ID: 1097907137

View in Genome Browser
Species Human (GRCh38)
Location 12:64931932-64931954
Sequence GCTCTGACTCTCCTTCAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097907132_1097907137 16 Left 1097907132 12:64931893-64931915 CCAGGTGGGGGCAGGGTCAGACG No data
Right 1097907137 12:64931932-64931954 GCTCTGACTCTCCTTCAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097907137 Original CRISPR GCTCTGACTCTCCTTCAGAA GGG Intergenic
No off target data available for this crispr