAGGGGCCAGG - Intronic
924490743 1:244535357-244535379 CTCTGGACCCACATGGGGCCTGG - Intronic
924648972 1:245905610-245905632 TTCTGGACCCACCTGGGGCCTGG + Intronic
1063452868 10:6163425-6163447 TCCTAGATACACCTGGAGCCTGG + Intronic
1064521650 10:16209321-16209343 CTCTGAACCCACCTGGGGCCTGG - Intergenic
1064719247 10:18212044-18212066 CTGTACAAACACCTGAGGCCTGG - Intronic
1067089024 10:43257319-43257341 GTCTAGACACAAGTGGGCCCAGG - Intronic
1067224580 10:44367358-44367380 CTCTGCACACACCTGGTGGCTGG + Intergenic
1068420200 10:56781193-56781215 CTCTAGATACACTTAGTGCCTGG - Intergenic
1068422082 10:56807731-56807753 CTCTAGAACCACCTGGGGCATGG - Intergenic
1069147910 10:64918229-64918251 ATCTAGACCCACCCAGGGCCTGG + Intergenic
1069958097 10:72063797-72063819 CTCCATAAACACCTGGGGGCCGG - Intronic
1070059310 10:72967176-72967198 CTCTGGACCCATCTGGGGCCTGG - Intergenic
1070477605 10:76845596-76845618 CTCTGGACCCACCCTGGGCCTGG + Intergenic
1071046626 10:81387172-81387194 CTCTGAACATGCCTGGGGCCTGG - Intergenic
1071209229 10:83318196-83318218 CTCTTGACCAACCTAGGGCCTGG + Intergenic
1072877758 10:99191172-99191194 CTCTGGACCTACCTGGGGCTGGG + Intronic
1073189601 10:101641863-101641885 CAATAGACACACATGTGGCCAGG + Intronic
1073248932 10:102110032-102110054 CTCCACACACACCTGGGGACAGG + Exonic
1073483645 10:103802792-103802814 CTTTAGGATCACCTGGGGCCGGG + Intronic
1073678904 10:105680357-105680379 CTCTAGATTCACCAGGGGCCTGG + Intergenic
1074226839 10:111493320-111493342 CCCTGGACTCACATGGGGCCTGG - Intergenic
1074408550 10:113202194-113202216 CTCTAGACTTGCCTGGGGCCTGG + Intergenic
1075581353 10:123620835-123620857 CTCTTGCCCCACCTGGGCCCTGG + Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1078690849 11:13579249-13579271 TTCTAGACACACTCTGGGCCAGG + Intergenic
1079038005 11:17037334-17037356 CTCTGGACCCACCCAGGGCCTGG + Intergenic
1079416045 11:20237659-20237681 GTCTCTAGACACCTGGGGCCAGG - Intergenic
1080767748 11:35312292-35312314 CTCAAGAAGCAGCTGGGGCCTGG - Exonic
1082122678 11:48396298-48396320 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1082556382 11:54567574-54567596 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1083654830 11:64224561-64224583 CTCCAGGCAGTCCTGGGGCCAGG + Exonic
1084360359 11:68665040-68665062 CACCAGACACAGCTGGGGACTGG + Intergenic
1084558401 11:69889061-69889083 CTCTAGACACACATGGATCTGGG - Intergenic
1084589931 11:70084684-70084706 GTCCAGACATACCTGTGGCCTGG + Intronic
1085147396 11:74213379-74213401 CTCTGGACTCACCTGGGACCAGG + Intronic
1085178521 11:74511667-74511689 CTCTGGACCTGCCTGGGGCCTGG + Intronic
1085223531 11:74896567-74896589 CTCTGGACACACCCAGGGCCTGG + Intronic
1085386360 11:76160451-76160473 CTGGAGAGAGACCTGGGGCCCGG + Intergenic
1085572048 11:77568407-77568429 CTTTGGACACACCCAGGGCCAGG - Intronic
1087370768 11:97280450-97280472 CTCTGGATATGCCTGGGGCCTGG + Intergenic
1087479249 11:98679130-98679152 CTCTAGACCAGCCTGGAGCCGGG - Intergenic
1088570003 11:111213625-111213647 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1088985266 11:114900016-114900038 ATCTAGACCTGCCTGGGGCCTGG + Intergenic
1089578785 11:119468559-119468581 CTCTGGACCCCCCTGGGGCCAGG - Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1089762131 11:120735640-120735662 CTATAGACCCACTTTGGGCCTGG - Intronic
1089946596 11:122480209-122480231 CTCTGGACCCACCAGGAGCCTGG + Intergenic
1090676826 11:129006827-129006849 CTCTGGACCCACCTAGGGCCTGG - Intronic
1091368384 11:135039998-135040020 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368398 11:135040064-135040086 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368405 11:135040097-135040119 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368418 11:135040163-135040185 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368439 11:135040273-135040295 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368446 11:135040306-135040328 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368453 11:135040339-135040361 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368466 11:135040416-135040438 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368473 11:135040449-135040471 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368486 11:135040515-135040537 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368507 11:135040625-135040647 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368514 11:135040658-135040680 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368521 11:135040691-135040713 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368543 11:135040801-135040823 