ID: 1097900435

View in Genome Browser
Species Human (GRCh38)
Location 12:64867625-64867647
Sequence ATATGCCAGGGTCTGTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 1, 2: 11, 3: 95, 4: 619}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097900435_1097900439 25 Left 1097900435 12:64867625-64867647 CCTTAGCACAGACCCTGGCATAT 0: 1
1: 1
2: 11
3: 95
4: 619
Right 1097900439 12:64867673-64867695 GAGTTTAATTTATTCCAGACTGG 0: 1
1: 0
2: 0
3: 20
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097900435 Original CRISPR ATATGCCAGGGTCTGTGCTA AGG (reversed) Intronic
900813060 1:4822611-4822633 TTATGCCACGGTCTCTGCTCGGG - Intergenic
901405360 1:9041445-9041467 GTGTGCCAGGCTCTGTGCTTGGG - Intronic
901909061 1:12439688-12439710 ATTTGCCAGGCACTGTTCTAAGG - Intronic
902115774 1:14119885-14119907 ATGTGCCAGGCACTGTTCTAAGG + Intergenic
902187584 1:14736891-14736913 GTATGCCAGGTGCTGTTCTAAGG + Intronic
902541433 1:17158355-17158377 ATGTGCCAGGCTCTGTGCTGGGG + Intergenic
902733698 1:18386197-18386219 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
903052082 1:20608948-20608970 GTGTGCCAGCCTCTGTGCTAAGG - Intronic
903116385 1:21181873-21181895 ATGAGCCAGGGACTGAGCTAAGG - Intergenic
903227583 1:21902396-21902418 TTGTGCCAGGGGCTGAGCTAAGG + Intronic
903231333 1:21924132-21924154 AAGTGCCAGGCTCTGGGCTAGGG - Intronic
903460547 1:23517588-23517610 ATATGCCAGGCTCTGGGCAAGGG + Intronic
903566120 1:24266937-24266959 ACAGGCCAGGCCCTGTGCTACGG - Intergenic
904052913 1:27651004-27651026 ATGTGCCAGGCCCTGTGCTAGGG + Intergenic
904383153 1:30124961-30124983 ATGTGCCAAACTCTGTGCTAAGG - Intergenic
904416209 1:30362518-30362540 GTGTGCCAGGCACTGTGCTAAGG + Intergenic
904542274 1:31240887-31240909 ATGTGCCAGGTTCTCTGCTGGGG + Intergenic
904717136 1:32476905-32476927 ATGTGTCAGGCTCTGTTCTAGGG - Intronic
904972403 1:34429306-34429328 ATGTGCCAGCCTCTGTTCTAAGG - Intergenic
905034966 1:34912152-34912174 ATGTGCCAGGGACAGTTCTAAGG - Intronic
905273494 1:36802127-36802149 TTCTCCCAGAGTCTGTGCTAAGG + Intronic
905342698 1:37290127-37290149 ATAGGCCAGGTTTTGTGCTAGGG + Intergenic
905479485 1:38251318-38251340 ATGTGCCAGGCTCTGTGTGAGGG + Intergenic
906280367 1:44549288-44549310 ATATGCAAGGCATTGTGCTAGGG - Intronic
906728317 1:48059996-48060018 GTATGCCCAGGTCTGTGTTAGGG - Intergenic
906865206 1:49410886-49410908 ATATGCCAGATGCTGTACTAAGG + Intronic
906935089 1:50207772-50207794 ATATGCCAGATACTGAGCTAGGG + Intergenic
907049349 1:51319097-51319119 ACATGCCAGGCACTGTCCTAAGG + Intronic
907381514 1:54094693-54094715 ATGTGCCAGGCTCTGTGCTTGGG - Intronic
907476256 1:54707685-54707707 GTATGTCAGGGCCTGTGCTGGGG + Intronic
907490874 1:54808035-54808057 GTATGCCAGGCTCTCTGCTTGGG - Intronic
907944984 1:59127735-59127757 GTTTGCCAGGCACTGTGCTATGG + Intergenic
908295327 1:62707144-62707166 GTATGCCAGGGTTTGTGCTAGGG + Intergenic
908577217 1:65473125-65473147 CTGTGCCAGGGTCTGTGCCAAGG + Intronic
909145965 1:71931761-71931783 ATATGTCAGGAATTGTGCTATGG - Intronic
910068163 1:83178966-83178988 ATGTGCCAGGTGCTGTTCTAAGG + Intergenic
910466394 1:87504836-87504858 ATGTGCCAGGTACTGTGCCAAGG - Intergenic
910566820 1:88653111-88653133 AAATGCCAGGCACTGTACTACGG - Intergenic
911051135 1:93672510-93672532 AGATGCCAGGCTGTGTGATACGG - Intronic
912323527 1:108736889-108736911 ATGTGCCAGGCACTGTTCTAAGG + Intronic
912858984 1:113196241-113196263 AAGTGCCAGGCTCTGTGCTAGGG - Intergenic
913958102 1:143321314-143321336 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
914052417 1:144146689-144146711 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
914126780 1:144819852-144819874 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
914506247 1:148291750-148291772 ATGTGCCAGGTACTGTGCTAAGG - Intergenic
915622819 1:157096372-157096394 ATTTGCCAGGCACTGTCCTAGGG - Intronic
915910920 1:159914839-159914861 ACATACCAGGGTCTGTGGTCGGG + Intergenic
916211448 1:162363347-162363369 ATAGGGCAGGGTCTGTGGGAAGG + Intronic
916743202 1:167663862-167663884 ATGTGCCAGGCACTGTGCTGGGG + Intronic
916866169 1:168861381-168861403 ATGTGCCAGGCCCTGTACTAAGG + Intergenic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
918370969 1:183861150-183861172 ATATGCCAGGTACTGTGCTAAGG - Intronic
920058574 1:203211954-203211976 ATGTGGCAGGAGCTGTGCTAGGG - Intergenic
920926730 1:210348533-210348555 ACATCCCAGGCACTGTGCTAGGG + Intronic
921000969 1:211042395-211042417 ATATGCCAGGCCTTGTGTTAAGG - Intronic
921353703 1:214264167-214264189 ATATGCCAGGTGCTGTTTTAGGG - Intergenic
921527638 1:216237698-216237720 GTGTGCCAGGCTCTGTGATAAGG - Intronic
921618264 1:217297464-217297486 GTTTGCCAGGCACTGTGCTAGGG + Intergenic
921816004 1:219564138-219564160 ATCTTCCAGGGTCGGTGCTAGGG + Intergenic
921839796 1:219816094-219816116 ATATGCCTGGTGCTATGCTAGGG - Intronic
922187967 1:223293169-223293191 ATAACCCAGGGTCTATGGTAGGG + Intronic
923081566 1:230661608-230661630 ATGTGCCAGGGACTGTCTTAGGG - Intronic
923852030 1:237806560-237806582 ATGGGCCAGGGGCTGTGTTAAGG - Intronic
924025138 1:239824232-239824254 AGATGCCATGGTGTGAGCTACGG + Intronic
924588878 1:245384331-245384353 ATATGCCAGGCACTGTGCTGAGG + Intronic
924946677 1:248851213-248851235 AGGTGCCAGGGTCTGTCCTTGGG - Intronic
1063369148 10:5509529-5509551 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1063410701 10:5834447-5834469 ACGTGCCAGGGACTGTGCTCAGG + Intronic
1063411452 10:5839756-5839778 ACGTGCCAGGGACTGTGCTCAGG - Intronic
1064105980 10:12501522-12501544 GTATGCACGGCTCTGTGCTAGGG + Intronic
1065678437 10:28203906-28203928 ATGTGACAGGGACTGTTCTAAGG - Intronic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1065888415 10:30099506-30099528 ATGTTCCAGGCACTGTGCTAGGG + Intronic
1066438979 10:35419462-35419484 ATGACCCAGGGTATGTGCTAGGG + Intronic
1066962048 10:42233497-42233519 ATACGACCAGGTCTGTGCTAGGG + Intergenic
1066966811 10:42274553-42274575 ATATGCCAGAGAGAGTGCTAAGG - Intergenic
1067236986 10:44459295-44459317 AAAGGCCAAGGTCTCTGCTAGGG - Intergenic
1068047336 10:51903979-51904001 ATTTGCCAGGCACTGAGCTAAGG - Intronic
1068581702 10:58748212-58748234 ATATGCCAGGCAGTGTTCTAGGG + Intronic
1068661663 10:59628959-59628981 AAGTGCCAAGCTCTGTGCTAAGG + Intergenic
1069183885 10:65397726-65397748 ATATGACAGGCGCTGTCCTAAGG - Intergenic
1069584858 10:69592522-69592544 ATGTTCCAGGTTCTCTGCTAAGG + Intergenic
1070674469 10:78402829-78402851 ACATGACAGGGTCTTTGCAAAGG - Intergenic
1071930321 10:90462380-90462402 GTATTCCAGGTGCTGTGCTAAGG + Intergenic
