ID: 1097899388

View in Genome Browser
Species Human (GRCh38)
Location 12:64857899-64857921
Sequence TGGGAGAGTGCAGTGACTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 11, 3: 42, 4: 286}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097899388_1097899394 14 Left 1097899388 12:64857899-64857921 CCTCTAGTCACTGCACTCTCCCA 0: 1
1: 0
2: 11
3: 42
4: 286
Right 1097899394 12:64857936-64857958 GACTCTTTCTCCATGTCTTATGG 0: 1
1: 0
2: 1
3: 18
4: 182
1097899388_1097899396 25 Left 1097899388 12:64857899-64857921 CCTCTAGTCACTGCACTCTCCCA 0: 1
1: 0
2: 11
3: 42
4: 286
Right 1097899396 12:64857947-64857969 CATGTCTTATGGCCACTGCCAGG 0: 1
1: 0
2: 1
3: 19
4: 157
1097899388_1097899397 26 Left 1097899388 12:64857899-64857921 CCTCTAGTCACTGCACTCTCCCA 0: 1
1: 0
2: 11
3: 42
4: 286
Right 1097899397 12:64857948-64857970 ATGTCTTATGGCCACTGCCAGGG 0: 1
1: 0
2: 1
3: 23
4: 156
1097899388_1097899398 27 Left 1097899388 12:64857899-64857921 CCTCTAGTCACTGCACTCTCCCA 0: 1
1: 0
2: 11
3: 42
4: 286
Right 1097899398 12:64857949-64857971 TGTCTTATGGCCACTGCCAGGGG 0: 1
1: 0
2: 3
3: 24
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097899388 Original CRISPR TGGGAGAGTGCAGTGACTAG AGG (reversed) Intronic
900002192 1:20878-20900 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
900021914 1:191402-191424 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
904735028 1:32625153-32625175 GGGGAGGTTGCAGTGAGTAGAGG + Intronic
905906850 1:41624111-41624133 GTGGAGAGTGCAGTCAGTAGTGG - Intronic
906345841 1:45013798-45013820 TGGGACAGGGCAGGGACTCGGGG + Intronic
906827172 1:48993804-48993826 AGGGAGAGTGCAGTGATTGTGGG - Intronic
907934165 1:59027391-59027413 TGGGAGAATCCAGTGACTCACGG - Intergenic
908363273 1:63390800-63390822 AGGGAGAGTGCAGTGACTATGGG - Intronic
910147435 1:84098587-84098609 TGGGAGATTGGATGGACTAGGGG + Intronic
911046297 1:93631509-93631531 TGGCAGAGGACAGTGACTATTGG + Intronic
911942859 1:104069513-104069535 AGAGAGAGTGCAATGACTGGGGG - Intergenic
911960846 1:104300915-104300937 AGGGAGGGTGCAGTGACTGAAGG + Intergenic
912018548 1:105072980-105073002 AGGAAGAGTGCAGTGACTGAGGG - Intergenic
915752662 1:158226761-158226783 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
917916666 1:179709089-179709111 TGGGGGAGTGCAGTGAATAAGGG - Intergenic
918357892 1:183723505-183723527 AGGGAGAGTACAGTGACTGTGGG + Intronic
919606303 1:199688750-199688772 TGGGAGAGGGCAGCTATTAGGGG - Intergenic
920161005 1:203997567-203997589 TGGGAGAAAGCAGTGGCTATGGG - Intergenic
921032910 1:211349717-211349739 AGGGAGAGTGCAGAGTGTAGTGG + Intronic
921932488 1:220766021-220766043 TAGGAGAGTGCAGGGACCACGGG + Intronic
922362935 1:224839684-224839706 TGGGACAGTGCAGTGGCAACTGG - Intergenic
922466526 1:225848697-225848719 TGGGGGAGTGCAGGGATGAGGGG + Intronic
923538211 1:234869352-234869374 TGGAAGAGAGCAGTGCCTGGAGG - Intergenic
924516319 1:244769011-244769033 AGGGAGAGCGCAGTGACTGGGGG - Intergenic
1065820112 10:29517519-29517541 TGGGAGATTTCAGCCACTAGAGG - Intronic
1066649838 10:37643670-37643692 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067032728 10:42889217-42889239 AAGGAGAGTGCAGTGATTATGGG - Intergenic
