ID: 1097905883 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:64919330-64919352 |
Sequence | CTGCTGGTACAGTGGGTGCT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1097905875_1097905883 | 26 | Left | 1097905875 | 12:64919281-64919303 | CCATGGGCACACAGCGTAATGGC | No data | ||
Right | 1097905883 | 12:64919330-64919352 | CTGCTGGTACAGTGGGTGCTTGG | No data | ||||
1097905877_1097905883 | 4 | Left | 1097905877 | 12:64919303-64919325 | CCAGGACAATTCTGAATGATTCT | No data | ||
Right | 1097905883 | 12:64919330-64919352 | CTGCTGGTACAGTGGGTGCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1097905883 | Original CRISPR | CTGCTGGTACAGTGGGTGCT TGG | Intergenic | ||
No off target data available for this crispr |