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368550 11:135040834-135040856 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368570 11:135040944-135040966 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368577 11:135040977-135040999 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368598 11:135041087-135041109 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368605 11:135041120-135041142 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368632 11:135041263-135041285 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368653 11:135041373-135041395 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368660 11:135041406-135041428 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368675 11:135041483-135041505 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368715 11:135041692-135041714 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368741 11:135041824-135041846 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368762 11:135041934-135041956 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368793 11:135042088-135042110 CTCCGGACACACCTGGTGACGGG - Intergenic
1091368823 11:135042242-135042264 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368853 11:135042385-135042407 CTCAGGACACACCTGGTGACGGG - Intergenic
1091368884 11:135042539-135042561 CTCCGGACACACCTGGTGACGGG - Intergenic
1091967131 12:4754298-4754320 CTCTGGACCCACTTGGGACCTGG - Intronic
1092187620 12:6492961-6492983 ATCTAGGCACACCTGGGGATGGG + Exonic
1092611525 12:10178188-10178210 CTATAGACACAAATGTGGCCGGG - Intronic
1093123958 12:15306554-15306576 CTCTGGACCCACCTGGGGCCTGG - Intronic
1093617281 12:21241562-21241584 CTCTGGACCCACATGGGACCTGG + Intergenic
1094787283 12:33863404-33863426 CTCTGGACACACCCAGGGCCTGG - Intergenic
1095227608 12:39695648-39695670 TTCTGGATCCACCTGGGGCCTGG + Intronic
1097159172 12:57034107-57034129 CCCTAGGCAGACCTGGGGGCAGG - Intronic
1097568917 12:61307531-61307553 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1098395382 12:70011374-70011396 CTCTGGACCAACCTGGGGTCTGG + Intergenic
1099239109 12:80117121-80117143 CTCAAGAGACAAATGGGGCCTGG + Intergenic
1099564848 12:84230252-84230274 CTCTGGACCCACTTGGGTCCTGG - Intergenic
1100360726 12:93877429-93877451 CTCTGGACCCACCTGGTGTCTGG - Intronic
1100360858 12:93878250-93878272 TTCTAGACATACCCTGGGCCAGG - Intronic
1101191422 12:102337545-102337567 CCATAGACACTCCTGTGGCCGGG + Intergenic
1101755441 12:107617559-107617581 CTCTGGCCAGACCTGGGGCCTGG - Intronic
1102318022 12:111905515-111905537 CTCTGGACCCACCCAGGGCCCGG + Intergenic
1102575880 12:113855908-113855930 CTCCAGACAGACCTGGAGCTGGG + Intronic
1103526708 12:121574136-121574158 TTCTAGACAAGCCTGGGGCAGGG - Intronic
1103617125 12:122161375-122161397 ATAAAGACATACCTGGGGCCAGG - Intergenic
1104014040 12:124950539-124950561 CGCTAGAGACGCCTGGGGGCCGG + Exonic
1104404810 12:128508532-128508554 CTCTGCACACAGCTGGGGACAGG - Intronic
1104718792 12:131033289-131033311 CTCTAGAAACCCCTCCGGCCTGG - Intronic
1104963206 12:132497911-132497933 CCCTAGAGACCCCTCGGGCCTGG + Intronic
1107287713 13:38814664-38814686 CCCTGGACACATTTGGGGCCTGG - Intronic
1107524133 13:41213635-41213657 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
1107619009 13:42205592-42205614 CTCTACAACCACCTGGGGACTGG - Intronic
1107774338 13:43822538-43822560 CTTTGGACCCAACTGGGGCCTGG - Intergenic
1108023027 13:46148323-46148345 CTCCAAACACAACTGGGACCTGG + Intronic
1109336617 13:61003095-61003117 CTATGGACTCACCTGGGGACTGG - Intergenic
1112618804 13:101034281-101034303 CTCTAGACCCTCCAGGGGCCTGG - Intergenic
1114135860 14:19849438-19849460 CTCTAGACAAACATGGACCCTGG + Intergenic
1114987909 14:28252705-28252727 TTCTGGACCCACTTGGGGCCTGG - Intergenic
1115282313 14:31677901-31677923 CTCTGGACCCACCTGGGGTCTGG - Intronic
1115821066 14:37212613-37212635 TTCAGGACCCACCTGGGGCCTGG + Intronic
1115918420 14:38343235-38343257 CTCTGGACCCTCCTGGGGCCTGG + Intergenic
1116121930 14:40731856-40731878 CTCTGGACTCACCTGGGGACTGG - Intergenic
1116220829 14:42085350-42085372 CTCTGGACACATCTGAGGACTGG - Intergenic
1116481151 14:45392543-45392565 CTCTAGACCTCCCTGGGGCCTGG + Intergenic
1116489747 14:45492128-45492150 CTCTGGACTCACCCAGGGCCTGG - Intergenic
1116497718 14:45582840-45582862 ATCTAGACACACCCAGGGCGAGG - Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1117893351 14:60450561-60450583 CTCTAGACCTGCCTAGGGCCAGG + Intronic
1118538973 14:66802064-66802086 CTATGGACTCACCTAGGGCCTGG - Intronic
