ID: 1097900709

View in Genome Browser
Species Human (GRCh38)
Location 12:64871266-64871288
Sequence ACTTGCCATCAGCAAGGCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097900709_1097900713 21 Left 1097900709 12:64871266-64871288 CCTGTGCCTTGCTGATGGCAAGT 0: 1
1: 0
2: 2
3: 26
4: 185
Right 1097900713 12:64871310-64871332 GAACACAATTATAATGCAATTGG 0: 1
1: 0
2: 6
3: 43
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097900709 Original CRISPR ACTTGCCATCAGCAAGGCAC AGG (reversed) Intronic
900905888 1:5557227-5557249 ACTTGCCATTGGCCAGGCATTGG + Intergenic
902515638 1:16988056-16988078 ACCTGCCAGCTCCAAGGCACAGG + Intronic
902660226 1:17895765-17895787 CCTTGCCCACAGCAAGGCAGGGG + Intergenic
902858497 1:19227083-19227105 ACTTACCATATGCTAGGCACTGG + Intronic
905389615 1:37628008-37628030 ACTTGGCATCAGAAAGGGCCTGG - Intronic
905881419 1:41466627-41466649 ACTTGGGGTCAGCAGGGCACTGG + Intergenic
908108880 1:60875051-60875073 ACTTGCCAAAGGCTAGGCACTGG - Intronic
908488147 1:64615547-64615569 ACGTGCTATGGGCAAGGCACTGG - Intronic
908747896 1:67393690-67393712 ACTTGCCATGTCCAAGGCAAGGG + Intronic
909924652 1:81425506-81425528 ACTTGCCATGAGCCAGGCATAGG - Intronic
910213202 1:84815045-84815067 ACTTACTATAAGCGAGGCACTGG + Intronic
911665704 1:100549026-100549048 ACTTGGCAAAAGCAAGTCACAGG + Intergenic
912471774 1:109911385-109911407 ACCCGCCACCACCAAGGCACGGG + Intronic
914785943 1:150830966-150830988 ACCTGCCATATGCCAGGCACTGG + Intronic
917384898 1:174461710-174461732 AGTTGGTAACAGCAAGGCACTGG - Intronic
918131787 1:181636015-181636037 ACTTGCCATGAGCAAGGAGTTGG - Intronic
919328949 1:196144533-196144555 ACTAGCCAACAGAAAGGCTCTGG + Intergenic
921405287 1:214772373-214772395 TCTTGAAATGAGCAAGGCACTGG - Intergenic
921487933 1:215737057-215737079 TCTTGCCATCATCAGGGTACTGG + Intronic
921966772 1:221098792-221098814 ATCTGCCATAGGCAAGGCACTGG + Intergenic
922041119 1:221899477-221899499 ACTGTCCATCAGGAAGGCACTGG + Intergenic
922580040 1:226690276-226690298 ACATACCATCAGCCAGGCACCGG + Intronic
923509707 1:234639745-234639767 GCTTGCTATCAGCCAGGTACAGG - Intergenic
1063188142 10:3668679-3668701 ACTTGCGTTCAGCAAGCCTCCGG - Intergenic
1065347500 10:24763041-24763063 AGTGGCCATCAGCAAGGCACAGG - Intergenic
1067291598 10:44947595-44947617 ACATGCCATCAGCAAGGTATGGG - Intergenic
1069310921 10:67035139-67035161 ACTTGGTATCAGCAAGGAATAGG - Intronic
1069823752 10:71242850-71242872 CCCTGCCAGCAGCAGGGCACTGG + Intronic
1070680960 10:78448670-78448692 ACTTGCCATCAGCCTGGCCCAGG - Intergenic
1071706336 10:88003497-88003519 ACTTACCACAAGCCAGGCACAGG + Intergenic
1074660010 10:115643853-115643875 TATTCCCAACAGCAAGGCACAGG - Intronic
1075900617 10:126040296-126040318 TCTTCCCATCAGCAAGGATCAGG + Intronic
1077509237 11:2947386-2947408 ACTCCCCTCCAGCAAGGCACTGG - Intronic
1084403964 11:68960467-68960489 TCTAACCACCAGCAAGGCACAGG - Intergenic
1085345274 11:75764562-75764584 ACTTGCCCTAAGAGAGGCACAGG - Intronic
1086071194 11:82801592-82801614 ACTTGTCATCATAAAAGCACAGG - Intergenic
1086336581 11:85807088-85807110 ACTTGCCCTAAGCAAGGCAGAGG - Intronic