1067713951 10:48672265-48672287 TGGGCGATTGCTCTGACTAGGGG + Intergenic
1068377666 10:56205434-56205456 TGGTAGAGCGGAGTGACTTGGGG - Intergenic
1069050571 10:63788305-63788327 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1070764188 10:79047183-79047205 TGGGAGAGTCCAGTGGGTGGAGG + Intergenic
1073576691 10:104631798-104631820 AGGGAGACTGCAGAGCCTAGTGG - Intergenic
1074099789 10:110345756-110345778 GGGGAGAGTGGAGTGACTCCTGG + Intergenic
1075496261 10:122922166-122922188 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1075633242 10:124013939-124013961 TATGAGAGTGCAGAGACCAGGGG - Intronic
1076913239 10:133402771-133402793 TGGGTGAGTGCAGTGAATGCAGG + Exonic
1077061546 11:619891-619913 GGGGAGGCAGCAGTGACTAGTGG + Intronic
1078579771 11:12529329-12529351 GGGGGGTGGGCAGTGACTAGGGG + Exonic
1084552469 11:69854119-69854141 TGGGAGAGTGCTGGGATTACAGG - Intergenic
1085572244 11:77569531-77569553 AGGGAGAGTGCAGTGATTATGGG - Intronic
1087134330 11:94700148-94700170 TTGCAGAGTGCAGTGAAAAGAGG + Intergenic
1088545270 11:110952780-110952802 TGGAGCAGTGCAGTGACCAGTGG - Intergenic
1089013247 11:115147304-115147326 TGGGACAGTGGAGTGTGTAGGGG + Intergenic
1091375607 12:22938-22960 CGGGAGTGTGCAGAGACTGGAGG - Intergenic
1092062292 12:5561296-5561318 GGGGAGAGTGCGGTGACCAGTGG - Intronic
1093424716 12:19015463-19015485 TGGGAGAGAGCAGAGAGCAGAGG + Intergenic
1095134286 12:38579688-38579710 TGGGAGGGTGAAGTGAGGAGAGG + Intergenic
1095860141 12:46907802-46907824 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
1096108652 12:49015063-49015085 GGGGAGAGTGCAGGGAGTAAGGG + Intronic
1097065866 12:56320052-56320074 TTGGATAGGGAAGTGACTAGGGG + Intronic
1097714859 12:62955206-62955228 ATGTAGAGTGCAGTGACTAAGGG - Intergenic
1097899388 12:64857899-64857921 TGGGAGAGTGCAGTGACTAGAGG - Intronic
1098405573 12:70122901-70122923 AGAGAGAGTGCAGTGACTAGAGG + Intergenic
1098419114 12:70272740-70272762 AGGGAGAGTGAAGGGATTAGAGG - Intronic
1098513996 12:71352746-71352768 GGGGAGATTGCAGTGAGTCGGGG - Intronic
1099757785 12:86876891-86876913 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1101598172 12:106185795-106185817 TCGCAGAGTGCAGTGAGAAGAGG - Intergenic
1101754020 12:107607114-107607136 TGGGAGAGGCCAGAGACTAGGGG - Intronic
1102575909 12:113856059-113856081 TGGGAGAGGGAAGTCACTACAGG + Intronic
1102625530 12:114232715-114232737 TGGGACTGTGCAGTGACTAAAGG - Intergenic
1106350213 13:28922631-28922653 AGGGAGAGCGCAATGACTGGGGG - Intronic
1107808346 13:44175547-44175569 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1109405844 13:61898894-61898916 TTGAAGAATGCAATGACTAGTGG - Intergenic
1110665874 13:78116770-78116792 AGGGAGAATGCAGTGACTGTGGG - Intergenic
1111494474 13:89030315-89030337 TGGCAGAGTGCATTGCATAGGGG - Intergenic
1112206662 13:97330418-97330440 AGGGAGGGTCCAGTGCCTAGTGG - Intronic
1112438488 13:99408356-99408378 TGGGAGAACCCAGTGACCAGCGG - Intergenic
1112944499 13:104910748-104910770 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1113897674 13:113776220-113776242 TGGGTGAGTGGAGCGACTTGGGG + Intronic
1115133883 14:30086206-30086228 AGGGAGAGCACAGTGACTGGGGG + Intronic
1116413091 14:44648980-44649002 AGGGAGAGTTCAGTGATTATGGG + Intergenic