1119143686 14:72291060-72291082 CTCTCCACATCCCTGGGGCCAGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121333257 14:93061191-93061213 CTCAACACAGATCTGGGGCCAGG + Intronic
1121442513 14:93957868-93957890 CTCTCGACACCCCAGTGGCCCGG + Intronic
1121759696 14:96434691-96434713 TTCTGGACCCACCTGGAGCCTGG - Intronic
1122931592 14:104935342-104935364 CTTTCCACACACCTGGGGACTGG + Exonic
1123006339 14:105325582-105325604 CTCAAGACACACCTGGCTCCTGG - Intronic
1123508564 15:20971952-20971974 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123565786 15:21545701-21545723 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1123602048 15:21982988-21983010 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1124167171 15:27338538-27338560 CTCTGCACAGACCTGTGGCCTGG - Intronic
1125437967 15:39668315-39668337 CTCCAGACAGACCTGGGGAGGGG - Intronic
1125566153 15:40679998-40680020 CTCTGGACACACTTGGGACCTGG - Intergenic
1125767839 15:42146989-42147011 CTCTCGGCTCCCCTGGGGCCAGG - Intronic
1126096860 15:45096136-45096158 CTCTTCACACCCCTGAGGCCTGG + Intronic
1126317564 15:47386686-47386708 CTCTGGGAACACCTGGTGCCAGG + Intronic
1126503822 15:49379989-49380011 CTCTGGACCCACCCAGGGCCTGG - Intronic
1127155670 15:56122633-56122655 CTCTGGACCCATCTGGGGTCTGG - Intronic
1127177949 15:56381956-56381978 CTCTGGACCCACCCAGGGCCTGG - Intronic
1127477053 15:59344598-59344620 CTCTGGACCTACCTGGGCCCAGG - Intronic
1127770934 15:62230281-62230303 CGCAAGACACACCTGGGCCAGGG + Intergenic
1127945196 15:63744445-63744467 CTCTAGACCCACCTGAGGCTTGG - Intronic
1129908270 15:79205210-79205232 CCCTGAACACAGCTGGGGCCAGG + Intergenic
1131323444 15:91420388-91420410 CTCTAAACACACCCAGGACCAGG - Intergenic
1131427425 15:92357971-92357993 ATAAAGACACACCTGAGGCCGGG + Intergenic
1131950102 15:97672843-97672865 TTCTAGAGCCACCTGGGGCCTGG - Intergenic
1202974155 15_KI270727v1_random:272794-272816 CTCTAGACCTACCTGGGGCCTGG - Intergenic
1132461090 16:55174-55196 CTCTACCCACCCCTGGGGGCAGG + Intronic
1134657142 16:15955572-15955594 CTCCAGCCACACTTGTGGCCAGG + Intronic
1134842621 16:17413920-17413942 CCCTAAACCAACCTGGGGCCAGG + Intronic
1136264564 16:29107354-29107376 CCCTCGCCAGACCTGGGGCCAGG + Intergenic
1136281409 16:29213594-29213616 ATCAAGGGACACCTGGGGCCGGG - Intergenic
1138638220 16:58361376-58361398 CTCTCAATCCACCTGGGGCCCGG - Intronic
1139562938 16:67755273-67755295 CTCTAGACCCACCTAGGGAGGGG - Intronic
1139655501 16:68384784-68384806 CTCTACACACAGCTAGGGTCAGG - Intronic
1140212426 16:72981122-72981144 CTTTAGAGATAGCTGGGGCCCGG - Intronic
1140376616 16:74450027-74450049 CTCTAGAGGTACCTGGAGCCCGG - Intergenic
1141626625 16:85264782-85264804 CTCTACACACACCTGACACCAGG - Intergenic
1141803344 16:86325275-86325297 CCCCAGAGTCACCTGGGGCCAGG - Intergenic
1141859718 16:86708361-86708383 GTCTGGACACACCTGGGCCTTGG - Intergenic
1142085779 16:88179522-88179544 ATCAAGGGACACCTGGGGCCGGG - Intergenic
1142288141 16:89179770-89179792 CTCTGGACTCCCCTGTGGCCTGG - Intronic
1142291567 16:89195714-89195736 CTCAGGCCACACCTGGGGCCTGG - Intergenic
1142919647 17:3172935-3172957 CTCTGGACTCACCCAGGGCCTGG + Intergenic
1144792292 17:17867198-17867220 CTCCTCACACACCTGGGCCCTGG + Intronic
1145069256 17:19788985-19789007 CTCTGGACATGCCTGGTGCCTGG + Intronic
1147589050 17:41669525-41669547 CTCTAGGCCCAGCTGGGGGCTGG + Intergenic
1148701052 17:49587160-49587182 CTCAAGACTCACCAGAGGCCGGG + Intergenic
1149180579 17:53931796-53931818 CTCTGGACTCACCTGGGGCCTGG - Intergenic
1149234968 17:54578715-54578737 TTCTAGACCCATCTGGGGCATGG + Intergenic
1151575633 17:74951413-74951435 CCCTAGAGACCCCTGTGGCCAGG - Exonic
1152448841 17:80363670-80363692 CTGTAGCCACGCCTGGGGACTGG - Exonic
1153099680 18:1452155-1452177 TTCTGGACCCACCTGGGGCTTGG + Intergenic
1153363386 18:4224743-4224765 CTCTGGACCCACCTGGGGCCAGG + Intronic
1153425807 18:4961600-4961622 CTCTGGAACCACCTAGGGCCTGG + Intergenic
1154491104 18:14922990-14923012 ATCTAGACACATCCTGGGCCAGG + Intergenic
1155183521 18:23368322-23368344 CTTTGGACACCCCTTGGGCCTGG + Intronic
1155597367 18:27503037-27503059 ATCTGGACACACCTGAAGCCTGG + Intergenic
1155781997 18:29849117-29849139 TTCTGGACACACATGGGGCCTGG - Intergenic
1157291249 18:46411609-46411631 CTCTCGTCACAGCTGGGGACAGG - Intronic
1159260281 18:66004776-66004798 CTCTGGACTTGCCTGGGGCCTGG + Intergenic
1159394480 18:67838400-67838422 CTCTGGACCCACTTGTGGCCTGG - Intergenic
1159648138 18:70943680-70943702 CTCTGGACCCACCTGGGACCAGG + Intergenic
1159896420 18:74001249-74001271 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1160398105 18:78586888-78586910 CACTAGAGACACCTGTGGCCTGG + Intergenic