1088608455 11:111554035-111554057 ACTGGCCAGCACCAAGGCAGAGG - Intronic
1089891970 11:121890500-121890522 AGTTGGCAGCACCAAGGCACAGG + Intergenic
1090072589 11:123556931-123556953 ACATGCCATTAGGAAGGCATGGG - Intronic
1090966787 11:131605565-131605587 ACTTGCATTCAGCATAGCACTGG - Intronic
1092985257 12:13838836-13838858 GCTTTGCATCAGCAGGGCACTGG - Intronic
1093548670 12:20379577-20379599 ACTTACAATAAGCAAGACACTGG - Intronic
1096345552 12:50843032-50843054 ACTCGCCCTCTGGAAGGCACAGG + Exonic
1096591046 12:52659461-52659483 ACTTGCCATCCGCATAGTACAGG + Intergenic
1097900709 12:64871266-64871288 ACTTGCCATCAGCAAGGCACAGG - Intronic
1098267327 12:68735871-68735893 AAGTGCCATAAGAAAGGCACAGG + Intronic
1099111038 12:78561309-78561331 ACTTGCTATCAGCATAGCACTGG + Intergenic
1099299192 12:80870050-80870072 ACTTGCCAGTTGCAAGGCTCTGG + Intronic
1099341573 12:81443148-81443170 ACTTGCCATATGCTAAGCACTGG + Intronic
1101595232 12:106158807-106158829 ACTTGCCCTCAGCAATGCAATGG - Intergenic
1102019716 12:109673841-109673863 ACTTGCCAGCAGCATGACCCTGG + Intergenic
1102425867 12:112843987-112844009 TCTTCCCAACAGCATGGCACAGG + Intronic
1102562450 12:113771907-113771929 ACCTGCCATCTGCATGGCTCAGG + Intergenic
1103133844 12:118490834-118490856 ACATGCCCTCTGCAAGGCACTGG - Intergenic
1103215580 12:119199131-119199153 ACCTACCATGTGCAAGGCACTGG + Intronic
1103367627 12:120394716-120394738 ACCTGCCATCTGAAGGGCACGGG - Intergenic
1103834113 12:123805387-123805409 ACTTGAAATCAGCAAGGAATAGG - Intronic
1105622196 13:22079163-22079185 GCTTGGCATCTGCAGGGCACTGG - Intergenic
1105824576 13:24110624-24110646 ACTTGCCATGGGCCAGACACTGG + Intronic
1107723345 13:43272930-43272952 GCTGGCAATTAGCAAGGCACTGG - Intronic
1108514415 13:51186023-51186045 ACTTGCCATCAGAAATATACTGG - Intergenic
1117191522 14:53297092-53297114 ACTTCTCATATGCAAGGCACAGG + Intergenic
1118909568 14:70049965-70049987 AGTTGCCGTTGGCAAGGCACAGG - Intronic
1121074582 14:91057306-91057328 ACCTAACATCTGCAAGGCACTGG + Intronic
1121571077 14:94946939-94946961 ACTTGCCCTCAGTAAGGGAGTGG - Intergenic
1121838320 14:97111966-97111988 ACTTGCCATCATCAGGACAGAGG - Intergenic
1121862638 14:97332968-97332990 ATGTGCCAACAGAAAGGCACTGG - Intergenic
1122124879 14:99573542-99573564 GCCTGCCATCAGCAGGGCTCTGG - Intronic
1122479807 14:102039687-102039709 TCTTGCCAGCAGCATGGCAAAGG - Exonic
1123688736 15:22819400-22819422 CCTTGCCCTCAGTAAGTCACAGG - Intronic
1123696244 15:22881032-22881054 AGTAGCCATCAGCACGGCCCTGG - Intronic
1123925625 15:25107458-25107480 ACTTCCGTTCTGCAAGGCACAGG - Intergenic
1126216351 15:46158561-46158583 ACCTGAAATCAGTAAGGCACTGG - Intergenic
1128251147 15:66165193-66165215 ACTTGGCATCTGGCAGGCACGGG + Intronic
1128757904 15:70195845-70195867 GCCTGCCATCAGCAAGGCCCTGG - Intergenic
1129121213 15:73397879-73397901 ACTTACCATGGGCCAGGCACTGG + Intergenic
1129642499 15:77394327-77394349 ACCTGCGGTCAGCATGGCACCGG - Intronic
1129697948 15:77751296-77751318 ACTTACCATGTGCCAGGCACAGG - Intronic
1129897456 15:79118967-79118989 GCTTGCCTTTAGCAAGACACAGG - Intergenic
1130152199 15:81319685-81319707 ACGTGACCTCAGCATGGCACTGG - Intronic
