ID: 1097913069 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 12:64991356-64991378 |
Sequence | TGAACTTGTTCTAGTTTTGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1097913064_1097913069 | 29 | Left | 1097913064 | 12:64991304-64991326 | CCATCTTCTGTTCATAAATGCTA | No data | ||
Right | 1097913069 | 12:64991356-64991378 | TGAACTTGTTCTAGTTTTGAGGG | No data | ||||
1097913066_1097913069 | 1 | Left | 1097913066 | 12:64991332-64991354 | CCACATTGCAGGCCAAAGTTTTT | No data | ||
Right | 1097913069 | 12:64991356-64991378 | TGAACTTGTTCTAGTTTTGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1097913069 | Original CRISPR | TGAACTTGTTCTAGTTTTGA GGG | Intergenic | ||