1161219712 19:3112885-3112907 CTCCAGACACACCGGGAGGCAGG - Intronic
1161575084 19:5050603-5050625 ATCAAGACTCTCCTGGGGCCAGG + Intronic
1161732978 19:5973525-5973547 CACTACAGACATCTGGGGCCAGG - Intronic
1162793821 19:13076620-13076642 CTCTGGACAGGCCTGGGCCCTGG + Intronic
1164464830 19:28478697-28478719 CTCTACATTCACCTGGGGCTTGG - Intergenic
1164491147 19:28715220-28715242 CTCTGGATCCACCTGGAGCCTGG + Intergenic
1165092779 19:33395536-33395558 CGCTGGCCACACCTGGGGCCTGG - Intronic
1165983540 19:39747209-39747231 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1165984128 19:39752424-39752446 TTCTGGACCCACCTAGGGCCTGG + Intergenic
1166408237 19:42539120-42539142 TTCTAGACACATCTGAGGCTTGG - Intronic
1167083213 19:47291311-47291333 CTCTGGACCCACCCAGGGCCGGG + Intronic
1167249810 19:48393829-48393851 CTCGAGAGACCCCTGGGGGCCGG - Intergenic
1167998960 19:53429617-53429639 CCCTAGAATCACCTGGGGGCAGG - Intronic
1168694908 19:58398588-58398610 CTCTAGACAGTCCTGGGCCCAGG - Intergenic
1168710373 19:58496630-58496652 TTGTGGACTCACCTGGGGCCAGG - Intronic
927041582 2:19235986-19236008 CTTCACAAACACCTGGGGCCAGG - Intergenic
927045347 2:19272567-19272589 CTCTGGAGTCACCAGGGGCCCGG + Intergenic
927570191 2:24152788-24152810 CTCTGGACATGCCTGGGACCTGG - Intronic
927848373 2:26483711-26483733 ATCTACACACTCCTGGGTCCTGG + Intronic
928293620 2:30061675-30061697 CTCTGGACCCACCTGGGCCCTGG + Intergenic
928442306 2:31302627-31302649 CTCTGGAGGCACCTCGGGCCTGG + Intergenic
928472291 2:31586300-31586322 CTCTGGACCCACCTGGGGCTTGG + Intergenic
928495586 2:31828657-31828679 CTGTGGACACACCTGGAGCCTGG - Intergenic
928811453 2:35233015-35233037 CTCCAGAGCCACTTGGGGCCAGG - Intergenic
929281653 2:40087027-40087049 CTCTAGACACACCTGGGGTGGGG - Intergenic
929388581 2:41441940-41441962 CTCCAGACCTACCTGAGGCCTGG - Intergenic
929555008 2:42920672-42920694 GACAAGACACACCTGGGGGCTGG + Intergenic
930492431 2:52092801-52092823 CTCTAGATCCACCTGGGGCCTGG - Intergenic
933260842 2:80129499-80129521 CCCTAGACACCTCTAGGGCCAGG + Intronic
933601061 2:84330754-84330776 CACTGGACACACCTGGGACCTGG + Intergenic
934870648 2:97861772-97861794 CTACAGACCCACCTGGGACCTGG + Intronic
935478536 2:103556617-103556639 CTCTCGACCCACTTGGGGCCAGG - Intergenic
935813030 2:106818115-106818137 CTCAAGACCCACCTGGGGCCAGG + Intronic
935928175 2:108093218-108093240 TTCTGGACACACCTGGGGCCTGG - Intergenic
936462087 2:112721638-112721660 CTTCAGACACACATGGGTCCAGG + Intronic
936795194 2:116195732-116195754 TTCTAGATCCACGTGGGGCCTGG - Intergenic
936885993 2:117310481-117310503 TCCTAGACACTACTGGGGCCTGG - Intergenic
937552118 2:123107427-123107449 CTCCAGAACCACCTGGGCCCTGG - Intergenic
937736457 2:125296737-125296759 CTCTGGACACACCCAGGGCCTGG - Intergenic
937905051 2:127049090-127049112 CCCGTGACCCACCTGGGGCCAGG - Intronic
940503832 2:154527685-154527707 GTCCAGACATACCTTGGGCCAGG - Intergenic
941227741 2:162869090-162869112 CTCTGGACCCATCTGGGGCCTGG + Intergenic
942391716 2:175502218-175502240 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
942862864 2:180636589-180636611 CTCTGGACCCATCTGGGGCCTGG + Intergenic
943337074 2:186628872-186628894 TTATAGACACACCTGGGTTCAGG + Intronic
943485392 2:188473378-188473400 CTCTGGACCTGCCTGGGGCCTGG - Intronic
943933658 2:193886493-193886515 CTCTGGAAATGCCTGGGGCCTGG + Intergenic
944929528 2:204501897-204501919 CTCCAGACACCCATGGGTCCTGG - Intergenic
945461634 2:210116298-210116320 CTCTAGACCCACCCGGGGCTGGG + Intronic
946127831 2:217579872-217579894 CATTACCCACACCTGGGGCCAGG - Intronic
948475421 2:238215957-238215979 CCCAGGACTCACCTGGGGCCTGG - Intergenic
1169302378 20:4455385-4455407 CTCTAGAAACAACTGGTGACTGG - Intergenic
1170461013 20:16576249-16576271 CTCTAGGCTCACCTGGGGTGAGG + Intergenic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1172778108 20:37419909-37419931 CTCTGGTCACACCTGGTCCCTGG + Intergenic
1172838727 20:37889131-37889153 CTCTGGAAACACCAGGGACCAGG + Intergenic
1173724866 20:45290422-45290444 CTCTCCACACACCTGGGCTCAGG + Intergenic
1174454195 20:50638134-50638156 CTCCAGAACCACCTGGAGCCAGG + Intronic
1174472643 20:50771911-50771933 CTCCAGAACCACCTGGAGCCAGG - Intergenic
1175047587 20:56121886-56121908 CTCTAGACTCAACTGGGGAAGGG - Intergenic
1175509703 20:59515524-59515546 CTCTGTGCACACCTGGTGCCTGG + Intergenic
1175824753 20:61930863-61930885 CTCTGGAAACACCGGGGGCCAGG + Intronic
1177133044 21:17280151-17280173 CTCTGGACCCACCTTAGGCCTGG + Intergenic
1177355925 21:20007494-20007516 CTCCAGTCACACATGTGGCCTGG - Intergenic
1177456394 21:21344674-21344696 CTCTGGACCCACCTGGGGCAAGG + Intronic