1132422530 15:101684606-101684628 ACATGCCATCATTATGGCACTGG + Intronic
1135349500 16:21716617-21716639 ACTTGCTATCTGCAAGGTATTGG - Intronic
1138209373 16:55150429-55150451 TCATGCCATCAGCAAGGCTGTGG - Intergenic
1141005426 16:80347696-80347718 ACCTGCCTTTACCAAGGCACAGG + Intergenic
1141157355 16:81606622-81606644 ACTTGCCATGAGCCAGGCACTGG + Intronic
1141504093 16:84463281-84463303 ATTTGCAAGCAGCAGGGCACTGG + Intronic
1141712679 16:85709011-85709033 ACTTGCCATGTGCTAGTCACGGG - Intronic
1144723065 17:17485623-17485645 ACTTGCTGTCAGCAGGGGACGGG - Intronic
1146002074 17:29137010-29137032 ACTTACTATGAGCCAGGCACAGG + Intronic
1146128523 17:30249482-30249504 ACTCACCATCACCAAGGCAGCGG - Intronic
1146407977 17:32556108-32556130 ACCTGCCATGTGCAAGGCCCTGG - Intronic
1146685806 17:34840987-34841009 ACTTGCCACCTGCAGGGGACTGG - Intergenic
1148490779 17:48023079-48023101 GTTTGCCATGAGCCAGGCACTGG - Intergenic
1150582473 17:66487281-66487303 ACATGACATAAGCCAGGCACAGG - Intronic
1151870639 17:76834191-76834213 AGCTGCCAGCAGCAAGGCTCAGG - Intergenic
1155240156 18:23857025-23857047 ACTTGCCAAGTGCCAGGCACTGG + Intronic
1155556158 18:27021326-27021348 ACTTGACAACAACAAGTCACAGG + Intronic
1156191223 18:34723245-34723267 ACTTGCCATAAGCAAAGCATCGG + Intronic
1156268251 18:35507889-35507911 AGTAGCCATCTGCAAGGCAAGGG + Intergenic
1157518708 18:48329942-48329964 ACTTGCGGACAGCAAGGCTCAGG + Intronic
1158585999 18:58735635-58735657 ATTTGCCAGTACCAAGGCACTGG - Intronic
1158937500 18:62377929-62377951 ACTAGCCACCAGCAAGGGAGAGG + Intronic
1160932478 19:1577232-1577254 ACCTGCCCTCGCCAAGGCACTGG + Exonic
1161424708 19:4196839-4196861 ACCTGCCATGGGCCAGGCACTGG + Intronic
1161576883 19:5059286-5059308 ACTCGCCAGCAGCAGGGGACAGG + Intronic
1166048303 19:40242542-40242564 AGTGGCGGTCAGCAAGGCACGGG - Exonic
1166757555 19:45202758-45202780 ACCTGAAATCAGCACGGCACTGG + Intronic
925742593 2:7018968-7018990 ACTTGACAGCAGCAGGCCACCGG - Intronic
933654580 2:84877132-84877154 ACATGTCTTCAGCAGGGCACAGG + Intronic
933904517 2:86877115-86877137 CATTCCCATCAGCAATGCACAGG - Intergenic
935537081 2:104307572-104307594 ACTGGGCTTGAGCAAGGCACTGG - Intergenic
936367722 2:111875036-111875058 CATTCCCATCAGCAATGCACAGG + Intronic
936947427 2:117943105-117943127 CCTTGCCCTCAGCAAGCCACTGG + Intronic
939314797 2:140534075-140534097 ACTTGCCATGAGGAATGCAGCGG + Exonic
941862613 2:170299506-170299528 ACTTGCTATAAGCCAGGCACTGG + Intronic
944064482 2:195604329-195604351 TCTTACCCTAAGCAAGGCACAGG + Intronic
944466733 2:200009071-200009093 ACTTGCATTCAGCATTGCACTGG - Intergenic
945940831 2:215948313-215948335 ATATGCCATCAGCAGGGCATGGG + Intronic
948948918 2:241236408-241236430 ACTTCCCTTCACCAAGGCTCGGG - Intronic
1169134491 20:3189040-3189062 TCTTGCCATCTGCATGGCAGTGG + Intergenic
1171349078 20:24489001-24489023 ACTTGCCAAGACCAAGGGACAGG - Intronic
1172150791 20:32788982-32789004 ACTTGCCATCGCCAAACCACTGG - Exonic
1172768813 20:37365093-37365115 ACTTGCTAGGAGCCAGGCACAGG + Intronic
1174401588 20:50278750-50278772 ACTTACCATCTGCCAGGCACTGG - Intergenic