1072223366 10:93346490-93346512 ATGTGCTAGGGACTGTGTTAGGG - Intronic
1072574438 10:96687340-96687362 ATGGACCAGGCTCTGTGCTAGGG - Intronic
1072802292 10:98400685-98400707 CCATGCCAGGGACTGTACTAGGG + Intronic
1072962806 10:99944616-99944638 ATGTGCCAGGCACTGTGCTAAGG - Intronic
1073029672 10:100515601-100515623 ACATGCCAGACACTGTGCTAGGG - Intronic
1073824979 10:107310427-107310449 ATGTACCAGGGACTGTGCTATGG + Intergenic
1074424580 10:113339597-113339619 ATGTGCTAGGCTCTGAGCTAAGG - Intergenic
1075246567 10:120827600-120827622 ATAAGCCAGGTGCTGTGCTCAGG - Intergenic
1075484532 10:122811406-122811428 CTGTGCCAGGGACTGTGCCAGGG - Intergenic
1075512161 10:123081350-123081372 ATAGGCCAAGGCCTCTGCTATGG + Intergenic
1075539775 10:123302397-123302419 TTGTGCCAGGCACTGTGCTAAGG - Intergenic
1076248725 10:128967679-128967701 ATATTCTAGGGTCTGTGTTCAGG - Intergenic
1077605792 11:3610846-3610868 TTGTGCCAGGCTCTGTGCTAGGG + Intergenic
1077747016 11:4918035-4918057 ATTTGCCAGGCTCTGTATTAGGG + Intronic
1077901112 11:6489542-6489564 ATATGCCAAGCACTGTGATAAGG - Intronic
1078444700 11:11395419-11395441 ATGTAGCAGGGCCTGTGCTAGGG + Intronic
1078659344 11:13274509-13274531 GTATGCCAGGCACTGTGTTAAGG + Intergenic
1078746540 11:14120771-14120793 GTGTGCCAGGAACTGTGCTAAGG + Intronic
1079025014 11:16940183-16940205 ATGTGCCAGCCACTGTGCTAGGG - Intronic
1079141442 11:17812764-17812786 ATATGCCAGGCTCTCTACTGGGG - Intronic
1079331275 11:19534996-19535018 ATGTCCCAGGCACTGTGCTAAGG - Intronic
1079335811 11:19569624-19569646 ATGTACCAAGCTCTGTGCTATGG - Intronic
1079621576 11:22562023-22562045 CTGTGCCAGGTACTGTGCTAAGG + Intergenic
1080646022 11:34188291-34188313 ACATGCCTGGGACTGTGCTGAGG + Intronic
1080791716 11:35527350-35527372 ATGTGGTAGGCTCTGTGCTATGG - Intronic
1081333351 11:41831907-41831929 ATATTCCAGATTCTGTGGTAAGG + Intergenic
1081343122 11:41951651-41951673 ATGTGCCAGGCTCTGTTCTAAGG + Intergenic
1081737550 11:45414491-45414513 AAATGCCAGGCTCTGTGCTGAGG + Intergenic
1081855216 11:46298845-46298867 ATGTGCCAGGGACTGTTATAAGG + Intronic
1081920376 11:46769766-46769788 TTATGCCAGGAACTGTACTAAGG - Intronic
1082088415 11:48068900-48068922 ATATACCAGGCTGTGTGCAAAGG - Intronic
1082928048 11:58571743-58571765 ACATGCCAGGCACTGTGCTCAGG + Intronic
1083705549 11:64511930-64511952 AGATGCCAGGGACTGGGCCAAGG - Intergenic
1084120260 11:67065004-67065026 TTATGCCAGGCCCTGAGCTAAGG + Intronic
1084551810 11:69848205-69848227 ATGTGCCAGGCTCTGTGCCAGGG + Intergenic
1084641687 11:70430076-70430098 AGATGCCAGGAACCGTGCTAGGG + Intronic
1084712995 11:70855671-70855693 ACATGCCAGGCCCTGTGCCATGG - Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085063755 11:73473089-73473111 ATGTGACAGGTACTGTGCTAAGG + Intronic
1085215107 11:74822886-74822908 GTATGCCAGGCACTGTGTTAGGG + Intronic
1085295077 11:75426911-75426933 GTGTGCCAGGCTCTGTGCTCAGG + Intronic
1085389077 11:76173038-76173060 TTGTGCCAGGCTCTGCGCTAGGG - Intergenic
1085440732 11:76560161-76560183 CCATGCCAGGGCCTGTTCTAAGG - Intergenic
1085717164 11:78882465-78882487 TTGTGCCAGGCTTTGTGCTAGGG + Intronic
1086464171 11:87036929-87036951 ATTTACCAGGCACTGTGCTAAGG - Intergenic
1086961810 11:92985600-92985622 ATATGCCAGGCACTGTTCTAAGG + Intergenic
1086998600 11:93389561-93389583 ATGTGCCAGGAACTGTTCTAAGG + Intronic
1087061145 11:93978835-93978857 ATGTGTCAGGTTCTGTTCTAGGG - Intergenic
1087696262 11:101379725-101379747 ACATTCCAGGGTCTGTGATGTGG + Intergenic
1087855379 11:103086333-103086355 ATATACCAGGTATTGTGCTAAGG + Intronic
1088641795 11:111879775-111879797 ATATGGCAGGGTGTGTGCTCTGG + Intronic
1088970229 11:114768030-114768052 ATGTTCCAGGTTCTTTGCTAGGG - Intergenic
1089181585 11:116586984-116587006 ATGTGCCAGGAACTGTGCTAAGG - Intergenic
1089254162 11:117185404-117185426 ATATGCCAGGTGGTATGCTAAGG + Intronic
1089617413 11:119702763-119702785 ATATGCCAGGGTCAGCTCTCAGG - Intronic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1090491500 11:127165492-127165514 ATATACTAGGGTCTGAGCTCAGG - Intergenic
1091878529 12:3957704-3957726 ATGTGCCAGGGATTGTGCTAAGG - Intergenic
1092289751 12:7152681-7152703 ATGTGCCAGGCACTGTGCTCGGG + Intronic
1092394077 12:8109743-8109765 ATATTCCAGGCCCTGTTCTAGGG - Intergenic
1093348155 12:18065850-18065872 ATGTGCCAGACACTGTGCTAAGG + Intergenic
1093566624 12:20613969-20613991 ATATGCCAGGCGCTTTTCTAAGG + Intronic
1094639595 12:32261199-32261221 ATGTGCCAGACCCTGTGCTAGGG + Intronic
1096240962 12:49960195-49960217 CTGTGCCAGGCACTGTGCTAAGG + Intergenic
1096558104 12:52416321-52416343 CAATGCCAGGGTCTGTTCCAGGG - Intergenic
1097283807 12:57862588-57862610 ATATGCCAGGCACTGTGAAAGGG + Intergenic
1097636639 12:62130625-62130647 ATGTGGCAGGCACTGTGCTAGGG + Intronic
1097900435 12:64867625-64867647 ATATGCCAGGGTCTGTGCTAAGG - Intronic
1098324544 12:69287996-69288018 AGATGTCAGGCACTGTGCTAGGG + Intergenic
1099346177 12:81502643-81502665 ATGTGCTAGGAACTGTGCTAGGG + Intronic
1099705246 12:86143984-86144006 ATGTGCTAGGCACTGTGCTAGGG - Intronic
1100233122 12:92630409-92630431 ATATGCCAGGCACTGAGCTATGG + Intergenic
1100725347 12:97402766-97402788 ATGTGCCAAGCTTTGTGCTAGGG - Intergenic
1101114823 12:101521821-101521843 ATGTGCCAGGAACTCTGCTAAGG + Intergenic
1101234165 12:102771461-102771483 ATGTGCCAGACTCTGTGCTAAGG + Intergenic
1101554500 12:105795665-105795687 ATATGCCAGGCACCATGCTAAGG - Intergenic
1101653006 12:106694705-106694727 ATATGCCAGGTACTTTGCTTAGG - Intronic
1101791996 12:107935748-107935770 ATGTGCCAGGGATTATGCTATGG + Intergenic
1102801261 12:115736450-115736472 TTGTCCCAGGCTCTGTGCTAGGG + Intergenic
1102859753 12:116325559-116325581 GTGTGCCAGGCCCTGTGCTAAGG + Intergenic
1103212536 12:119177420-119177442 ATATGCCAGGCCCTGCTCTATGG - Intergenic
1103251174 12:119501270-119501292 ATGGGCTAGGTTCTGTGCTAAGG + Intronic
1103906781 12:124331904-124331926 AACTGCCAGGCGCTGTGCTAGGG + Intronic
1105843765 13:24277715-24277737 GTATGCCAGGTACTATGCTAGGG + Intronic
1106454436 13:29914508-29914530 ATGTGCCAGGCTCTATGTTAAGG + Intergenic
1107727764 13:43317120-43317142 ACATGCCAGGATCTGAGCTCCGG - Intronic
1109991976 13:70070226-70070248 ATATGCCTGGATCTGTGGTTTGG - Intronic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1110264671 13:73523729-73523751 ATTTGCCAGGGTATGTACTAGGG + Intergenic
1111141464 13:84125189-84125211 ATATACCAGGCTCTGTGCTCAGG + Intergenic
1111316877 13:86574870-86574892 AGTTGCCAGGGTCTATGCGAAGG - Intergenic
1113104770 13:106760098-106760120 ACATGCCAGGCTCTGAGCTGAGG - Intergenic
1113543039 13:111123703-111123725 GTATGCCAGGCACTGTTCTAAGG + Intronic