1178216675 21:30606341-30606363 TTCTAGACCCACCTGAGGCCTGG + Intergenic
1178412259 21:32374656-32374678 CTCTACTGACACTTGGGGCCAGG + Intronic
1178993955 21:37379880-37379902 ATATAGAAAAACCTGGGGCCTGG + Intronic
1179064648 21:38013741-38013763 CTCTGCACACAGCTGGGGCATGG - Intronic
1179094073 21:38296461-38296483 CACTTGACACAGCTGGGTCCTGG - Intronic
1179395988 21:41040387-41040409 TTCTGGACCCACCTGGGACCTGG + Intergenic
1179642210 21:42755259-42755281 CTCTTGGCACCCCTGAGGCCAGG + Intronic
1179652572 21:42821156-42821178 CCCTGGACCCACTTGGGGCCTGG + Intergenic
1179973636 21:44850564-44850586 CTCTGGACACACCTGCTTCCGGG + Exonic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1180848155 22:18995551-18995573 CCCTGGACATCCCTGGGGCCAGG - Intergenic
1181804899 22:25368836-25368858 CTCCAGGCACCCCTGAGGCCAGG + Intronic
1183416674 22:37686573-37686595 CTCTAGCCACGCCAGGGGGCGGG - Intronic
1184528534 22:45040057-45040079 CTCAAGAATCACCTGTGGCCGGG - Intergenic
1185239243 22:49733786-49733808 CACAAGACACCCCAGGGGCCTGG - Intergenic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
949155945 3:827389-827411 CTCTGGACCCACCTCAGGCCTGG + Intergenic
949448453 3:4161400-4161422 CTCTGGACCCACCGAGGGCCTGG - Intronic
951029212 3:17862936-17862958 TTCTGGGCCCACCTGGGGCCAGG - Intronic
951423193 3:22511304-22511326 CTCTGGACCTACCTGGGGCCTGG + Intergenic
951819290 3:26790736-26790758 CTCTGGATCCACCTGGGGCCTGG - Intergenic
952066375 3:29576581-29576603 CTCTGGACCCACCTGGGGCCTGG - Intronic
952222034 3:31332645-31332667 CTCTGGACACAGCCAGGGCCTGG + Intergenic
952811818 3:37411152-37411174 CTCTGGACCCACCTGGGAACAGG - Exonic
954028344 3:47800847-47800869 CTCTCCACACACTTGTGGCCTGG + Intergenic
954838692 3:53493846-53493868 CTCCAAACACACGTGGGGGCGGG + Intergenic
955274288 3:57532933-57532955 CTCTGGACCCACCTGGGGCTTGG - Intronic
956413391 3:69002202-69002224 CTCTAGACTCAACCTGGGCCTGG - Intronic
958078428 3:88713240-88713262 TTCTTGACCCACCTGGGGCCTGG + Intergenic
958631134 3:96685399-96685421 TTCTGGACCCACCTGGAGCCTGG - Intergenic
958876760 3:99625235-99625257 CTCTGGACTTACCTGGGGCCTGG + Intergenic
958976909 3:100679057-100679079 CTCTGGACCGACCTGGGGACAGG - Intronic
959189795 3:103097069-103097091 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG + Intergenic
959547370 3:107612844-107612866 CTCTGGACCCACCCAGGGCCTGG - Intronic
959761884 3:109976113-109976135 TTCTGGACCCACCTGGGACCTGG - Intergenic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
960207250 3:114917978-114918000 CTCTGGAACCATCTGGGGCCGGG - Intronic
960498989 3:118412339-118412361 CTCTGGACACACCTAGGACCAGG + Intergenic
962193662 3:133337099-133337121 CTCTGGACCCACCTGGGGCCTGG + Intronic
962671975 3:137717334-137717356 CTATAGACACACATGCGGGCCGG - Intergenic
962698938 3:137978537-137978559 ATCTGGACATGCCTGGGGCCTGG - Intergenic
962862556 3:139418462-139418484 CTCTAGACCCATCTGGGGCCTGG - Intergenic
963448116 3:145440547-145440569 TTCTGGACCCACCTGGGGCCTGG + Intergenic
964209232 3:154209850-154209872 CTCTCGACCCACCTGGGGCCTGG - Intronic
964339061 3:155688942-155688964 CGCTGGACATGCCTGGGGCCGGG + Intronic
964961121 3:162427878-162427900 TTCTGGACTCACCTGGGGCCTGG + Intergenic
965380692 3:167983727-167983749 GTCTGGACCCACTTGGGGCCTGG + Intergenic
966312970 3:178615372-178615394 CTCTGGACCCACTTGGGGCCTGG - Intronic
966348637 3:179005395-179005417 CTCTGGACCCACCTGGGGCCTGG + Intergenic
966491156 3:180529900-180529922 CTCTGGACTCACCCAGGGCCTGG + Intergenic
966732797 3:183164256-183164278 CTGTAAAACCACCTGGGGCCAGG - Intergenic
967636677 3:191809359-191809381 CTCTGGACCCACCTGAGGCAGGG + Intergenic
969110571 4:4841594-4841616 CTCTGGACACACCTGGGAAAGGG + Intergenic
970011064 4:11459755-11459777 CTCTTGACCCACTTGGGACCTGG + Intergenic
971702774 4:30000843-30000865 CTCTTGACACACCTGGACCAAGG + Intergenic
972063329 4:34909247-34909269 ATAAAGACACACCTGGGGCTGGG - Intergenic
972909610 4:43797979-43798001 ATCTGGACCCACCTGGGGCCTGG + Intergenic
973227517 4:47802658-47802680 CTCTGGACCCACCTGAGGCCTGG + Intronic
975026820 4:69559292-69559314 CTCTGAACATGCCTGGGGCCAGG + Intergenic
975081063 4:70281039-70281061 CTCTGGACCCACCTGAGGTCTGG + Intergenic
975503976 4:75117783-75117805 CTCTTGACCCATCTGGGGCCTGG + Intergenic
975839012 4:78454761-78454783 CTCTTAACACAGCTGGGGTCAGG - Intronic
976254123 4:83083087-83083109 CTCTGGACTCACCTGGGGCCTGG - Intergenic
976402580 4:84623949-84623971 CTCTTGAAACACCTGGCTCCTGG - Intronic
976908307 4:90267389-90267411 CTCTGGACCCACCTGGGGCCTGG + Intronic
978287880 4:107099508-107099530 GTCTTGTCCCACCTGGGGCCTGG + Intronic