1117161617 14:52995341-52995363 AGGGAGAGCACAGTGACTATGGG - Intergenic
1117384369 14:55195809-55195831 AGGGAGAGCGCAGTGACTGATGG - Intergenic
1121403456 14:93703153-93703175 TGGGAGTGTGCAGAGAGTCGGGG - Intronic
1121441986 14:93955284-93955306 TGGGAGAGTGCAGGGGCTGGTGG - Intronic
1121477057 14:94218565-94218587 TGTGCGCGTGCAGTGTCTAGGGG - Intronic
1125585427 15:40816021-40816043 CGGGAAAGTGCTGTGACTTGGGG - Intronic
1126277865 15:46905643-46905665 CAGGAGAGTGCAGTGTATAGGGG + Intergenic
1126452453 15:48823566-48823588 AGGGAGAATGCAGTGCCTTGGGG - Intergenic
1126838874 15:52696248-52696270 TGGGAGAGAGGAATGGCTAGAGG - Intronic
1127493203 15:59484558-59484580 AGGGAGAGTGCAGTGTTTATGGG + Intronic
1128561019 15:68667712-68667734 TGGGAGAGTGCACTGAAGATGGG + Intronic
1132451318 15:101970061-101970083 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
1135927486 16:26708352-26708374 TGGGAGAGGGCAGGGATTTGAGG - Intergenic
1136676615 16:31914175-31914197 ACGGAGAGCACAGTGACTAGGGG - Intronic
1138316833 16:56077530-56077552 ACGGAGAGAGCAGTGACCAGAGG + Intergenic
1138375997 16:56564575-56564597 GGGGAGGGTGCAGTCAGTAGAGG + Intergenic
1138509765 16:57501642-57501664 TGGCTGAGTGCAGTGAGGAGGGG + Intergenic
1139005041 16:62559487-62559509 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1142211235 16:88809620-88809642 TGGGCAACTGCAGTGACCAGGGG - Exonic
1144859538 17:18292229-18292251 TGGGAAACTGCAGTGACAGGGGG + Intronic
1145124777 17:20291235-20291257 TGGGAGAGGGCAGATTCTAGAGG - Intronic
1146794886 17:35773916-35773938 GGGCAGAGTGAAGTGTCTAGAGG - Intronic
1147458515 17:40553694-40553716 TGGGAGAGGGCAGGGAGGAGGGG + Intergenic
1148866086 17:50629402-50629424 TGGAAGAGGGCAGTGCCTGGAGG + Intergenic
1149249345 17:54750033-54750055 TGGGAGAGTGCAGTGATTGTGGG - Intergenic
1149599872 17:57886248-57886270 TGGTAGAGACCAGTGACTTGAGG - Intronic
1150125548 17:62632359-62632381 TGTGAGAGTGCAGAGCCAAGAGG - Intronic
1150555740 17:66252614-66252636 ACGGAGATTGCAGTGAGTAGAGG + Intronic
1150862270 17:68812804-68812826 TGGGAGAGGGGACTGACTAGAGG + Intergenic
1151094997 17:71486791-71486813 TGGCAGAGTGCAGAGATTAGAGG + Intergenic
1151455960 17:74225947-74225969 TGGGCGTGGGCAGTGACCAGAGG + Intronic
1151715331 17:75828120-75828142 GGGGAGAGGGCAGTGCCTGGTGG + Intronic
1152091558 17:78250390-78250412 TGGGCTGGTGCAGGGACTAGGGG + Intergenic
1152829021 17:82486037-82486059 TGGGAGAGAGCAGTGAGAGGTGG + Intronic
1153952587 18:10069681-10069703 TGGGAGAGGGCAGTGCTCAGAGG + Intergenic
1155845416 18:30699524-30699546 TGGAAGAGGGGGGTGACTAGAGG + Intergenic
1156561535 18:38130993-38131015 TGGGAGAGTTAATTCACTAGTGG + Intergenic
1156989526 18:43391677-43391699 TATGAGGGTGGAGTGACTAGTGG + Intergenic
1158123412 18:54075807-54075829 TGGGAGCGTTCAGTGATTTGAGG - Intergenic
1159564856 18:70036979-70037001 AGGGAGAGAGCAGCGACTGGGGG + Intronic
1160301933 18:77689734-77689756 CGTGAGACTGCAGTGCCTAGGGG - Intergenic
1160633945 19:62486-62508 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1162294909 19:9806721-9806743 TGGGAGAAGGCAATGATTAGGGG + Intergenic
1163840864 19:19608879-19608901 TTGGAGAGTGCGGTGACACGGGG - Intronic
1166580826 19:43897450-43897472 GTGGAGAGTGTAGTGACAAGAGG - Intronic