1114802517 14:25793297-25793319 ATATATAAGGGTCTGTGCTGAGG - Intergenic
1114912018 14:27212457-27212479 ATGTGCCTGGTTCTGGGCTATGG + Intergenic
1115491027 14:33958262-33958284 ATACCCCAGGCTCTGTGGTATGG + Intronic
1115519240 14:34216520-34216542 ATATGCCAGGCCCTGTGCAAAGG + Intronic
1116342112 14:43737081-43737103 ATGTGCCTGGCTCTCTGCTAAGG - Intergenic
1116392648 14:44412184-44412206 ATATGCCAGGCACTGAGCCATGG + Intergenic
1117336267 14:54759498-54759520 TCATGCCAGGGGCTGTGGTACGG - Intronic
1117409179 14:55434935-55434957 ATTTGCCAGGCTCTGTACTTAGG - Intronic
1118055556 14:62076127-62076149 ATATGCCAGGCACTGTGATAAGG + Intronic
1118060406 14:62131801-62131823 ATGAGCCAGGCACTGTGCTAGGG + Intergenic
1118417886 14:65563278-65563300 ACATGCCAGGTACTGTGCCAAGG + Intronic
1118457772 14:65960288-65960310 ACAAGCCAGTGTCTGAGCTAGGG + Intronic
1118608789 14:67523427-67523449 ATGTGCCATGCACTGTGCTAAGG + Intronic
1118668650 14:68098949-68098971 ATGTACCAGGCTCTGTTCTAGGG + Intronic
1118685636 14:68287826-68287848 ATAGGCCGGGTACTGTGCTAAGG + Intronic
1118744250 14:68762552-68762574 ATGTGCCAGGTCCTGTGCTAGGG - Intergenic
1118778792 14:68992269-68992291 AAATGTTAGGCTCTGTGCTAAGG - Intergenic
1119446843 14:74672037-74672059 CTATGCCAGTGTCTGTGCAGTGG + Intronic
1119497612 14:75093910-75093932 ATTTGCCAGGCACTGTTCTAGGG + Intronic
1119518304 14:75265866-75265888 ATATGCCAGATACTGTGTTAGGG + Intronic
1119616041 14:76099700-76099722 ATGTGCCAGGCGCTGTGCTGAGG + Intergenic
1119879240 14:78087079-78087101 ATGTTCCAGGGACTATGCTATGG - Intergenic
1120565692 14:86053309-86053331 ATATGCCAGCTGCTATGCTATGG + Intergenic
1121062319 14:90924457-90924479 ATATTCCAGAGTCTCTGATAGGG + Intronic
1121158258 14:91708052-91708074 ATATGCCAGATTCTGTGCTAAGG - Intronic
1121688562 14:95857906-95857928 GTATGCCAAGCTCTGTGCTAGGG + Intergenic
1121805801 14:96821205-96821227 ATGTGCCAGGAACTGTGCTAGGG - Intronic
1202930308 14_KI270725v1_random:28851-28873 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1123443006 15:20303968-20303990 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1123531303 15:21149206-21149228 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1124047607 15:26164465-26164487 ATGTGCCAGCTGCTGTGCTAGGG + Intergenic
1124185716 15:27526797-27526819 ATGTGCTAGCGTCTGTGCTGGGG + Intronic
1124867073 15:33502913-33502935 TTATGCCAGGTACTGTTCTAAGG - Intronic
1124988586 15:34648095-34648117 ATGTGCCAGGCACTGTGTTAGGG - Intergenic
1125183303 15:36902122-36902144 ATGTGCCAGGCATTGTGCTAAGG - Intronic
1125285162 15:38084699-38084721 ATATGCCAAGGTTTGTGCTAGGG - Intergenic
1125695447 15:41633279-41633301 ATATGCCAGGCATTGTGTTAAGG + Intronic
1125932770 15:43612101-43612123 ATTTCCCAGGGCCTGGGCTAGGG + Intronic
1125945869 15:43711563-43711585 ATTTCCCAGGGCCTGGGCTAGGG + Intergenic
1126376878 15:48005876-48005898 GTGTGCCAGGCACTGTGCTAGGG - Intergenic
1126380142 15:48038135-48038157 ATATGCCAAGCACTGTTCTAAGG + Intergenic
1126541784 15:49831950-49831972 GTATGCCAGCCACTGTGCTAAGG + Intergenic
1126627347 15:50697741-50697763 ATATGCCAGCCACTGTACTAAGG - Intergenic
1126691208 15:51290164-51290186 ATATGCCAGGCACTGTGCAAAGG - Intronic
1126800147 15:52290926-52290948 ATGTGTCAGGTGCTGTGCTAAGG + Intronic
1127568560 15:60217367-60217389 ATGTGCCAGGCACTTTGCTAAGG - Intergenic
1127698688 15:61475934-61475956 TTATGCCAGGTACTGTTCTAAGG - Intergenic
1129464124 15:75714275-75714297 GTATGCCAGGCCCTGGGCTAGGG - Intergenic
1129745365 15:78015757-78015779 ATGTGCCAGGAGCTGTGCTAAGG - Intronic
1130516267 15:84628284-84628306 ATGCGCCAGGCACTGTGCTAAGG + Intergenic
1130569080 15:85024299-85024321 ATATGCCAGGTACTGTGCCAGGG - Intronic
1130857732 15:87856024-87856046 ATTTGCCAAGCTCTCTGCTAAGG - Intergenic
1130899682 15:88198051-88198073 ATATTTCAGGGAATGTGCTAGGG - Intronic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130969364 15:88720155-88720177 GCATGCCAGGCTCTGTGCTATGG + Intergenic
1130969708 15:88722275-88722297 ACATGCCAAGCACTGTGCTAAGG - Intergenic
1131625172 15:94109927-94109949 ATATGTCAGGTTCAGTGCAAGGG - Intergenic
1131960870 15:97789032-97789054 CTATGCCAGGCTTTGTGCTGAGG - Intergenic
1132214078 15:100049903-100049925 ACCTGCCAGGTTCTGTTCTATGG - Intronic
1132551517 16:555695-555717 ACCTGGCAGGGTCTGTGCTGTGG - Intergenic
1132729324 16:1353304-1353326 ATGTGTTAGGGTCTGTGCTGGGG + Intronic
1132761728 16:1511801-1511823 ATGTGCCAGGCGCTGTGCTGGGG + Intronic
1133071623 16:3250214-3250236 ATTTGCCAGGTACTCTGCTAGGG - Intronic
1133386671 16:5375664-5375686 ATGTGCCAGGCACTGTGCCAGGG + Intergenic
1134555675 16:15161945-15161967 ATATGCCAGGTCCTGTGCTATGG + Intergenic
1134614689 16:15642343-15642365 ATATGCCAGGCATTGTACTAAGG - Intronic
1134630412 16:15752221-15752243 ATATGCCAGGCTCTGGGCCTAGG - Intronic
1134760584 16:16710884-16710906 ATGTGCCAGGAACTGTTCTAAGG + Intergenic
1134916257 16:18073656-18073678 ATATGCCAGGTTCTGTGCTATGG + Intergenic
1134985475 16:18648289-18648311 ATGTGCCAGGAACTGTTCTAAGG - Intergenic
1135195025 16:20387115-20387137 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1135657967 16:24268025-24268047 AGATGCCAGGCACTGTTCTAAGG + Intronic
1136241763 16:28949015-28949037 ATATGCCAGGCTGGGTGCTGTGG + Intergenic
1136718243 16:32301714-32301736 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1136718696 16:32303335-32303357 ATATGCCAGGACCAGGGCTAGGG + Intergenic
1136773726 16:32860432-32860454 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1136836617 16:33507984-33508006 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1136837067 16:33509599-33509621 ATATGCCAGGACCAGGGCTAGGG + Intergenic
1136862761 16:33713015-33713037 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1136896886 16:34001087-34001109 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1138927229 16:61607294-61607316 TTCTGCCAGGATCTTTGCTATGG + Intergenic
1138958568 16:62002067-62002089 ATGTTCCAGGGTCTTTGCTGAGG - Intronic
1139359747 16:66390160-66390182 GTATGCCAGGCACTTTGCTAGGG - Intronic
1139612407 16:68068545-68068567 ACATGCCAGGCACTGTGCCAAGG - Intronic
1140133994 16:72189097-72189119 ATGTGCCAGGCACCGTGCTATGG + Intergenic
1140477921 16:75248283-75248305 ATGTGCGAGGCTCTGTGCTGGGG - Intronic
1141209161 16:81959956-81959978 ATATGTCAGGTTCTTTGATATGG - Exonic
1141346686 16:83253034-83253056 CTGTGCCAGGTGCTGTGCTAAGG - Intronic
1141386490 16:83626455-83626477 ATGAGCCAGGGTCTTTGCTGGGG + Intronic
1141763923 16:86046391-86046413 ATGTGCCAGGCCCTGTGCCAGGG + Intergenic
