ID: 1097901596

View in Genome Browser
Species Human (GRCh38)
Location 12:64878815-64878837
Sequence ACCAGCGAGTCTGCAAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 72}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097901596 Original CRISPR ACCAGCGAGTCTGCAAATGC TGG (reversed) Intronic
904496094 1:30887563-30887585 CCCAGCTAGTCTGCAAAACCAGG + Intronic
905371764 1:37486279-37486301 ACCAGTAAGTATGCAAATTCTGG + Intergenic
924385819 1:243497223-243497245 ACCAAAGAGTCAGCAAATGGAGG + Intronic
1065639507 10:27767509-27767531 ACCAGAAAGTCTGCTAATTCTGG + Intergenic
1067499440 10:46788776-46788798 ACCAACCAGTGTGCAGATGCTGG - Intergenic
1067642296 10:48059629-48059651 ACCAACCAGTGTGCAGATGCTGG + Intergenic
1070139497 10:73728182-73728204 ACCAACCAGTGTGCAGATGCTGG + Intergenic
1070886777 10:79906955-79906977 ACCAACCAGTGTGCAGATGCTGG - Intergenic
1071606186 10:86992644-86992666 ACCAACCAGTGTGCAGATGCTGG - Intergenic
1071614693 10:87064800-87064822 AACAGTGAGAATGCAAATGCTGG + Intronic
1071727137 10:88210526-88210548 CCCAGCCAGTTTGCAAATACTGG - Intergenic
1073456156 10:103637921-103637943 ACCAGAGAAGCTGGAAATGCAGG + Intronic
1080562300 11:33475069-33475091 AGCAGCGAGTGTGCAAAAGAGGG + Intergenic
1080637763 11:34138739-34138761 GGCAGCCAGTCTGCAAGTGCAGG - Intronic
1088934867 11:114389731-114389753 ACCAGCTGGTCTCCAACTGCTGG + Intergenic
1095686048 12:45035067-45035089 ACAAGTGAGGCAGCAAATGCTGG - Intronic
1097901596 12:64878815-64878837 ACCAGCGAGTCTGCAAATGCTGG - Intronic
1099730607 12:86495503-86495525 ACCAGCCAGTCTTCAAATACAGG - Intronic
1108493078 13:51000374-51000396 ATCAGGGAGACTGCAAATGGTGG + Intergenic
1115309149 14:31962001-31962023 ATAAGCGAGTCTGCAACAGCTGG - Intergenic
1118319899 14:64746974-64746996 ACCAACTAGACTGAAAATGCAGG - Exonic
1121711316 14:96040616-96040638 GACAGCGAGTCTGCAAATGGAGG + Intronic
1123978570 15:25577241-25577263 ACCAGGGAAACGGCAAATGCAGG - Intergenic
1127285091 15:57525547-57525569 AGCAGCGAGTCTGTACATCCCGG + Intronic
1128757651 15:70194397-70194419 ACCAGCATGTCTCCAACTGCAGG - Intergenic
1129220605 15:74129692-74129714 AACAGCGAGTCTGCCGAAGCCGG + Exonic
1130871855 15:87978102-87978124 ACCAATGAGTCAGCAAATACGGG + Intronic
1131656998 15:94471368-94471390 AGCTGAGAGCCTGCAAATGCTGG + Intronic
1134384074 16:13755731-13755753 AACAGCAAGTCTGGTAATGCAGG - Intergenic
1137352608 16:47726776-47726798 ACCAGCCAGACTGCAAAGCCAGG - Intergenic
1144673470 17:17146161-17146183 CCCAGCCAGTCTGCAAGTGCTGG + Intronic
1150435793 17:65153200-65153222 ATCTGCGAGTCTTCACATGCAGG + Intronic
1154219032 18:12436015-12436037 ACCAGCGAGTCGGCAATGGGAGG - Intergenic
1160011550 18:75110233-75110255 ACCAGTGAGCCAGCAGATGCTGG + Intergenic
1165130383 19:33628390-33628412 ACCAGCGAGGCTGGAGCTGCAGG + Intronic
1166040090 19:40197074-40197096 TCCAGCTGGTCCGCAAATGCAGG - Intronic