1167578840 19:50330516-50330538 TGGGAGAGGGCACTGCCTAAAGG + Intronic
925588470 2:5486942-5486964 AGAGAGAGTGCAGTGATTATGGG + Intergenic
929011119 2:37446066-37446088 TGGCAGAGTGCAGGGGCTGGGGG + Intergenic
929268536 2:39946309-39946331 TGGGAGAGTTAAGTGACAAATGG - Intergenic
930439784 2:51391220-51391242 AGGGAGAGTACAGTGACTGGGGG - Intergenic
932220979 2:69998834-69998856 TGGGAGAGGGCACTGGCTAGAGG + Intergenic
932389408 2:71372450-71372472 AGGGACAGCGCAGTAACTAGGGG - Intronic
932517456 2:72367732-72367754 AGGGAGAGTGCAGCAACTGGGGG + Intronic
932589776 2:73058419-73058441 TGGGGGAGTGAAGAGAATAGGGG - Intronic
934777228 2:96947182-96947204 AGGGAGGGTGCAGCCACTAGGGG + Intronic
934928862 2:98404045-98404067 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
935437954 2:103056898-103056920 AGGGAGAGTGCCGTGACTAGGGG - Intergenic
936567533 2:113592542-113592564 TGGGAGTGTGCAGAGACTGGAGG + Intergenic
937613670 2:123893905-123893927 AGGGAGAGTGCAGATACTGGGGG - Intergenic
938587636 2:132707207-132707229 GGGGAAAGTGCAGTGACTGTGGG + Intronic
939092973 2:137800176-137800198 TGGGAGGGTCCAGGGACCAGGGG + Intergenic
939708027 2:145479185-145479207 AGGAAGACTGCAGTGACTAAGGG - Intergenic
939909415 2:147962445-147962467 TGGAAAGGTGCAGTGACTACTGG - Intronic
940007722 2:149023372-149023394 TGGGACAGTGCACTGCCCAGAGG - Exonic
941047642 2:160694739-160694761 AGGGAGAGTGCAGTGACTGGTGG - Intergenic
942881796 2:180870665-180870687 AGGGAGAGTGCAGTGACTGTGGG + Intergenic
943099656 2:183472223-183472245 AGGGAGAGTGCAGTGACTATGGG - Intergenic
943385265 2:187195917-187195939 TGGAAGTGTATAGTGACTAGGGG - Intergenic
943867047 2:192938491-192938513 AGGGAGAGTGCAGTGACTGAGGG - Intergenic
944427437 2:199598167-199598189 AGGGCTAGTGCAGTAACTAGGGG - Intergenic
944616548 2:201465909-201465931 AGGGAGAGTGCAGTGATTGTGGG - Intronic
944660450 2:201917213-201917235 AGGGAGAGTGCAGACATTAGTGG + Intergenic
944760240 2:202807310-202807332 AGGGAGAGTGCAGTGATTGTGGG + Intronic
946507612 2:220318271-220318293 TAGGAGACTGCAGAGGCTAGAGG + Intergenic
947126818 2:226877849-226877871 GTGAAGAGTGCAGTGACTATTGG + Intronic
947326501 2:228984440-228984462 TGGGAGAGTGGAGTATCCAGTGG - Intronic
948765083 2:240215430-240215452 TGGGCTGGTGCAGTGACCAGGGG - Intergenic
948774555 2:240277081-240277103 AGGGAGAGAGCAGTGACTGTGGG + Intergenic
1169390024 20:5182853-5182875 TGGGAGAGCTCACTCACTAGTGG + Intronic
1170668266 20:18405886-18405908 AGGGAGAGCACAGTGACTGGGGG + Intronic
1171819704 20:29823564-29823586 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1171898116 20:30829615-30829637 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1172980390 20:38937269-38937291 TGGGAGAGTGCCATGACTGTGGG + Intronic
1173181128 20:40807115-40807137 TGGGAGAGGGCTGGGACCAGGGG - Intergenic
1174253199 20:49234724-49234746 AGAGAGAGTGCAGGGACGAGGGG - Intronic
1175269428 20:57723438-57723460 GGGGAGAAGGCAGAGACTAGAGG + Intergenic
1176290826 21:5043726-5043748 TGGGAGAATGCAGTGAGGAAGGG + Intergenic
1178134558 21:29612473-29612495 GGGGAGAGTTGTGTGACTAGAGG - Intronic
1178535349 21:33405536-33405558 TGCCAGAGAGGAGTGACTAGTGG + Intronic
1178833413 21:36075507-36075529 TAGGAGAGTGAATTTACTAGGGG - Intronic
