ID: 1097910519

View in Genome Browser
Species Human (GRCh38)
Location 12:64965144-64965166
Sequence GCCTTGGATTTCCCCATACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097910516_1097910519 -10 Left 1097910516 12:64965131-64965153 CCAGACCCTAGTTGCCTTGGATT No data
Right 1097910519 12:64965144-64965166 GCCTTGGATTTCCCCATACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097910519 Original CRISPR GCCTTGGATTTCCCCATACC TGG Intergenic
No off target data available for this crispr