925129822 2:1486915-1486937 ACCTGGGTGTCTTCAAATGCCGG - Intronic
927865135 2:26583275-26583297 CCCATCGAGACTGGAAATGCTGG + Intronic
933349470 2:81136003-81136025 ACCAGGGAATCTGGAAATCCAGG + Intergenic
934755899 2:96824679-96824701 ATCAGCCAGCCTGCACATGCAGG - Intronic
937039330 2:118808726-118808748 ACCAGCGAGCCTCCAGATTCTGG + Intergenic
941883506 2:170505061-170505083 ACCAGCCAGTAATCAAATGCTGG + Intronic
948870115 2:240793481-240793503 CCCAGCCATTCTGCAGATGCTGG - Intronic
1176512191 21:7757173-7757195 ACCAGCGAGTGGGCAGCTGCCGG - Intronic
1178646303 21:34387697-34387719 ACCAGCGAGTGGGCAGCTGCCGG - Intronic
1180946344 22:19695861-19695883 AGCAGCGAGTCTCCAACGGCCGG - Intergenic
952736989 3:36700693-36700715 ACCAGCTAGCCTGCAAGTGTGGG + Intergenic
954800040 3:53181709-53181731 ACAAGCAAGGCTACAAATGCAGG + Exonic
959390735 3:105770336-105770358 ACCAGGGAATCTGAAAATCCAGG + Intronic
962236986 3:133715106-133715128 ACCAGCCAGGCTGGAAGTGCAGG - Intergenic
969883260 4:10193398-10193420 GTTAGAGAGTCTGCAAATGCTGG + Intergenic
970418258 4:15880661-15880683 ATAAACGAGTCTCCAAATGCAGG - Intergenic
972629367 4:40829912-40829934 TCCAGGGTTTCTGCAAATGCAGG - Intronic
981423315 4:144576465-144576487 AACAGCGACACTGAAAATGCTGG + Intergenic
984563258 4:181296256-181296278 ACCTGCGGAGCTGCAAATGCAGG - Intergenic
985951554 5:3225364-3225386 ACCAGGACGTCTGTAAATGCAGG + Intergenic
989818622 5:45766221-45766243 ACCAGGGAATCTGAAAATCCAGG - Intergenic
995043480 5:107617275-107617297 ACCACAGAGTCTCCAAATACAGG + Intronic
1012031391 6:94070396-94070418 ACCAGTGATTCTGCAAATGCAGG + Intergenic
1022821018 7:33961103-33961125 ACCTGCGATTTTGCACATGCTGG - Intronic
1023713801 7:43022495-43022517 ACCAGCTAGCTTGCCAATGCAGG + Intergenic
1024246656 7:47475870-47475892 GCCTCCAAGTCTGCAAATGCGGG + Intronic
1024969168 7:55052996-55053018 AGCAGGGAGTCTCCCAATGCTGG - Intronic
1027230831 7:76271257-76271279 ACCAGTCAGTCTGGAACTGCAGG - Intronic
1031822027 7:126514165-126514187 CCCAGCAAGTCCGCAGATGCTGG + Intronic
1033264815 7:139875872-139875894 CCCAGCAAGGCTGCAAAGGCTGG - Intronic
1035392190 7:158511814-158511836 AGCAGCCAGTCTGAAAATCCTGG + Intronic
1039467493 8:37795164-37795186 ACCAGAGAGCCTGCAACTGGGGG + Intronic
1048441407 8:134462189-134462211 ATCAGCCAGTCTGCACAAGCTGG - Intergenic
1049850330 8:144827198-144827220 GCCAGCGAGTCCGCAACTCCCGG + Intergenic
1054503179 9:65888205-65888227 ACAAGCGAGTCTTTAAAAGCTGG - Intronic
1062195030 9:135268284-135268306 TCCAGTGAGGCTGCAACTGCTGG + Intergenic
1186528235 X:10269209-10269231 ACCAGTGAATCTGCAGATCCAGG - Intergenic
1189096162 X:38142666-38142688 ACCAGAGAGTGTGGAAATGGAGG - Intronic
1191848992 X:65571719-65571741 ACCAGAGAGTTTCAAAATGCTGG - Intergenic
1197494016 X:127154534-127154556 ACCAGGGAATCTGAAAATCCAGG - Intergenic
1201231494 Y:11868924-11868946 ACCAGCAAGTCTGCTAGTGTAGG - Intergenic