1178844136 21:36160403-36160425 TTGGAGGGTGCAGTGACAAGTGG + Intronic
1179038434 21:37780584-37780606 TGGGGGAGTGCAGGTAATAGGGG + Intronic
1179242540 21:39604868-39604890 TGGGACAGTGAGGTGACAAGAGG + Intronic
1179866429 21:44219915-44219937 TGGGAGAATGCAGTGAGGAAGGG - Intergenic
1179979950 21:44890655-44890677 TGGGAGAATGCAGGGACAAGGGG + Intronic
1180071255 21:45436828-45436850 TGGGGGAGTGCCGTGCCTGGGGG + Intronic
1180323704 22:11348255-11348277 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1183096721 22:35556479-35556501 TGGGAGAGTCCAGTGAGTTGGGG + Intergenic
1183475525 22:38033984-38034006 TGGGATGGTGCAGGGAATAGGGG - Intronic
949510134 3:4760135-4760157 TAGGAGAGGTCAGTGACTTGTGG - Intronic
950202843 3:11057068-11057090 GGGGAGAGTGCAGTGGCCAAAGG - Intergenic
952598157 3:35044190-35044212 TGGGAGAGTTGAGTGAGAAGAGG - Intergenic
953019688 3:39105544-39105566 TAGGAGAGGGCAGTGGTTAGGGG - Intronic
953165199 3:40458745-40458767 TGGGAGGGAGGAGTGATTAGTGG - Intronic
954415680 3:50392195-50392217 GGGGAGGGTGCAGGGACTTGAGG - Intronic
954493591 3:50930942-50930964 CAGGAGAGGGCAGTGACTTGGGG + Intronic
955343621 3:58144571-58144593 TGTGAGTGTGAGGTGACTAGGGG - Intronic
955506287 3:59636321-59636343 TGGGAGACTGCTGTGACCACAGG + Intergenic
958677495 3:97285361-97285383 TGGGAGAGAGCAATGAAGAGAGG - Intronic
959191072 3:103112399-103112421 AGGGAGACTGCAGTGACTGGGGG + Intergenic
960723423 3:120646737-120646759 TAGGAAAGTGCAATGACAAGTGG + Intronic
961649061 3:128408454-128408476 TGGGAGTGTGCAGGGGCTGGAGG - Exonic
961959175 3:130836160-130836182 TGGCAGATGGTAGTGACTAGAGG + Intergenic
961964544 3:130888635-130888657 AGGGAGAGTGCAGTGGCTAGTGG - Intronic
962812531 3:138971996-138972018 TGGCAGAGGTCAGTGACTGGAGG - Intergenic
963115655 3:141726882-141726904 TGGCTGGGTGCAGTGGCTAGTGG - Intergenic
963820502 3:149887170-149887192 AGCGAGAGCACAGTGACTAGAGG + Intronic
964164379 3:153684533-153684555 TGGGAGTGTGGAGAGACTATTGG + Intergenic
964823263 3:160796941-160796963 TGGGAGAGTGGTGTGACATGAGG - Intronic
966410684 3:179643196-179643218 TTGGAGAGCACAGTCACTAGAGG - Intergenic
967231685 3:187343554-187343576 TGGGAGAGGGCTGTGATTACAGG + Intergenic
967257534 3:187609120-187609142 TGGGAGAGGGCTGTGACTACTGG - Intergenic
970368813 4:15387579-15387601 AGGGGGATTCCAGTGACTAGTGG + Intronic
970963233 4:21897959-21897981 AGGGAAAGTGCAGTGATTATGGG + Intronic
971312149 4:25534488-25534510 GTGGAGATTGCAGTGAATAGAGG + Intergenic
971504745 4:27354014-27354036 TGGAGGACTGCAGTGACTCGGGG - Intergenic
972278568 4:37582066-37582088 AGGGAGAGTACAGTGATTTGGGG - Intronic
974456194 4:62131478-62131500 TGGGGGGGTGCAGTGTCTTGGGG - Intergenic
976578004 4:86698824-86698846 TGGGAGATAGCAGTAGCTAGGGG + Intronic
977325803 4:95573082-95573104 AAGGAAAGTGCAGTGACTGGAGG - Intergenic
979540766 4:121878792-121878814 TAGGAAAGAGCAGTGACTATGGG - Intergenic
981871197 4:149487737-149487759 AAGGAGAGTGCAGTGACTAGGGG - Intergenic
981874187 4:149520886-149520908 TGAGAGAGTGCAGTTCCTATTGG - Intergenic
981996046 4:150976809-150976831 TGGGAGAGTGCAGCGACTGTGGG + Intronic
982358392 4:154492492-154492514 TGGCAGAGGGGAGTGACAAGAGG - Intergenic
