ID: 1097904696

View in Genome Browser
Species Human (GRCh38)
Location 12:64907682-64907704
Sequence CAGGCTTATTGGACCTAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097904696_1097904701 27 Left 1097904696 12:64907682-64907704 CCACCTTAGGTCCAATAAGCCTG No data
Right 1097904701 12:64907732-64907754 CTCTGAATTCTGTGTCAGAAAGG No data
1097904696_1097904700 4 Left 1097904696 12:64907682-64907704 CCACCTTAGGTCCAATAAGCCTG No data
Right 1097904700 12:64907709-64907731 GAATTTCATGTGTTCACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097904696 Original CRISPR CAGGCTTATTGGACCTAAGG TGG (reversed) Intergenic
No off target data available for this crispr