ID: 1097905883

View in Genome Browser
Species Human (GRCh38)
Location 12:64919330-64919352
Sequence CTGCTGGTACAGTGGGTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097905875_1097905883 26 Left 1097905875 12:64919281-64919303 CCATGGGCACACAGCGTAATGGC No data
Right 1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG No data
1097905877_1097905883 4 Left 1097905877 12:64919303-64919325 CCAGGACAATTCTGAATGATTCT No data
Right 1097905883 12:64919330-64919352 CTGCTGGTACAGTGGGTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097905883 Original CRISPR CTGCTGGTACAGTGGGTGCT TGG Intergenic
No off target data available for this crispr