982683486 4:158459943-158459965 AAGGAGAGTGCAGTGGCTGGGGG - Intronic
983111165 4:163751205-163751227 TTGGAGAGTGCAGTAACTACAGG + Intronic
983657851 4:170101030-170101052 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
986085203 5:4437945-4437967 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
986631304 5:9776246-9776268 AGGGAGAGTGCAGTGACTACAGG - Intergenic
986992596 5:13571403-13571425 TGGGAGAGTGAGGAGATTAGGGG + Intergenic
987616003 5:20275877-20275899 AGGGAGAGTGCAGTGATTTGGGG + Intronic
987645777 5:20671244-20671266 AGGGAGAGTGAAGTGACTGTGGG + Intergenic
989134975 5:38144699-38144721 TGGGAGAATGCTGTGACAAGGGG + Intergenic
990827817 5:59922044-59922066 AGGGAGAGTGCAGCGACTGGGGG + Intronic
991209249 5:64085212-64085234 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
992311811 5:75509608-75509630 TGGGGGAGTGGAGTGACCGGGGG - Intronic
993060168 5:83029486-83029508 GGGGAGAGTGCAGTGATTGTGGG + Intergenic
993279264 5:85904750-85904772 AGGGAAAGTGCAGTGACTGAGGG + Intergenic
993287454 5:86017133-86017155 ATGGAGAGTACAGTGACTGGAGG - Intergenic
994245666 5:97472245-97472267 TGGGTGAGAGCAGTGACATGGGG + Intergenic
994279114 5:97878796-97878818 TGGGAGAGTGTCCTGACCAGAGG + Intergenic
994349926 5:98733611-98733633 TGAGAGACTGCAGTAACAAGTGG - Intergenic
994539332 5:101075115-101075137 TGGTTGAGTGCAGTCACTTGGGG - Intergenic
995042306 5:107602858-107602880 TAGAAGAGCACAGTGACTAGAGG + Intronic
995290372 5:110444374-110444396 AGGGAGAGCTCAGTGACTGGGGG - Intronic
995310695 5:110707348-110707370 AGGGAGAGTGCAGTAACTGCAGG + Intronic
996459424 5:123724728-123724750 AGGGAGAGTGCAGCGACCGGGGG + Intergenic
999559448 5:152785117-152785139 AGGGAGAGTGCACTGACTGTGGG + Intergenic
1000699118 5:164426175-164426197 TGGGTGAGTGCAGAGGGTAGGGG + Intergenic
1001484994 5:172113281-172113303 TGGGTGTGTGCAGTGAGTTGGGG - Intronic
1004619298 6:17319350-17319372 TGAGAGGGGGCGGTGACTAGGGG + Intergenic
1005071252 6:21863945-21863967 TTGGAGGTTGCAGTGAGTAGAGG + Intergenic
1006337143 6:33426767-33426789 TGGAAGGGGGCAGTGACGAGGGG - Intronic
1007168632 6:39846978-39847000 TGGGATGGGGCAGTAACTAGGGG - Intronic
1009781674 6:68279682-68279704 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1010088564 6:71951746-71951768 TGGGAGAGTGCTGGGATTTGAGG - Intronic
1011195706 6:84777204-84777226 TGGGAGAGAGCAGTGAGTGCTGG + Intergenic
1012305953 6:97657537-97657559 TGGGAGAGTGCATTGCTTTGTGG + Intergenic
1013174392 6:107664846-107664868 TGGGAGTGTGCAGTGAAGTGTGG - Intergenic
1013621162 6:111890881-111890903 GGAGAGAGGGCAGTAACTAGAGG - Intergenic
1015578934 6:134702470-134702492 AGAGAGAGTGCAGTGACTGTGGG - Intergenic
1015856976 6:137635402-137635424 TGGGAGTGTCCAGTGAAAAGTGG + Intergenic
1019922986 7:4174615-4174637 CGGTAGAGTGCAGTCACTGGAGG - Intronic
1020447313 7:8282822-8282844 TGGGAGTTTCCAGTGACTAGTGG + Intergenic
1021123629 7:16825635-16825657 AGGGAGAATGCAGTGATTATGGG + Intronic
1023035691 7:36129508-36129530 TGACAGAGTGCAGGGACAAGGGG - Intergenic
1024115126 7:46185480-46185502 TGGGAGAGTGAAGTGACTCCAGG - Intergenic
1024562756 7:50658327-50658349 GGGGAAAGTGCATTGTCTAGTGG + Intronic
1024705956 7:51959785-51959807 AGGAAGAATGCAGTGACTGGGGG - Intergenic