1175282506 20:57813478-57813500 ACTTTCCATAAGCCAGGCACTGG - Intergenic
1175838498 20:62011789-62011811 ACCTGCCATGAGCCAGGCAGTGG - Intronic
1177115939 21:17087423-17087445 ACCTGCTATAAACAAGGCACTGG - Intergenic
1180854903 22:19039515-19039537 ATTTGTCATCAGGGAGGCACTGG + Intronic
1181021789 22:20107402-20107424 ACTGGCCATCAGCAGGTCCCAGG + Intronic
1181734422 22:24870533-24870555 ACTGGCCTTCATCAAGCCACAGG - Intronic
1182338457 22:29601062-29601084 ACTTGCCAGGTGCTAGGCACTGG - Intergenic
1182837107 22:33351150-33351172 ACTTGCTATGAGCTAGACACTGG - Intronic
1183653122 22:39170350-39170372 GCTAGCCTTCAGCAAGCCACAGG + Intergenic
952346957 3:32497051-32497073 ACTTCTTATCAGCAAGCCACAGG + Intronic
952505981 3:34007242-34007264 ACATTCCAACAGCAAGGCAAGGG - Intergenic
952712546 3:36445960-36445982 CCTTTCCATCTTCAAGGCACAGG - Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
956551944 3:70470972-70470994 ACTTTCAATCAGCAAGGGGCTGG - Intergenic
958989185 3:100822007-100822029 CCTTGAAATCACCAAGGCACAGG - Intronic
960469760 3:118048156-118048178 TCTTGCCATCATCAGGGTACTGG + Intergenic
966324674 3:178740771-178740793 ACCTGCCATCTGTCAGGCACTGG + Intronic
967853711 3:194100887-194100909 GGTAGCCAGCAGCAAGGCACCGG + Intergenic
968710041 4:2107905-2107927 TCTTGCCATAAGCCAGGCACTGG + Intronic
968960717 4:3742077-3742099 ACTGGCCATCAGCAAGGGATAGG - Intergenic
969330177 4:6470358-6470380 ACCAGCCCTCAGCAGGGCACAGG - Intronic
970279658 4:14440554-14440576 ACTGGTCATCAACAAGGCTCTGG - Intergenic
972208567 4:36808545-36808567 TCTTGCTATCAGCAAGGGATCGG - Intergenic
975165231 4:71170931-71170953 ACATGGCATGAGCAAGGGACTGG + Intergenic
975577613 4:75878222-75878244 ACTTGCGGTCATCATGGCACTGG + Intronic
981002233 4:139839125-139839147 ACTTGCCATCAAGAACGCGCTGG + Intronic
985003193 4:185505775-185505797 CCTTCCCATCAGTAATGCACAGG + Intronic
989004607 5:36796513-36796535 ACTTGCCATTGGCATGACACAGG + Intergenic
991530969 5:67613696-67613718 ACTTGCTATCATCAATGCACGGG + Intergenic
992371747 5:76151035-76151057 ACTTGTCATCAGAATGACACAGG + Intronic
992396784 5:76375834-76375856 AGTGGCCTTCAGCAAGTCACTGG + Intergenic
993027224 5:82660951-82660973 ACTTGCTATTTGAAAGGCACTGG - Intergenic
993547956 5:89236258-89236280 AATTTCTATCAGTAAGGCACTGG + Intergenic
997813882 5:136997673-136997695 AATTGGCATTAGCAAGGCAGTGG - Intronic
998628065 5:143868197-143868219 CCTTGCCATCAGAAAGGGAGAGG - Intergenic
999572511 5:152936740-152936762 ACTTGCCAAGAGCAAACCACAGG + Intergenic
999627102 5:153532432-153532454 ACTTGCCATTTGCTAGGTACTGG - Intronic
999828589 5:155297912-155297934 ACTGGCAATCAGCAGGACACAGG + Intergenic
1003270315 6:4602391-4602413 CTTTTCCATCAGCAAGGCACTGG + Intergenic
1006300004 6:33188976-33188998 ACTTGCCATCTGCTAGGCTGAGG + Exonic
1006848951 6:37083522-37083544 ACTTGAGAACAGCAGGGCACAGG + Intergenic
1007025696 6:38570725-38570747 AGTTGTCATCTGCAAGGCATAGG - Intronic
1007819007 6:44546409-44546431 GCTCTCCTTCAGCAAGGCACAGG - Intergenic
1010975759 6:82312105-82312127 ACGTGAAATCAGCAAGGTACTGG + Intergenic
1013174055 6:107662413-107662435 ACATACCATGTGCAAGGCACAGG - Intergenic