1141787359 16:86210684-86210706 ATGTTCCCGGCTCTGTGCTAAGG - Intergenic
1142274132 16:89107052-89107074 ATCTGGCAGGGTCTGTGCTGTGG + Intronic
1203007735 16_KI270728v1_random:214436-214458 ATATGCCAGGACCAGGGCTAGGG - Intergenic
1203008185 16_KI270728v1_random:216051-216073 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1203076144 16_KI270728v1_random:1122543-1122565 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1203123754 16_KI270728v1_random:1559391-1559413 ATATGCCAGGACCAGGGCTAGGG - Intergenic
1203124244 16_KI270728v1_random:1561174-1561196 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1203147244 16_KI270728v1_random:1809878-1809900 ATATGCCAGGACCAGGGCTAGGG + Intergenic
1142637323 17:1266074-1266096 ATGTGCCAGGTACCGTGCTAAGG + Intergenic
1143014182 17:3882947-3882969 AGATCCCTGGGTCTGTGCTAGGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1143425748 17:6835987-6836009 ATGTGCCAGGCACTGTGCTTGGG + Intergenic
1144025447 17:11272672-11272694 GTATGCCAGGCTCTGAGCCAGGG - Intronic
1144251627 17:13422366-13422388 ATATGCCAGGCACTGTACCAAGG + Intergenic
1145783542 17:27579477-27579499 ACATGCCAGGCTCTGATCTAAGG - Intronic
1145987068 17:29054217-29054239 ATAAGCCAGGTTATGTCCTAAGG - Intronic
1146475739 17:33161250-33161272 GTATGCCAGGCAGTGTGCTAAGG + Intronic
1146573279 17:33970631-33970653 ATCTCCCTGGGTCTGTGTTAGGG - Intronic
1148080212 17:44963861-44963883 ATGTGCCAGGGCCTGTGGTCAGG - Intronic
1148200391 17:45746381-45746403 ATGGGCCAGGGTCAGTGCTGGGG + Intergenic
1148633896 17:49132702-49132724 ATTTGCCCGGGTCGGTGCCAGGG + Intronic
1148689495 17:49518947-49518969 ATATGCCAGGCAAGGTGCTAAGG - Intergenic
1149388340 17:56164489-56164511 ATGTGCCAGCTACTGTGCTACGG - Intronic
1150203824 17:63385129-63385151 ATGTGTCAGGTTCTGTGCTAGGG - Intronic
1150469090 17:65420908-65420930 ACATGCCAGGGACTGTTCTAAGG - Intergenic
1150503428 17:65673521-65673543 AGATGCCAGGGACTGGGGTATGG + Intronic
1150843353 17:68630204-68630226 ATGTGCTAAGCTCTGTGCTAAGG - Intergenic
1151426415 17:74033702-74033724 CTATGCCAGGCTCCGTGCCAAGG - Intergenic
1151675954 17:75597529-75597551 CTGTGCCAGGAACTGTGCTAAGG + Intergenic
1151887954 17:76934192-76934214 ATGTGCCAGGCATTGTGCTAAGG + Intronic
1152879104 17:82805303-82805325 AGGTCCCAGGGTCTGTGCCATGG + Intronic
1152998584 18:431861-431883 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1153203832 18:2675168-2675190 ATATGCGAGGCTCTGTCCTAAGG - Intronic
1156234772 18:35191810-35191832 ATGTGCCAGACGCTGTGCTAGGG + Intergenic
1156385539 18:36601517-36601539 ATATGCCAGGCACTGTCCTAAGG + Intronic
1157228700 18:45892750-45892772 ATCTGCAAGCGTCTGAGCTATGG - Intronic
1158638910 18:59185588-59185610 ATGTGATAGGGGCTGTGCTAAGG - Intergenic
1158686913 18:59622841-59622863 AGATGCCAGGGTCTGGGGGAGGG + Intronic
1158908601 18:62037893-62037915 ATATGCCAAGCCCTGTGCCAGGG - Intergenic
1160048990 18:75414340-75414362 ACATGCCAAGTACTGTGCTAGGG + Intronic
1160301437 18:77684322-77684344 ATATGCCAGGTATTGTTCTAGGG + Intergenic
1160619687 18:80162052-80162074 ATGTGCCAGAGCCTGTGCTAGGG - Intronic
1161609329 19:5232279-5232301 ATGTGCCAGGTACTGTGCCAAGG + Intronic
1161609483 19:5233433-5233455 ATGTGCCAGGCACTGTGCCAAGG + Intronic
1162104205 19:8360348-8360370 ATATGCCAGGCACTGTACTGGGG - Intronic
1162378847 19:10320559-10320581 CTATGCCAGGCCATGTGCTAGGG - Intronic
1162470488 19:10869958-10869980 CCATGCCAGGGTCTCTGCAACGG + Intergenic
1162573611 19:11486285-11486307 ATATGCCAGGCTCTGGACTGGGG + Intronic
1164714446 19:30381266-30381288 ATGTGCCAGGCACTGTGCTGGGG + Intronic
1165145818 19:33729350-33729372 CTATGCCATGAACTGTGCTACGG - Intronic
1165256294 19:34578861-34578883 CTATGCCAGGGCCAGTGCCAGGG + Intergenic
1167210471 19:48131029-48131051 CTCTGCCAGGGTCTGTGGTCAGG - Intronic
1167215014 19:48158750-48158772 AGATGCCAGGGTCTCTGATCAGG - Intronic
1167514339 19:49914359-49914381 GTATGCCTGGGCCTGTGCTCAGG + Intronic
1202691815 1_KI270712v1_random:99113-99135 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
925296977 2:2783731-2783753 CTATGCCAGATGCTGTGCTAAGG - Intergenic
925780966 2:7381526-7381548 ATAAGACAGGGTCTGTTCTCAGG + Intergenic
925801916 2:7609954-7609976 ATGTGCCAGACACTGTGCTAGGG - Intergenic
926079079 2:9969263-9969285 ATATGCTAGGTGCTGTGCTAAGG + Intronic
926710071 2:15872175-15872197 ATGTGGCAGGTTCTGTGCTGAGG + Intergenic
926777565 2:16437609-16437631 ATGTCCCAGGCTGTGTGCTAGGG + Intergenic
927140471 2:20126827-20126849 CCATGCCAGGGTCTATGTTAGGG + Intergenic
927185757 2:20481159-20481181 ACAGGCCAGTCTCTGTGCTAGGG + Intergenic
927240968 2:20919266-20919288 AGATGCCAGCGTCTGTGTTCTGG - Intergenic
927271625 2:21216345-21216367 TTTTGCCAGGCACTGTGCTAAGG + Intergenic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
927904221 2:26846039-26846061 CTATGCCAGGCAATGTGCTATGG + Intergenic
928259866 2:29756843-29756865 ATGTGCCAGTCACTGTGCTAGGG + Intronic
928542990 2:32300894-32300916 TTATGCCAAGTTCTGTGATAGGG - Intronic
929093411 2:38241660-38241682 ACATGCCAGGCACTATGCTAAGG + Intergenic
929900980 2:46003386-46003408 ATATGCCAGCATCTATGCGAAGG + Intronic
930490039 2:52057992-52058014 ATGTGCCAAGCTCTTTGCTAAGG - Intergenic
932448908 2:71797276-71797298 CTATGCTAGGGTCTGTGATCTGG + Intergenic
932614654 2:73224242-73224264 ATAGGCCAGGCCCTGTACTAAGG + Intronic
933954575 2:87354843-87354865 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
934238770 2:90251063-90251085 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
934274426 2:91565647-91565669 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
934461197 2:94214394-94214416 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
935775773 2:106469774-106469796 GTATGAGAGGGTCTGAGCTAGGG - Intergenic
936105426 2:109620126-109620148 ACATGCCAGGCACTGTGCAAGGG - Intergenic
936503792 2:113088359-113088381 GTGTGCCTGGCTCTGTGCTAAGG - Intergenic
936797838 2:116228406-116228428 ATATGCCAGGAACTGTGCTGGGG + Intergenic
937685479 2:124691632-124691654 AGGTGCCAGCGACTGTGCTATGG - Intronic
939729492 2:145764415-145764437 ATGTGCCAGATACTGTGCTAAGG - Intergenic
940009820 2:149040901-149040923 ATATGCCAGGGCCTCTGCCAAGG + Intronic
940511900 2:154626313-154626335 ATGTGCCAGATCCTGTGCTAGGG - Intergenic
941290488 2:163667876-163667898 ATATTCCAGGCTCTGCGCTAGGG - Intronic
941310016 2:163915703-163915725 ATATGCCAGGCAATGTGCTGAGG - Intergenic
941862466 2:170298082-170298104 ATATTCCAGGGCCTGTTCTCTGG + Intronic
942081424 2:172402861-172402883 ATATGCCAGGCATTGTACTATGG - Intergenic