1024956469 7:54926456-54926478 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1025637435 7:63335331-63335353 TGGGTGAGTGCAGTTTTTAGAGG + Intergenic
1025645262 7:63412768-63412790 TGGGTGAGTGCAGTTTTTAGAGG - Intergenic
1026374101 7:69732905-69732927 TAGGAGAGTAGAGTGCCTAGTGG + Intronic
1026404185 7:70047993-70048015 TGGGAGAGTGTCTTGGCTAGAGG + Intronic
1027523955 7:79244451-79244473 AGGGAGAGTGCAGTGATTGTGGG + Intronic
1027934456 7:84585552-84585574 TGGAAGAGTGCAGGGATTAAGGG + Intergenic
1029042610 7:97593395-97593417 AGGGAGAGTGCAGTGGCTGTGGG - Intergenic
1030071824 7:105704675-105704697 CGGGAGGTTGCAGTGAGTAGAGG - Intronic
1030629332 7:111878661-111878683 TAGGATAATGCAGTGACTTGGGG + Intronic
1030972829 7:116081568-116081590 TTGGAGAGAGCAGTTACCAGCGG - Intronic
1031243857 7:119281647-119281669 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1031753665 7:125611459-125611481 AGAGAGAGTGCAGTGATTATGGG + Intergenic
1031862198 7:126993674-126993696 AGGGAGAGCACAGTGACTGGGGG + Intronic
1032437385 7:131911196-131911218 TGGGACAGTGGAGTGAAGAGCGG - Intergenic
1033542474 7:142369605-142369627 AGGGAGAGTGCAGTGACTGTGGG - Intergenic
1033804467 7:144938013-144938035 TGTGGGATGGCAGTGACTAGGGG - Intergenic
1033877773 7:145843225-145843247 AGGGAGAGTGCAGTGATTGTGGG - Intergenic
1033950115 7:146774285-146774307 TGGGGGAGTCCAGAGACAAGTGG - Exonic
1034348452 7:150401341-150401363 GGGTAGACTGCAGTGACCAGAGG + Intronic
1034473438 7:151268972-151268994 TGAAAGAGTGAAGTGACTGGGGG - Intronic
1034847914 7:154464261-154464283 AGGGAGAATGCAGTGACTGTGGG - Intronic
1035343143 7:158177523-158177545 TGGGAGAGGGCAGTGTCTCCAGG - Intronic
1037751228 8:21683670-21683692 TGGGAGGCTGCAGTGACATGAGG - Intergenic
1037902115 8:22694501-22694523 AGGGGGAGGGCAGAGACTAGGGG - Intergenic
1038351192 8:26777771-26777793 TGGGAGGGTACAGTGAGTAAGGG + Intronic
1038921714 8:32092176-32092198 TGGCAGGGTGCAGTGGCTCGTGG + Intronic
1041301262 8:56414358-56414380 TGGGAGAATGAGGTGACCAGTGG + Intergenic
1041744881 8:61197878-61197900 AGGGAGAGAACAGTGACTATAGG - Intronic
1043079972 8:75754838-75754860 AGGGAGAGTGCAGTGACTATGGG + Intergenic
1044424820 8:92038838-92038860 TGGGAGAGTGAAGCCCCTAGAGG - Intronic
1044497327 8:92902383-92902405 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1045547347 8:103140712-103140734 TGGGAGAGGGCCCGGACTAGGGG + Exonic
1047364988 8:124203500-124203522 TGGTATAGTACAGTGGCTAGGGG - Intergenic
1049174390 8:141182712-141182734 TGTGAGATTGCAGGGACAAGAGG + Intronic
1049454156 8:142678541-142678563 GGGGAGAGCACAGTGACCAGAGG + Intronic
1049818170 8:144618220-144618242 TGGGAGAGGGCGGGGACAAGGGG - Intergenic
1049885000 9:20991-21013 TGGGAGTGTGCAGAGACTGGAGG - Intergenic
1050248062 9:3713005-3713027 TGGAAGAGTGCAGTGACTGGGGG + Intergenic
1051345609 9:16148094-16148116 AGGGAGAGTGCAGTGGGTGGGGG + Intergenic
1051464941 9:17367190-17367212 AGGGAGAATGCAGTGACTGTTGG + Intronic
1052169556 9:25376970-25376992 TGGGTGGGTGCAGGGACTGGGGG - Intergenic
1052367896 9:27633853-27633875 TGGGAGATTGCAGTGGCAAAGGG - Intergenic
1052938801 9:34115634-34115656 GGGGAGACTGCAGAGACTATAGG - Intronic
1053197995 9:36135199-36135221 TGGGAGAGGGAATTGAATAGAGG + Intergenic