1015630712 6:135229278-135229300 ACTTACTATGAGCTAGGCACTGG - Intergenic
1019058375 6:169238909-169238931 CCTTGCCAACGGCACGGCACTGG + Intronic
1020918670 7:14233175-14233197 ACTTGCCTTAAGCTATGCACAGG + Intronic
1022505445 7:30906457-30906479 AGTTGCCATCAGCCAGGCTGGGG - Intergenic
1023987924 7:45108478-45108500 CCTTGCCATCAGCCAGACACTGG + Intronic
1024926008 7:54616778-54616800 ATTTGCCATCTGCCAAGCACAGG - Intergenic
1025987148 7:66463758-66463780 ACCAGTCATCAGAAAGGCACGGG - Intergenic
1026252475 7:68682961-68682983 ATTGGCCATCAGCAAAACACAGG - Intergenic
1027170168 7:75866346-75866368 ACTTGCCTTCAGCAGGGCATGGG - Intronic
1028440445 7:90853706-90853728 ACATGCCAACCACAAGGCACTGG - Intronic
1039484482 8:37899980-37900002 ACTCACCATGAGCCAGGCACTGG - Intergenic
1040866832 8:52055917-52055939 AAGTGTGATCAGCAAGGCACTGG - Intergenic
1041369913 8:57148435-57148457 ATTTGCCATCAGCCAGGGACTGG - Intergenic
1041473532 8:58237364-58237386 ACTTGCCCTTGGCCAGGCACTGG - Intergenic
1045726945 8:105185536-105185558 AGTTGCCATCAGAAGTGCACAGG - Intronic
1046749402 8:117911146-117911168 ACTTGCCGTGTGCCAGGCACTGG - Intronic
1047644894 8:126860012-126860034 AATTCCCATCAGCCATGCACGGG - Intergenic
1048971104 8:139645382-139645404 ACCTGCCCTCAGCATGGCCCAGG + Intronic
1049543098 8:143217443-143217465 ACTTGCTCTCTGCCAGGCACGGG - Intergenic
1050149489 9:2605145-2605167 AGTTGCCATCTACAAGGAACAGG + Intergenic
1050788802 9:9439891-9439913 ACTTCCCAGCTGCAAGACACTGG - Intronic
1051385066 9:16499019-16499041 ACCTGCCATAAGAAAAGCACAGG + Intronic
1051490323 9:17656445-17656467 ACTTGCAATCTACAAAGCACTGG - Intronic
1051835835 9:21336564-21336586 ACTGCCCATCAACAGGGCACTGG - Intergenic
1052204837 9:25827265-25827287 ACTTGCCATCCTGAAGGCAAGGG - Intergenic
1052461939 9:28775995-28776017 GCTTGCCATGAGCCAGGGACTGG - Intergenic
1052692669 9:31835053-31835075 TCTTGGCATCAGCAAAGAACAGG - Intergenic
1056513244 9:87326175-87326197 CATTTCCATCAGCAATGCACAGG - Intergenic
1057277520 9:93683931-93683953 CCTTGCCGTCAGCAAGGCAGAGG - Intergenic
1057556925 9:96095436-96095458 CCCTGCCATCAGCAAGGCCCTGG + Intergenic
1059446994 9:114344361-114344383 GCTTTCCATCTGCCAGGCACTGG - Intronic
1060965293 9:127709126-127709148 ACCTGCTATCTGCCAGGCACAGG + Intronic
1061807040 9:133142421-133142443 ACTTGCCTGCAGGAAGGCTCCGG - Intronic
1187172508 X:16865809-16865831 AGTATCCATCAGCAAGGAACTGG + Intronic
1188318453 X:28706018-28706040 TATTGCTACCAGCAAGGCACAGG + Intronic
1188642700 X:32525752-32525774 AAATGCCATCTGCAAAGCACTGG - Intronic
1189498466 X:41530915-41530937 AAATGCCATCAGAAAGTCACAGG - Intronic
1194817161 X:98456850-98456872 ACTTGCCATCAAGTAGGCATAGG + Intergenic
1195641493 X:107180396-107180418 AATGGCCATCAGCAAGGGACTGG + Intronic
1197422902 X:126259913-126259935 TACTGCTATCAGCAAGGCACTGG - Intergenic
1198642065 X:138767200-138767222 TCTTGGCCTCAGCAAGGCACTGG + Intronic
1198937361 X:141912312-141912334 AGTGGTCATCAGCAAGCCACGGG - Intergenic
1198961691 X:142190553-142190575 AGTGGTCATCAGCAAGCCACGGG + Intergenic
1200052346 X:153441122-153441144 CCTTCCCACCAGAAAGGCACGGG + Intergenic