942181959 2:173388636-173388658 ATGGGCCAGGGCCTGTGCTGAGG - Intergenic
942828087 2:180204780-180204802 ATATGCTAGGCACTGTTCTAGGG + Intergenic
943475340 2:188347296-188347318 ATCTTCCCGGGTTTGTGCTATGG - Intronic
943980037 2:194538528-194538550 TGATGCCAGGGTTTGTGGTAGGG + Intergenic
944409356 2:199422787-199422809 ATATACCAGGCACTGTCCTAGGG - Intronic
944678448 2:202053850-202053872 ATGTGCCAGGCTCTGTGCTGGGG - Intergenic
944950659 2:204745182-204745204 TGATGCCAGGGTCTGTGCTATGG + Intronic
945154094 2:206819443-206819465 ATATGCCAGGTTGTATACTAAGG - Intergenic
945406856 2:209459318-209459340 ATGTGCCAGGCACTGTTCTAGGG - Intronic
948030348 2:234812765-234812787 ATATGCCAGGCACATTGCTAGGG + Intergenic
948903871 2:240968758-240968780 ACATGCCAGGCTTTGTGCTGGGG + Intronic
1170879926 20:20287970-20287992 ATATGCCAGGCACTGTGTGAGGG - Intronic
1172624912 20:36341418-36341440 ACATGCCAGGCACTTTGCTAGGG - Intronic
1172908098 20:38384551-38384573 ATGTGCCAGGTGCTGTTCTAGGG - Intergenic
1173025751 20:39305889-39305911 ATGTGCCAGGTACTGTGCTGGGG + Intergenic
1173234435 20:41231649-41231671 ATGTGTCAGGCTCTGTACTAAGG - Intronic
1173351422 20:42248923-42248945 ATGTGCCAGGCACTGTGCTAAGG + Intronic
1173666249 20:44765457-44765479 GTATGCCAGACTCTGTTCTAAGG - Intronic
1174224470 20:48985736-48985758 GTGTGCCAGGCACTGTGCTAAGG + Intronic
1174519702 20:51120008-51120030 ATATGCCAGGCACTGTTCCAAGG + Intergenic
1174634521 20:51987539-51987561 ATGTGCCAGGCACTGTTCTATGG + Intergenic
1174775698 20:53341313-53341335 TTGTGCCAGACTCTGTGCTAAGG + Intronic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1175078372 20:56395289-56395311 GTATGCCAGGCACTGTGCTCAGG + Intronic
1175373479 20:58508714-58508736 ATGTGCCAGGCACTGTTCTAGGG + Intronic
1175580004 20:60091147-60091169 GGATGCCAGGCTCTGTGCTAGGG - Intergenic
1175640720 20:60628030-60628052 ATGTGCCAGGCACTGTGCTAAGG - Intergenic
1176244083 20:64089109-64089131 GCATGCCAGGGTCTGTGCTGGGG + Intronic
1176592320 21:8657433-8657455 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1176866350 21:14056941-14056963 CTATGCTAGGGTCAGTGCGAGGG + Intergenic
1177043081 21:16136544-16136566 CTATGCCAGGCTCTGTCCTAGGG - Intergenic
1177581464 21:23028190-23028212 ATATTCCAGGCACTGTTCTAAGG - Intergenic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
1178250789 21:31001406-31001428 GCTGGCCAGGGTCTGTGCTAAGG + Intergenic
1178347127 21:31839750-31839772 ATATTCCAGGCACTGTTCTAAGG - Intergenic
1178411899 21:32370909-32370931 ATGTGCCAGGCACTGTCCTAGGG + Intronic
1178461587 21:32807217-32807239 ATGTGCCAGGCCCTGTGCTAAGG - Intronic
1178701165 21:34834961-34834983 ACATGCCAGGGGCTATGCTGTGG + Intronic
1179299364 21:40092415-40092437 GTATGTCAGGGTCTATGCTGGGG - Intronic
1180275171 22:10634562-10634584 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1180549646 22:16529496-16529518 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1181355035 22:22292315-22292337 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1182025352 22:27114023-27114045 ATGTGCCAGGCCCTGTGTTAGGG + Intergenic
1182323158 22:29491452-29491474 ATGTGCCAGGCAGTGTGCTAGGG + Intergenic
1183224222 22:36538290-36538312 TTATGCCAGGCACTGTGCTATGG + Intergenic
1183527558 22:38332826-38332848 ACATGCCAGGCTCTGAGCTACGG - Intronic
1183563977 22:38599653-38599675 GTGTGCCAGGCGCTGTGCTAAGG + Intronic
1184008906 22:41732012-41732034 AAGTGCCAGGGACTGTGCTATGG + Intronic
1184372589 22:44092047-44092069 AAATGCCAGGGTCTTTGGAAGGG - Intronic
1184563449 22:45276826-45276848 ACGTGTCAGGGACTGTGCTAGGG - Intergenic
1184903865 22:47465460-47465482 ACAGGCCAGGGTCAGAGCTAGGG + Intronic
949202790 3:1399764-1399786 ATGTGCCAGGCACTGTGCTAGGG + Intronic
949610685 3:5700323-5700345 ATGTGCCAGGTTTTGTGTTAAGG + Intergenic
949636279 3:5984830-5984852 GTACTCCAGGGCCTGTGCTATGG - Intergenic
949923052 3:9019348-9019370 ATATGCCAGGGGCAGGGCTGTGG - Intronic
950580892 3:13861402-13861424 ATGTGCCAGGCACTGTTCTAGGG + Intronic
950914884 3:16634295-16634317 GTGTGCCAGGCACTGTGCTAAGG - Intronic
951141978 3:19173146-19173168 AGATGCCAGGATCTCTCCTAAGG - Intronic
951806942 3:26655803-26655825 ATATGCCAGGTACTGGGCCAAGG + Intronic
952077437 3:29714122-29714144 ATAAGCCAGGATCTCTTCTAGGG + Intronic
952206682 3:31187363-31187385 GTATGCCAGGCACTGTGCTGAGG + Intergenic
952218370 3:31300328-31300350 ATTTACCAGGGTATGTGCTTGGG + Intergenic
952333130 3:32383012-32383034 ATGTGCCAGGCACTGTGCTGAGG + Intergenic
952820915 3:37484851-37484873 ATATGCCAGACACTGTTCTAAGG - Intronic
953236919 3:41115023-41115045 ACGTGCCAGGAACTGTGCTAAGG + Intergenic
953789499 3:45936673-45936695 ATCTGCCAGGGTCTCTGTCATGG - Intronic
954917671 3:54162774-54162796 ATGTGCCAGATTCTGTCCTAAGG + Intronic
955134104 3:56199035-56199057 ATATGACAGGCACTGTGCTAAGG + Intronic
955676375 3:61453190-61453212 TTGTGCCAGGGACAGTGCTAGGG - Intergenic
955949517 3:64228170-64228192 ATTTGCCAGTCACTGTGCTAGGG + Intronic
956345797 3:68277058-68277080 ATGTGCCAGGCACTGTGCTAAGG + Intronic
956354221 3:68373106-68373128 ATGTGCCAGGCACTGTGTTAGGG - Intronic
956737110 3:72246436-72246458 AGATCCCAGGCACTGTGCTAAGG - Intergenic
956747982 3:72324463-72324485 ATGTGCCAGGCACTATGCTAGGG + Intergenic
956885219 3:73552269-73552291 ATCTCCCAGGGACTGTTCTAAGG - Intronic
957128207 3:76189762-76189784 GTATGCCAGGCTCTCTGCTAAGG + Intronic
957507332 3:81139383-81139405 ATTTGCCTGGATATGTGCTATGG - Intergenic
957687789 3:83525197-83525219 ATATGCCAGCTTCTGTGGGAGGG + Intergenic
959135160 3:102409447-102409469 ATATGTGTGGGTATGTGCTATGG - Intronic
959145445 3:102538959-102538981 ATATGCCAGACTCTGTTCTAGGG + Intergenic
959880476 3:111439575-111439597 CTATTCCATGGGCTGTGCTATGG + Intronic
960696543 3:120401993-120402015 ATATCCCTGGTTCTTTGCTAGGG + Intronic
960986629 3:123285308-123285330 AAATGGCAGGGCCTGTGCTTAGG + Intronic
962151181 3:132895056-132895078 ACATGCCAGGGCCTGTGGTGGGG + Intergenic
962209911 3:133468930-133468952 AACTGCCAGGCACTGTGCTAAGG - Intronic
962244228 3:133778200-133778222 ATGTGCCAGTTTCTGTGCTGTGG - Intronic
962629642 3:137263291-137263313 ATGTGCCAGGCTCTGTGTTGGGG - Intergenic
963792381 3:149596951-149596973 ATCTGCCAGGTTTTGTTCTAAGG - Intronic
963797096 3:149641879-149641901 AGATGACAGGGGCTGTGCTTTGG - Intronic
964598794 3:158471384-158471406 ATATACTAGGCTCTGTGATAAGG - Intronic
964687723 3:159415809-159415831 ATGTGCCAGGCACTGTACTAGGG - Intronic
965342592 3:167508488-167508510 ATATTTCAGGGCCTGTTCTAAGG - Intronic
965548133 3:169936028-169936050 ATATGCCAGCCTCTGTATTAGGG + Intronic