978654441 4:111049423-111049445 CTTTGGACCCACCTGGGGCCAGG + Intergenic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
979213213 4:118132163-118132185 CTCTGGACCTGCCTGGGGCCTGG - Intronic
980657753 4:135811865-135811887 CTCTGAACTCACCCGGGGCCTGG + Intergenic
981518277 4:145634160-145634182 CTCTGGACTTACCTGGAGCCTGG - Intronic
981870974 4:149486217-149486239 CTCTGGACACACCCAGGGCCTGG - Intergenic
983456350 4:167969173-167969195 CTCTGTACCCACCTGGGGCCTGG + Intergenic
985229562 4:187799791-187799813 CTTTTGACCCTCCTGGGGCCTGG + Intergenic
986492683 5:8308305-8308327 TTCTAGACACACCCTGGGACTGG + Intergenic
986657617 5:10030850-10030872 TTCTAGACACACTCTGGGCCAGG - Intergenic
986901363 5:12438078-12438100 ATTTAGGCACACCTGAGGCCTGG + Intergenic
987823180 5:22991937-22991959 CTCTGGACCCACCTGGTGTCTGG + Intergenic
988117917 5:26920411-26920433 CTCTGGACCCACCTAGGACCAGG + Intronic
988470144 5:31530314-31530336 CTCATGATAAACCTGGGGCCCGG + Intronic
989504764 5:42215100-42215122 CTCTGGACCCATCTGGGTCCTGG - Intergenic
989629040 5:43461833-43461855 CTCTAGACCCACCCAGGGCCTGG + Intronic
989672675 5:43936714-43936736 CTCTGGACTCGCCTGGGGACTGG + Intergenic
990578909 5:57150006-57150028 CTCTGGACCCACCCAGGGCCTGG - Intergenic
992454279 5:76901975-76901997 TTCTAGACACACTTTGGGCCAGG - Intronic
995089928 5:108162201-108162223 CTCAATAAACACCTGGGGCTGGG + Intronic
995777907 5:115745518-115745540 CTCTGGACCCACCTGGGGCATGG - Intergenic
995874009 5:116771303-116771325 CTGAAGACACACCTTGGACCTGG + Intergenic
996133329 5:119809038-119809060 TTCTGGACCCACCTGGGGCCTGG - Intergenic
997613318 5:135230140-135230162 CTGCAGCCACACCTGGGGCCTGG - Intronic
998135307 5:139671350-139671372 CTCTAGAGACCCTGGGGGCCTGG - Intronic
998634075 5:143932687-143932709 CTCTGGACACACTTGGGGCCTGG + Intergenic
1000399548 5:160811740-160811762 CTCTGGACCCACCAAGGGCCTGG + Intronic
1000455002 5:161437943-161437965 TTCTGGACCCACCTGGGGCCTGG + Intronic
1001562196 5:172677097-172677119 CTGTAAGCACACCTTGGGCCGGG + Intronic
1001862086 5:175066071-175066093 TTCCAGACACAGCTGAGGCCAGG - Intergenic
1001982705 5:176047494-176047516 CTCGACTCCCACCTGGGGCCTGG + Intergenic
1002234758 5:177796563-177796585 CTCGACTCCCACCTGGGGCCTGG - Intergenic
1002643514 5:180641598-180641620 CTCTCTTCACTCCTGGGGCCAGG + Intronic
1003514037 6:6803790-6803812 GCTGAGACACACCTGGGGCCAGG + Intergenic
1007358899 6:41341602-41341624 AATTAGACACACCTGTGGCCTGG - Intronic
1008731710 6:54491119-54491141 CACTGGACTCACCTGGGACCAGG - Intergenic
1009353350 6:62709041-62709063 CTCTAGACCCACCAGGTACCTGG - Intergenic
1009847286 6:69150205-69150227 CTCTGGACTCAACTGGGACCTGG - Intronic
1010474825 6:76274518-76274540 CTCTGGACGTACCTGGGACCTGG - Intergenic
1010548075 6:77183750-77183772 CTCTGGACTCACCTAGGGCCTGG + Intergenic
1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG + Intergenic
1011333158 6:86233160-86233182 CTCTGGACCTGCCTGGGGCCTGG - Intergenic
1011901408 6:92302594-92302616 TTCTGGGCACACCCGGGGCCAGG + Intergenic
1011914544 6:92487841-92487863 CTCTGGGCCCACCAGGGGCCTGG - Intergenic
1012003686 6:93685492-93685514 CTCTGGACCCACCTGGGACCTGG + Intergenic
1012028682 6:94030163-94030185 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1012047839 6:94301207-94301229 CCCTGGACCCACCCGGGGCCAGG + Intergenic
1012073696 6:94657112-94657134 ATCTGGACCTACCTGGGGCCTGG - Intergenic
1014073964 6:117215622-117215644 CTCTAAACACACTCTGGGCCAGG - Intergenic
1014855484 6:126396136-126396158 CTCTGGACACACTCAGGGCCTGG - Intergenic
1015030381 6:128587176-128587198 CTCTGGACCCACGTGGGGCCTGG + Intergenic
1015052752 6:128862517-128862539 CTCTAGACATGCTTGGGACCTGG - Intergenic
1015460784 6:133488303-133488325 CTGTAGACCCACCAGGGACCAGG + Intronic
1018085020 6:160294079-160294101 CTCTAGACTCACGTTTGGCCAGG + Intergenic
1018414194 6:163587088-163587110 CTCCAGACATAACTGTGGCCAGG - Intergenic
1019504717 7:1385218-1385240 CTGTAGCCACACCTGTGTCCAGG - Intergenic
1021382332 7:19983400-19983422 CCCTAGACTCACCTGGAGTCTGG - Intergenic
1021946802 7:25735685-25735707 CACTGGACACCCCTGGGTCCTGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023552907 7:41388515-41388537 CTCCAGCCACACCTGGCTCCCGG + Intergenic
1023983095 7:45080909-45080931 CTCCAGCCTCACCCGGGGCCTGG + Exonic
1024956579 7:54927134-54927156 CTCCAGACCCACCTAGGGCCTGG + Intergenic
1025959797 7:66209961-66209983 CTGAAAATACACCTGGGGCCAGG - Intronic
1026136919 7:67671603-67671625 CTCTAGTCACCCTTGGGGCAGGG + Intergenic
1026976589 7:74502536-74502558 TTCTAGCCAGCCCTGGGGCCAGG - Intronic
1027524146 7:79245677-79245699 CTCTGGACCCACCTGGGATCAGG + Intronic