1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054256202 9:62815755-62815777 AGGGAGAGCACAGTGACTGGAGG + Intergenic
1054335103 9:63799859-63799881 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1055381393 9:75710814-75710836 TGGGACAGTGGAGATACTAGAGG - Intergenic
1056739116 9:89237467-89237489 TGGCAGAGTGCAGAGAGGAGAGG - Intergenic
1058285363 9:103170065-103170087 AGGGAGAGGGCAGTGACTGTGGG - Intergenic
1058486599 9:105448117-105448139 TGGGGCAGTGCAGTGAGTAGCGG + Exonic
1059555600 9:115277131-115277153 AGGGAGAGTGCAGTGATTGTGGG - Intronic
1062097288 9:134709938-134709960 TGGGAGGGTCCAGTGGCTGGGGG + Intronic
1062306847 9:135912127-135912149 GGGGAGAGTCCAGGGACCAGAGG + Intergenic
1062318440 9:135979176-135979198 TGGTAGAGTTCAGTGACATGTGG - Intergenic
1062354315 9:136154512-136154534 TGGGAGAGCGGAGAGACTGGAGG - Intergenic
1203371376 Un_KI270442v1:308829-308851 AGGGAGAGCACAGTGACTGGAGG - Intergenic
1186507325 X:10103518-10103540 GGGGAGAGAGCAGTGGCAAGTGG + Intronic
1187284781 X:17894545-17894567 TGAGAGAATGCAGTGATTTGGGG - Intergenic
1188162001 X:26815412-26815434 AGGGAGAGTGCAGTGATTGTAGG - Intergenic
1188651420 X:32635146-32635168 AGGGAGATTGCAGTGATTATAGG - Intronic
1188897346 X:35685821-35685843 AGGGAGATAGCAGTGACTGGGGG + Intergenic
1190171321 X:48114496-48114518 GGGGAGATTGCAGTGAGCAGAGG + Intergenic
1190374467 X:49775451-49775473 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1191197061 X:57736027-57736049 TGGGAGAGTTTAGTGACTGGGGG + Intergenic
1192793302 X:74405735-74405757 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1193896935 X:87126496-87126518 AGGGAGAGTGCAGTGATTATGGG + Intergenic
1194388930 X:93292459-93292481 AGGGAGAATGCAGTGACTGGGGG + Intergenic
1194526369 X:94982843-94982865 TGGGAAAGTGCAGTGACTGTGGG + Intergenic
1194842077 X:98754821-98754843 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1195489469 X:105450215-105450237 AGGGCGAGTGCAGTGACTTGGGG - Intronic
1195595331 X:106682705-106682727 AGGGAGAGTGCAGTGATTGTGGG + Intergenic
1196357470 X:114810559-114810581 AGGGAGAATGCAGTGACTGTGGG - Intronic
1196485704 X:116204163-116204185 AGGGAGAGTGCAGCAACTGGGGG - Intergenic
1197099676 X:122637407-122637429 AGGGAGAGCGCAGTGACTGTGGG - Intergenic
1197375882 X:125681738-125681760 AGTGAGAGTGCAATGACTGGAGG + Intergenic
1197457903 X:126700979-126701001 AGGGAGAGCACAGTGACTGGGGG + Intergenic
1197623650 X:128779835-128779857 AGGGAGAGCACAGTGACTGGGGG - Intergenic
1197887222 X:131231126-131231148 TGGGAGAGCGGAGTGATTGGAGG + Intergenic
1198156001 X:133961454-133961476 TGGGAGAGTGTAGTGATCTGGGG - Intronic
1198640225 X:138748048-138748070 TGGAGCAGTGCAGGGACTAGTGG - Intronic
1198761890 X:140040932-140040954 AAGGAGAGCTCAGTGACTAGGGG - Intergenic
1198770683 X:140126903-140126925 AGGGAGAGTGTAGTGACTAGGGG - Intergenic
1199025753 X:142935455-142935477 TTAGAGGGTGCAATGACTAGAGG - Intergenic
1199158080 X:144573157-144573179 TGGCAGAGGTCAGTAACTAGTGG - Intergenic
1199325091 X:146489933-146489955 AGGGAGAGTACAGTGACTGAGGG + Intergenic
1199393177 X:147305732-147305754 AAGGACAGTGCAGTGACTTGGGG + Intergenic
1200069789 X:153522509-153522531 TGGGACAGTGCAGAGACTCCGGG + Intronic