965611905 3:170553210-170553232 ATATGCTAGGCACTGTGCTTGGG - Intronic
966641515 3:182196313-182196335 ATATGCCAGGAACTCTGCCAAGG + Intergenic
966917302 3:184592156-184592178 ACATGGCAGGGTCTGGGCTGTGG - Intronic
967264260 3:187676247-187676269 ATATGTCAGGGTCTCTACTAGGG - Intergenic
967318434 3:188172430-188172452 ACATGTCAGGCTCTGTTCTAAGG - Intronic
967473381 3:189888924-189888946 CTGTGCCAGGCACTGTGCTAGGG + Intronic
967888784 3:194350573-194350595 ATGTGCCAGGCGCTGTGTTAAGG - Intronic
968329730 3:197856790-197856812 ATATCCCAGGAACTGTGGTAGGG - Intronic
968968887 4:3783382-3783404 ACATGCCAGGCCCTGTGCCAGGG + Intergenic
969078510 4:4599804-4599826 ATATGCCCTGGCCTGTCCTAAGG - Intergenic
969339271 4:6530145-6530167 ATATTCCATGGGCGGTGCTAAGG - Intronic
969722193 4:8898270-8898292 ATGTGCCTGGCTCTGTGCTCTGG - Intergenic
969987231 4:11225009-11225031 ATGTGCCAGGTACTATGCTAAGG - Intergenic
970038186 4:11763962-11763984 AGTTGCCAGGGTCTGGGTTAGGG - Intergenic
970236019 4:13958791-13958813 ATTTGCCAGGGTGTGTGAGAAGG + Intergenic
970852772 4:20621308-20621330 ATATGCCAGGTACTATGCTCAGG + Intergenic
970932936 4:21534722-21534744 ATCTGCCAGGGTGTGTGCTCTGG - Intronic
971098767 4:23438613-23438635 ATGTGCCAGGTTCTATGTTAAGG - Intergenic
971609429 4:28703482-28703504 AGATGTCAGGGTCTTTGCTGCGG - Intergenic
971993239 4:33929093-33929115 AAATGCCAGGCACTGTACTAGGG + Intergenic
972478015 4:39471057-39471079 ATGTGCCAGGGACTGTGGTAAGG - Intronic
973107430 4:46357570-46357592 ATGTGCCAGGCACTGTTCTAGGG + Intronic
973647876 4:52968200-52968222 GTGTGCCAGGCACTGTGCTAGGG + Intronic
973705709 4:53577949-53577971 ATGCGCCAGGCACTGTGCTAGGG + Intronic
973839552 4:54846948-54846970 ATATACTTGGTTCTGTGCTAAGG - Intergenic
973869721 4:55153955-55153977 ATATGCCAGGTACTATTCTAAGG - Intergenic
974406017 4:61470682-61470704 ATGAGCAAGGTTCTGTGCTATGG + Intronic
974724009 4:65776174-65776196 ATATGTCAGGCACTGTACTAAGG - Intergenic
975359075 4:73445625-73445647 ATGTGCCAGGCATTGTGCTATGG - Intronic
975613375 4:76222743-76222765 ATATGCCAAGCTCTGTTCTAAGG + Intronic
975691915 4:76973819-76973841 ATATGCCAGGCACTGGTCTAAGG - Intronic
976836042 4:89375081-89375103 ATGTGCCAGGCACTGGGCTAAGG - Intergenic
978054003 4:104240209-104240231 ATATGCAAGGCACTGTGTTAAGG - Intergenic
978195379 4:105965941-105965963 GTGTGCCAGCCTCTGTGCTAAGG - Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
979316706 4:119273519-119273541 ATATGCCATGTGCTGTTCTAGGG - Intronic
980000888 4:127486402-127486424 ATGTTCCAGTGTCTGTGATATGG - Intergenic
980190468 4:129518816-129518838 ATATGCCAGGCACTGTTTTAGGG + Intergenic
980949319 4:139357170-139357192 ATATGAAAGGGATTGTGCTAGGG + Intronic
982034695 4:151334170-151334192 ATATGCCAGGAGCTGTTCTAAGG - Intergenic
982163233 4:152590918-152590940 ATGTGCCAGGTACTGTTCTAAGG + Intergenic
982397466 4:154927639-154927661 ATGTGCCAGGGTCTCTGCCTAGG + Intergenic
982565461 4:156980295-156980317 ATGTGCCAGGTACTGTCCTAAGG + Intergenic
982610628 4:157569751-157569773 ATATGCTAGGCACTGTTCTAGGG + Intergenic
983212497 4:164973141-164973163 ATATGTCAGGCACTATGCTAAGG + Intronic
983249089 4:165325256-165325278 GTATGCCAGAGACTGTGCAAAGG + Intergenic
984090821 4:175373199-175373221 GTATGCCAGGCACTGTGCTATGG - Intergenic
984300346 4:177909466-177909488 ACAGGCCATGGACTGTGCTACGG + Intronic
984693084 4:182751238-182751260 AAGTGCCAGTGTCTGTCCTATGG - Intronic
984838897 4:184050183-184050205 ATATGCCAGGCGCTGGTCTAGGG + Intergenic
986183434 5:5415564-5415586 ATATTCCATGGTTTGTGATATGG + Intergenic
986441190 5:7783289-7783311 ATGTGTCAGGCTCTGTGCCAGGG + Intronic
987346971 5:16987548-16987570 ATATGCCAGATCCTTTGCTATGG - Intergenic
987927994 5:24365859-24365881 ATGTGCCAAGGTCTTTGCTGGGG - Intergenic
988412047 5:30898975-30898997 ATGTGCCAGGCACTGTGGTAGGG + Intergenic
988514994 5:31896525-31896547 ATGTGCCAAGCCCTGTGCTAAGG + Intronic
990027600 5:51214051-51214073 ACATGACAGGCTCTCTGCTACGG + Intergenic
990490884 5:56301811-56301833 ATAGCCCAGGATCTCTGCTAAGG + Intergenic
990943587 5:61228289-61228311 ATGTGCCAGGCACTGTGGTAGGG - Intergenic
991292369 5:65045208-65045230 AGAGGCCAGGGTGTGTTCTATGG - Intergenic
991423142 5:66462162-66462184 CAATGCCAGGCACTGTGCTAGGG + Intergenic
991566910 5:68014821-68014843 ATATGCCAGGGGCCTTGCTTGGG + Intergenic
991665113 5:68991987-68992009 CTGTTCCAGGTTCTGTGCTAAGG + Intergenic
992035443 5:72770089-72770111 ATATGCCATGCACTGTGCCAAGG - Intergenic
992062854 5:73073500-73073522 ATGTGCCAGGCACTTTGCTAGGG - Intronic
992226597 5:74624890-74624912 CTATGCCAGGGACTGAGTTAAGG - Intergenic
992441288 5:76799865-76799887 ATGTGCCAGGTACTGTGTTACGG + Intergenic
992762827 5:79966385-79966407 ATGTGCGAAGCTCTGTGCTAGGG + Intergenic
993106748 5:83608759-83608781 ACATGTGAGGGACTGTGCTAAGG + Intergenic
994032698 5:95163193-95163215 AAAAGCCAGGGTTTGTGCCAGGG + Intronic
994033715 5:95174736-95174758 TTATGCCAGGCTCTGTTCTCAGG - Intronic
995500692 5:112803582-112803604 ATATGCCAGGGACTGTGTTAAGG - Intronic
995797097 5:115953044-115953066 ATATGCCAGATTCTGGGCTAGGG - Intergenic
995807495 5:116069848-116069870 TTGTGCCAAGCTCTGTGCTAGGG - Intergenic
996387464 5:122924666-122924688 ATGTGCCAGGCTAGGTGCTAAGG + Intronic
997258750 5:132449270-132449292 ATATGCCAGGCACTGTCCTAGGG - Intronic
997276342 5:132595301-132595323 ATGTGCCAGGCACTGTTCTAAGG - Intronic
998360942 5:141586315-141586337 ATGTACCAGGCCCTGTGCTAAGG + Intronic
998714276 5:144864690-144864712 CTATGCTAGGGACTATGCTAGGG - Intergenic
999099058 5:149007172-149007194 AGATGTCAGGGACTGTGCTGGGG + Intronic
999387724 5:151166997-151167019 AAGTGCCAGGTGCTGTGCTAAGG + Intergenic
999712226 5:154328863-154328885 ATAGGGCAGGGTCTGTGGGAAGG + Intronic
999909008 5:156176278-156176300 ATATGCCAGAGTCAATTCTAAGG + Intronic
1000478401 5:161741811-161741833 AAATGCCAGGTTTTTTGCTAGGG + Intergenic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1001770389 5:174291756-174291778 ATATGCCATGCATTGTGCTAAGG + Intergenic
1001962539 5:175888423-175888445 ATGTGCCTGGCACTGTGCTAGGG - Intergenic
1001967497 5:175921532-175921554 TGGTGCCAGGCTCTGTGCTAGGG - Intronic
1002359344 5:178658440-178658462 ATATGCCAGGCTCTGGGGTTAGG - Intergenic
1003267800 6:4581790-4581812 ATTTTCCAGGTCCTGTGCTAGGG - Intergenic
1003513152 6:6798356-6798378 ATGTGCCAGGTTCTGTGCTTGGG + Intergenic
1004323364 6:14650972-14650994 ATGTGCCAGGCATTGTGCTAAGG + Intergenic
1004753926 6:18591035-18591057 ATGTCCCAGGCTCTCTGCTATGG - Intergenic
1005443469 6:25897081-25897103 AAGTGCCAATGTCTGTGCTATGG + Intergenic