1027808321 7:82859149-82859171 TTCTGGACCCACCTGGGGCCTGG + Intronic
1028186308 7:87789924-87789946 CTCTGGACCCACCCAGGGCCTGG + Intronic
1028264390 7:88705239-88705261 CTCTGGACCCAGCTGGAGCCTGG - Intergenic
1028299522 7:89180534-89180556 TTCTAGACACACCTTGAGCCAGG - Intronic
1029364021 7:100105955-100105977 CTTTAGATAAACCTGGAGCCTGG - Exonic
1029483499 7:100826334-100826356 CCCGGGACTCACCTGGGGCCGGG + Intronic
1032980295 7:137274206-137274228 CTCTAGGCACAGCTGGGGTAAGG - Intronic
1033449483 7:141449745-141449767 CGCCAGACACACCTTGGCCCAGG + Intronic
1033867714 7:145713199-145713221 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1034418123 7:150975824-150975846 CCCTGGACACACCTGGAGCCTGG + Intronic
1035328729 7:158082896-158082918 CCGTAGACAGGCCTGGGGCCTGG - Intronic
1040095772 8:43440858-43440880 CTCTGGACCCACATGGGGCCTGG + Intergenic
1040485813 8:47870079-47870101 CTCTTGACCCACCTGGAGCCAGG + Intronic
1042162703 8:65912928-65912950 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1043449023 8:80348424-80348446 CACTAGACACACCTATGCCCCGG - Intergenic
1044259136 8:90097836-90097858 CTCTAGAGACACCTGTGGAGAGG - Intergenic
1044395153 8:91702707-91702729 TTCTGGACCCATCTGGGGCCTGG - Intergenic
1045311834 8:101009811-101009833 CTTTCTAAACACCTGGGGCCAGG + Intergenic
1045351257 8:101342146-101342168 CTCTATAAACACCCGGGCCCCGG + Intergenic
1045589914 8:103582165-103582187 TTCTAGACACATCCTGGGCCAGG + Intronic
1045590024 8:103582833-103582855 CTCTGGACCCACCTGGGGCCTGG + Intronic
1045733313 8:105266772-105266794 CTCTGAACACACGTGGGGCCTGG - Intronic
1045777381 8:105821759-105821781 CTTTGGACCCACCTGGGGCCTGG - Intergenic
1046268122 8:111858416-111858438 CTCTGGACCCACCTGGAGCCTGG - Intergenic
1047233219 8:123015470-123015492 CGGGAGACACAACTGGGGCCAGG - Exonic
1047342709 8:123998659-123998681 CTCTGGACCCATCTGGGGCCAGG - Intronic
1049603454 8:143518625-143518647 CTCAGGGCACACCTGGTGCCTGG - Intronic
1050248253 9:3714240-3714262 CTCTGGACACACCTGGGGCCTGG + Intergenic
1050355948 9:4782594-4782616 CAATGGACCCACCTGGGGCCTGG + Intergenic
1051923827 9:22299270-22299292 TTCTACACACACCTTGGGCCAGG - Intergenic
1052063384 9:23987516-23987538 CTCTGGACCTCCCTGGGGCCTGG + Intergenic
1052258819 9:26491249-26491271 TTCTAGACACACCCTGGGCCAGG - Intergenic
1052607509 9:30723523-30723545 CTCTGGATCCACCAGGGGCCTGG + Intergenic
1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG + Intergenic
1053153578 9:35757615-35757637 CTCTGGACAGACCTGATGCCTGG - Exonic
1055387338 9:75776351-75776373 CTCTGGACCCATCTGGGGTCTGG + Intergenic
1056230501 9:84538525-84538547 CTCTAGACCCACCTGGAGCCAGG - Intergenic
1057792014 9:98130781-98130803 CCCTAGGAACACCTGGAGCCAGG - Intronic
1059817898 9:117938502-117938524 CTAGAGGCACACCTGAGGCCTGG - Intergenic
1060328497 9:122642513-122642535 CTCTAGAGCCACCTGGGGGGAGG + Intergenic
1060898706 9:127238446-127238468 CTCAAGGCACACCTAGGGCTTGG + Intronic
1061325143 9:129859145-129859167 CTGAGGACACACCTGGGGCCGGG - Intronic
1061918808 9:133770959-133770981 CTCTACACACAGCTTGGGTCTGG - Intronic
1061923880 9:133796674-133796696 CTCTGCACACACCTGGTGCATGG - Intronic
1062401222 9:136373559-136373581 CTGCAGACACACCAGGAGCCTGG + Exonic
1062524369 9:136972348-136972370 ACCTGGACACACCTGCGGCCTGG + Intergenic
1185785443 X:2887009-2887031 CTCCCCTCACACCTGGGGCCAGG + Intergenic
1186515317 X:10162312-10162334 CTCAAGACTCAACTGCGGCCAGG - Intronic
1186691859 X:11985939-11985961 CTCTGGACTTGCCTGGGGCCTGG + Intergenic
1187651987 X:21419994-21420016 CTCTGGACCCACCCAGGGCCTGG - Intronic
1187846335 X:23541502-23541524 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1188046178 X:25428201-25428223 CTTTGGACCCGCCTGGGGCCTGG - Intergenic
1188068783 X:25694660-25694682 CTCTGGATGCACTTGGGGCCTGG - Intergenic
1188721551 X:33528859-33528881 TTCTAGACACACCCCAGGCCAGG - Intergenic
1188924551 X:36023556-36023578 CTCTGGACCCACCCGGGGCCTGG - Intergenic
1188930102 X:36098458-36098480 CTCTGGACCCACCTGGGGTCTGG - Intronic
1188931988 X:36123386-36123408 CCCTGGACACACTTGGGACCTGG - Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1189467602 X:41289116-41289138 CGCCACACACACCTAGGGCCTGG - Intergenic
1189657928 X:43266824-43266846 CTCTGGACCCACCTGGGACATGG - Intergenic
1189690493 X:43612718-43612740 CTCTGGACATGCCTGGGGCCTGG - Intergenic
1189690601 X:43613388-43613410 TTCTAGACACACCCTGGGCAAGG - Intergenic
1189858484 X:45248007-45248029 TTCTAGACACAACCTGGGCCAGG - Intergenic
1190588078 X:51967393-51967415 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1190614666 X:52217841-52217863 CTCTGGACCCACTTGGGGCCTGG + Intergenic
