ID: 1097910900

View in Genome Browser
Species Human (GRCh38)
Location 12:64968070-64968092
Sequence CTGGCTGATCTGGTTTCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097910900_1097910906 16 Left 1097910900 12:64968070-64968092 CCACCAGAAACCAGATCAGCCAG No data
Right 1097910906 12:64968109-64968131 TTCTAGCCTCCAGAACTTTGAGG No data
1097910900_1097910903 -9 Left 1097910900 12:64968070-64968092 CCACCAGAAACCAGATCAGCCAG No data
Right 1097910903 12:64968084-64968106 ATCAGCCAGAACCTTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097910900 Original CRISPR CTGGCTGATCTGGTTTCTGG TGG (reversed) Intergenic
No off target data available for this crispr