1006382849 6:33710768-33710790 ATATGCCTGGAACGGTGCTAGGG - Intronic
1006749165 6:36365846-36365868 ATGTGCCAGGCCTTGTGCTAAGG - Intronic
1006903778 6:37519561-37519583 ATGTGCCAGGTAATGTGCTATGG - Intergenic
1007111526 6:39315800-39315822 CTGTGCCAGGGTCTGTGCCAGGG - Intronic
1007111529 6:39315812-39315834 ATGTGCCAGGTGCTGTGCCAGGG - Intronic
1007122732 6:39396735-39396757 ATGTGCCAGGCACTGTGCTGGGG - Intronic
1007698982 6:43754587-43754609 ATATACCAGGCCCTGTGCTAGGG - Intergenic
1007725870 6:43915252-43915274 ACATGCCAGGCACTGGGCTAGGG + Intergenic
1008055847 6:46945461-46945483 ATGTGCCAGGTACTGTGCTAGGG + Intronic
1008603378 6:53117192-53117214 ACATGCCAGGTTCTGTTTTAAGG - Intergenic
1009767867 6:68105282-68105304 ATGAGCCAGGTTCTGTGCTAGGG + Intergenic
1010129829 6:72478484-72478506 ATATTCCAGGCCCTCTGCTAAGG + Intergenic
1011813537 6:91160866-91160888 AAATGCCAGACCCTGTGCTAAGG + Intergenic
1011850415 6:91620719-91620741 ATATGCCAGACACTGTACTATGG + Intergenic
1012200576 6:96401430-96401452 ATGTGCCAGACACTGTGCTAAGG - Intergenic
1012739336 6:102994622-102994644 ATATGCCAAACTCTGTGCTAAGG - Intergenic
1012850558 6:104441872-104441894 CTACGCCAGGCACTGTGCTAAGG - Intergenic
1013203886 6:107929014-107929036 GTATGCTAGAATCTGTGCTAGGG - Intronic
1013604457 6:111734862-111734884 ATGTGACAGGCACTGTGCTAAGG + Intronic
1014242074 6:119028628-119028650 ATAGGGCAGGGTCTGTGGGAAGG - Intronic
1014457891 6:121657969-121657991 ATATACCAGGCACTATGCTAGGG - Intergenic
1015187442 6:130434199-130434221 ATATGCCAGGCACTCTGCCAAGG + Intronic
1015608266 6:134984323-134984345 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1015622331 6:135144255-135144277 AAATGCTAGGCTCAGTGCTAGGG + Intergenic
1015870342 6:137769840-137769862 ATATGCCAGGCTCTGTGCTGAGG - Intergenic
1015941397 6:138456020-138456042 CTGTGCCAGGCACTGTGCTAAGG + Intronic
1016236858 6:141878393-141878415 CTCTCCCAGTGTCTGTGCTAGGG - Intergenic
1016967253 6:149730401-149730423 ATTTGCCACTGTCTATGCTATGG + Intronic
1016980661 6:149851090-149851112 AAATGACAGGGCCTGTACTAGGG - Intronic
1018332429 6:162744912-162744934 ATTTGCTAGGTTCTGTGATATGG - Intronic
1019968286 7:4519218-4519240 ATATGCCAGGCTGGGTGCTGGGG - Intergenic
1020263591 7:6545697-6545719 ATGTGCCAGGCGCTGTGCTTGGG - Intronic
1021907506 7:25350251-25350273 ACATTCCAGGTTTTGTGCTACGG + Intergenic
1022348933 7:29548055-29548077 ATGTGTCAGGTACTGTGCTAGGG + Intergenic
1023117232 7:36874454-36874476 ATATGCTAGGCCCTGTGCTAAGG - Intronic
1023143738 7:37128801-37128823 ATGTGCTAGGCTCTGTGCCAGGG + Intronic
1023344182 7:39254152-39254174 ATATGCAAGAATCTGTGCTGAGG - Intronic
1023656835 7:42431803-42431825 ATATGTTAGGAACTGTGCTAGGG + Intergenic
1024880211 7:54076734-54076756 ATATGTCAGATCCTGTGCTAGGG + Intergenic
1027275935 7:76555793-76555815 ATGTGCCAGGTGCTGTTCTAAGG - Intergenic
1027429574 7:78096404-78096426 ATGTGTCAGGCACTGTGCTAAGG - Intronic
1027473690 7:78603908-78603930 ATATGACAGGTACTGTGGTAGGG + Intronic
1027510770 7:79076996-79077018 AAATGCCAGGGACTGGGATATGG + Intronic
1027579408 7:79975589-79975611 ATATGCCAGGCACTGTTGTAGGG + Intergenic
1027598824 7:80212466-80212488 ATATGTCATGCTCTGTGCCAGGG - Intronic
1027602535 7:80257032-80257054 TTGTGCCAGGTTCTTTGCTAAGG - Intergenic
1027699920 7:81456973-81456995 ACATGCCAGGCTCTGTGCCAGGG + Intergenic
1027757460 7:82232470-82232492 ATATGCCATAGTTTGTACTATGG + Intronic
1029214226 7:98934040-98934062 ATCTGCCAGGGTCCGTGTTTGGG - Intronic
1029472292 7:100762209-100762231 GTTTGCCAGAGTATGTGCTAGGG - Exonic
1029794883 7:102883235-102883257 ATGTGCCAGGTTCTCTCCTAAGG - Intronic
1030624292 7:111827396-111827418 ATGTTCCAGGTTCTGTGCTTAGG + Intronic
1030826135 7:114160515-114160537 ATATACCAAGCTCTGTCCTAAGG + Intronic
1032286189 7:130539994-130540016 TTGGGCCAGGGTCTTTGCTATGG + Intronic
1032875237 7:136031651-136031673 ATATGCCAGGCACTGAGTTAGGG + Intergenic
1033433210 7:141307792-141307814 ATATTCCAGGCACTGGGCTAAGG + Intronic
1033461854 7:141553606-141553628 ATATGGTAGGCTCTGTGCTGGGG - Intronic
1034588173 7:152114783-152114805 GTATGCCAGGCTCTGTGTTAGGG + Intronic
1035134486 7:156687763-156687785 ATGTGCCAGGCGCTATGCTAAGG + Intronic
1035954662 8:4063442-4063464 ATATGCCAGGCATTGTTCTAAGG - Intronic
1037506869 8:19539452-19539474 ATATGCCAGGCCCTGTGCTGAGG - Intronic
1037630182 8:20648874-20648896 ATGTGCCAGGCATTGTGCTATGG - Intergenic
1038269774 8:26065836-26065858 AGGTGCCAGGGTCCTTGCTAAGG + Intergenic
1038826782 8:31011784-31011806 TTTTGCCAGGTTCTGTGCTAGGG - Intronic
1039889459 8:41674250-41674272 ACATGCCAGGCACTGTGCTATGG + Intronic
1040445668 8:47490828-47490850 ACATACCAGGGCCTGTGCTAGGG + Intronic
1041390459 8:57343122-57343144 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1041484032 8:58354378-58354400 ATATGCCAGTCCATGTGCTATGG - Intergenic
1041694432 8:60720822-60720844 ACATGCCAGGCCCTGTGCTAAGG - Intronic
1041697387 8:60750326-60750348 ATGTGCCAAGGACTGTGTTAAGG + Intronic
1042116687 8:65439536-65439558 ATATGCCAGGCATTATGCTAAGG - Intergenic
1042183664 8:66115855-66115877 ATGTGCCAGGCACTGTACTAAGG - Intergenic
1042577950 8:70241802-70241824 ACATGCCAGGTCCTGTTCTATGG - Intronic
1042648969 8:71018614-71018636 ATGTGCCAGGGCTTGTGCCAGGG - Intergenic
1042769985 8:72369020-72369042 ATGTGCCAGGCACTGTTCTAAGG - Intergenic
1042777675 8:72451920-72451942 ATATGCCAGATCCTGTTCTAGGG - Intergenic
1042977578 8:74487104-74487126 ATGTGCCAGGCACTGTGCCATGG - Intronic
1043388740 8:79770925-79770947 ATGTGCCATGTGCTGTGCTAGGG + Intergenic
1043759967 8:84055973-84055995 ATCTCCCAGGGTCTGTGGGAGGG - Intergenic
1044794787 8:95885762-95885784 ACATGCCAGGGGCTGAACTATGG - Intergenic
1045415129 8:101958572-101958594 ATATGCCAGAACCTGTTCTAGGG + Intronic
1046124445 8:109886568-109886590 ATATGCCAGGTTCTGTAGAAGGG + Intergenic
1046479221 8:114792871-114792893 ATGTGCCAGGGACTGTCCTTGGG - Intergenic
1046825831 8:118690380-118690402 ATATCCCAGGGTCTGAACTGGGG - Intergenic
1047539135 8:125747183-125747205 ATAAGCCAGTATCTGTTCTAAGG - Intergenic
1047628512 8:126680917-126680939 CTGTGCCAGGGTCTGTGGCATGG - Intergenic
1047804057 8:128340378-128340400 ATGTGCCAGTCTTTGTGCTAAGG + Intergenic
1047842841 8:128772742-128772764 ATATACCATGCACTGTGCTAAGG - Intergenic
1048020547 8:130535021-130535043 ATGATCCAGGGTCTGTGCTAGGG - Intergenic
1048233509 8:132667351-132667373 GTATACCAGGCACTGTGCTAAGG - Intronic
1048284518 8:133131317-133131339 ATTTGCCAGGTACTGTGCTGCGG + Intronic
1048315456 8:133358595-133358617 ATATGCCAGGTACTCTTCTAAGG - Intergenic