1190919488 X:54838882-54838904 CTCTAGACCCACCTAGGGCCTGG - Intergenic
1191994717 X:67080466-67080488 TTCTGGACCCACCTGGGGACTGG - Intergenic
1192027211 X:67466409-67466431 TTCTGGACCCACCTGGGGCCTGG + Intergenic
1192135130 X:68589711-68589733 CTCTGGACATACCTGGGGTCTGG + Intergenic
1192380875 X:70614555-70614577 CTCTGGACTCACCTGGGGCCTGG + Intronic
1192406100 X:70887617-70887639 CTCTGGACCCACCCAGGGCCTGG + Intronic
1192521493 X:71805016-71805038 CTCTGGACCCACCTGGGATCTGG + Intergenic
1192725871 X:73751853-73751875 CTCTGGACACATCTGAGGCCTGG - Intergenic
1192855900 X:75011594-75011616 TTCTGGACCCACCTGGGGCTTGG - Intergenic
1193260854 X:79404558-79404580 TTCTGGACCCAACTGGGGCCTGG + Intergenic
1193441114 X:81539845-81539867 CTCTGGACCCACCTGGGACTAGG + Intergenic
1193455380 X:81725253-81725275 CTCTGGACTCACATGAGGCCTGG + Intergenic
1193563326 X:83047258-83047280 CTCTGGACCCACCTAGGGCCTGG - Intergenic
1193583608 X:83294251-83294273 CTCTAGCCACAGGTGAGGCCTGG + Intergenic
1193670358 X:84376794-84376816 CTCTGGACCCACCTGGGGCCTGG + Intronic
1193683659 X:84552289-84552311 CTCTGGACCCACCTGGGGCCTGG - Intergenic
1193877788 X:86883648-86883670 CTCTGGACTCACCTGGGGAATGG - Intergenic
1193880085 X:86910949-86910971 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1193907640 X:87262108-87262130 TTCTTGACCCACCTGGGGCCTGG + Intergenic
1193915459 X:87357188-87357210 TTCTAGACACACCCTGGGCCAGG + Intergenic
1194196645 X:90902887-90902909 CTCTGGACACAACGGTGGCCTGG - Intergenic
1194323129 X:92477199-92477221 ATCTGGACATACCTGGGGCCTGG - Intronic
1194358447 X:92917942-92917964 TTTTGGACTCACCTGGGGCCTGG - Intergenic
1194370880 X:93070021-93070043 GTCTGGACCCACCTGGGGACTGG + Intergenic
1194568503 X:95522989-95523011 CTCTGGACTCACCTAGGGCATGG + Intergenic
1194591583 X:95805914-95805936 CTCCGGACCCACCTGGGGCCTGG + Intergenic
1194787556 X:98105908-98105930 CTCTGGACCCACCTGGGGCATGG - Intergenic
1194791867 X:98160354-98160376 CTCTGGACCCACCTGGGGCCTGG + Intergenic
1194892213 X:99394352-99394374 CTCTAGAAATGCCTGGGGCCTGG - Intergenic
1194990783 X:100544350-100544372 CTCTTGACCTGCCTGGGGCCTGG + Intergenic
1195172196 X:102280793-102280815 TTCTGGACCCACCTGGGGCTTGG - Intergenic
1195186664 X:102406300-102406322 TTCTGGACCCACCTGGGGCTTGG + Intronic
1195199435 X:102533332-102533354 CTCTGGAAACACCCGGGGCATGG + Intergenic
1195312357 X:103643808-103643830 CTCTGGACCTGCCTGGGGCCTGG + Intergenic
1196096674 X:111808228-111808250 CTCTGGACCCACCTGGGGACTGG - Intronic
1196154106 X:112407548-112407570 CTCTTGACACACCTGGGGCCTGG + Intergenic
1196233433 X:113252572-113252594 CTCTGGACACACCTGGAACTGGG - Intergenic
1196242967 X:113365543-113365565 CTCTGGACACACCCAGGGCCTGG - Intergenic
1196467877 X:115991626-115991648 CTCTGGACCCACCTAGGGTCTGG + Intergenic
1196495428 X:116318589-116318611 CTCTAGACCTACCTGGGGCCTGG + Intergenic
1196552584 X:117046215-117046237 CTCTGGACACGCCTGGGGCCTGG + Intergenic
1196573362 X:117289177-117289199 CTCTAGACCCATCCGGGGCCTGG + Intergenic
1196639313 X:118039632-118039654 CTCTGGACACACCCAGGGCCAGG + Intronic
1196865431 X:120066513-120066535 TTCTAGACCCACCTGGGGCCTGG + Intergenic
1196877663 X:120169767-120169789 TTCTAGACCCACCTGGGGCCTGG - Intergenic
1197113001 X:122798167-122798189 CTCTGGACCCACCTGGGGCTGGG + Intergenic
1197303003 X:124804080-124804102 CTTTATACTCAGCTGGGGCCAGG - Intronic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197544546 X:127808751-127808773 CTTTGGAAACACCTGGGGCCTGG + Intergenic
1197561990 X:128034946-128034968 CTCTGGACTCACGTGGGGTCTGG + Intergenic
1197623472 X:128778635-128778657 CTCAGGACCCACCTGGGGCCCGG - Intergenic
1197987071 X:132278233-132278255 TTCTGGACTCACCTGGGGCTCGG - Intergenic
1197987198 X:132278902-132278924 TTGTAGACACACCCTGGGCCAGG - Intergenic
1198233255 X:134713804-134713826 GTGTAGACACACCTGAGTCCAGG - Intronic
1198515137 X:137399831-137399853 CTCTGGACACACCTGGGGCATGG - Intergenic
1198785392 X:140282944-140282966 CTCTGGACCCATCTGGGACCTGG - Intergenic
1198788255 X:140314278-140314300 CTCTGGACCCACCCAGGGCCTGG + Intergenic
1199173667 X:144759230-144759252 CTCTAGACACATGTGGGACCAGG + Intergenic
1199217857 X:145281911-145281933 CTCTGGACCCACCCAGGGCCTGG - Intergenic
1199274705 X:145927029-145927051 CTCTGGACCCACCCGGGGACTGG + Intergenic
1199676770 X:150196015-150196037 CTCTAGACACCCCAGAGGCTTGG - Intergenic
1200542492 Y:4477088-4477110 CTCTAGACACAACGGTGGCCTGG - Intergenic
1200631228 Y:5590356-5590378 ATCTGGACATACCTGGGGCCTGG - Intronic
1200678675 Y:6181911-6181933 GTCTGGACCCACCTGGGGACTGG + Intergenic