1048705741 8:137151121-137151143 ATGTGCCAGAAACTGTGCTAAGG - Intergenic
1048750955 8:137674949-137674971 ACAAGGCAGGCTCTGTGCTAGGG + Intergenic
1049078565 8:140421638-140421660 CTATGCCAGGCACTGTGCGAGGG + Intronic
1049245558 8:141560443-141560465 ACGTGCCAGGCTCTGTGCTGAGG + Intergenic
1049261427 8:141641261-141641283 CTATGTCAGGCTCTGTGCTCTGG - Intergenic
1049846740 8:144806144-144806166 ATGTGCCAGGGACTGAGCTCAGG + Intronic
1050267190 9:3903616-3903638 ATATGCCAGGCACTGTTCTAGGG + Intronic
1050684768 9:8155574-8155596 ATGTGCCAGGCCCTGTGCTGGGG - Intergenic
1051070139 9:13156122-13156144 ATGTGCCAGGCACTCTGCTAAGG + Intronic
1051167732 9:14282971-14282993 ATGTGCCTGGGACTGTGTTAAGG - Intronic
1051194458 9:14547765-14547787 ATGCGCCAGGTTCTTTGCTAAGG + Intergenic
1051512187 9:17890266-17890288 ATATGCCAGACACTGTTCTAAGG - Intergenic
1051685439 9:19653714-19653736 ATATGCCAGGCATTGTGCCAGGG - Intronic
1051872638 9:21756252-21756274 ATATGCCAGAGTTTATGCTGGGG - Intergenic
1051910877 9:22153764-22153786 ATGTAACAGGTTCTGTGCTAAGG - Intergenic
1051916343 9:22212525-22212547 ATATGCCAGACGCTGTACTAGGG + Intergenic
1052120296 9:24706392-24706414 ATTTGCCAGGATCCATGCTAAGG + Intergenic
1052168694 9:25366222-25366244 ATGTGCCAGGTGCTGTGCTAAGG + Intergenic
1052750836 9:32488335-32488357 ATGTGTCAGGCTCTGTGCTAAGG - Intronic
1052787259 9:32840469-32840491 ATATGTCAGGCATTGTGCTAAGG - Intergenic
1053691691 9:40590071-40590093 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1054273110 9:63047414-63047436 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1054302948 9:63391037-63391059 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1054401729 9:64717553-64717575 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1054435332 9:65201862-65201884 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1054495058 9:65819819-65819841 ATAGGACCAGGTCTGTGCTAGGG + Intergenic
1055500744 9:76900201-76900223 TTGTTCCAGGTTCTGTGCTAAGG + Intronic
1055883764 9:81034252-81034274 ATATGTCAGAGTCTGTTTTAGGG - Intergenic
1055955561 9:81770145-81770167 ATGTACCAGGTACTGTGCTAAGG + Intergenic
1056466047 9:86856169-86856191 ATATGCCGGGCTCTATACTAAGG + Intergenic
1056678320 9:88695536-88695558 GTCCGCCAGGGTCTTTGCTAAGG + Intergenic
1057829751 9:98397372-98397394 ACGTGCCAGGCTCTGGGCTAGGG + Intronic
1058422659 9:104847415-104847437 ATGTGCCAGGCACTGTGCGAGGG - Intronic
1058586395 9:106511022-106511044 ATATGCCAGGTACTATTCTAGGG - Intergenic
1058626071 9:106934084-106934106 ATATACCAGGCACTGTACTAAGG + Intronic
1058787797 9:108407344-108407366 ATGTGCCAGGGACTCTGCTAAGG + Intergenic
1059019676 9:110561644-110561666 ATATACCAGGCACTGTACTAGGG + Intronic
1059306987 9:113361505-113361527 ATATGGAAGGATATGTGCTATGG + Intronic
1059463407 9:114449854-114449876 ATGTGCCAGGCACTGGGCTAGGG + Intronic
1059581974 9:115559488-115559510 ATAAGCCTGGGTGTGTGGTAGGG + Intergenic
1059826341 9:118033447-118033469 ATATTCCAGGCTCTGAGCTAGGG - Intergenic
1059854102 9:118376292-118376314 ATTTGCCAGGCACTGTGCCAAGG - Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060038505 9:120279956-120279978 ATATCCCAGGAGCTGTACTAGGG - Intergenic
1060139711 9:121199982-121200004 ATATGCCAAGCAATGTGCTAAGG + Intronic
1060161984 9:121372263-121372285 ATGTGGCAGGGAGTGTGCTAAGG + Intergenic
1060290052 9:122293727-122293749 ATGTGCCAGGCTCTGTGCTGGGG + Intronic
1060433157 9:123568384-123568406 GTGTGCCAGGCACTGTGCTAGGG - Intronic
1060474990 9:123980013-123980035 ATGTGCCAGGCCCTGAGCTAGGG - Intergenic
1060521625 9:124297322-124297344 ATGTGCCAGGCTCTGTGCTAAGG + Intronic
1060587271 9:124794466-124794488 ACGTGCCAGGCGCTGTGCTAGGG - Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1060824611 9:126680817-126680839 ATGTGCCAGGCACTGTGCGAAGG - Intronic
1060887753 9:127167541-127167563 AAATGCCAGGGACTGTGCTAAGG - Intronic
1060889764 9:127180576-127180598 GTATGCCAGGGGCTGGACTAAGG - Intronic
1060925522 9:127452602-127452624 ATGTGCCAGGTACTGTACTAGGG + Intronic
1060937766 9:127525685-127525707 ACATACCAGGCCCTGTGCTAAGG + Intronic
1060989812 9:127842000-127842022 ATGTGCTAGAGACTGTGCTAGGG - Intronic
1061527382 9:131177890-131177912 ATGTGCCAGGCTCTGTGTTAGGG - Intronic
1061621186 9:131812354-131812376 CTGTGCCAGGATCTGTGCCAAGG - Intergenic
1203622374 Un_KI270749v1:136280-136302 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1186152106 X:6686401-6686423 ATATGCCAGGAAATGTGTTACGG + Intergenic
1187238738 X:17493523-17493545 ATATGCCAGGCACTGTGCTGGGG - Intronic
1187963601 X:24589023-24589045 ATGTGCCCGGCACTGTGCTAAGG - Intronic
1187981907 X:24766359-24766381 ATGTGTCAAGGTCTATGCTAGGG - Intronic
1188512785 X:30954640-30954662 ATTTGCCAGACACTGTGCTAAGG - Intronic
1188521702 X:31045077-31045099 ATATACCAGAGACTGTGCTGGGG - Intergenic
1189818264 X:44845636-44845658 ATGTGCCAGGTACTATGCTAAGG - Intergenic
1191817354 X:65260962-65260984 ATATAACAGGCACTGTGCTATGG - Intergenic
1193095688 X:77546281-77546303 TTATGCCAGGAACTGTGCTAAGG - Intronic
1193855622 X:86598510-86598532 ATATTCCAGTGTCTTTGCAAGGG + Intronic
1194745849 X:97627605-97627627 ATTTGCTAGGCACTGTGCTAGGG + Intergenic
1195336002 X:103854952-103854974 ATATGCCAGGCACTCTGTTAGGG - Intergenic
1195372447 X:104191346-104191368 CTTTGCCAAGGTCTGTGATATGG + Exonic
1196013814 X:110916272-110916294 CTATGCCAGGCACTGTGCTATGG + Intergenic
1196038843 X:111178545-111178567 ATGTGCCATGTACTGTGCTAAGG - Intronic
1196062473 X:111425820-111425842 ATGTGCCAGACTCTGTGCAAGGG + Intergenic
1196650624 X:118164995-118165017 ATTTGCCAGGCACTCTGCTAAGG - Intergenic
1196692530 X:118576171-118576193 ATGTGGCAGGGCATGTGCTAGGG - Intronic
1198254127 X:134910457-134910479 ATATACAAGGCACTGTGCTAGGG + Intronic
1198282053 X:135151976-135151998 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198284354 X:135174963-135174985 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198288906 X:135220546-135220568 ATATGCCAAGCACTGGGCTAAGG + Intergenic
1199296443 X:146164271-146164293 CTGTGCCAGGTTCTGTGCTAAGG - Intergenic
1200181154 X:154151453-154151475 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200186799 X:154188567-154188589 GCGTGCCAGGCTCTGTGCTAAGG + Intergenic
1200192450 X:154225705-154225727 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200198205 X:154263509-154263531 GCGTGCCAGGCTCTGTGCTAAGG + Intronic
1200760359 Y:7032530-7032552 AAATGACACTGTCTGTGCTAGGG - Intronic
1201190384 Y:11438780-11438802 ATAGGACCAGGTCTGTGCTAGGG - Intergenic
1202583225 Y:26403107-26403129 ATAGGACCAGGTCTGTGCTAGGG + Intergenic