ID: 1097913069

View in Genome Browser
Species Human (GRCh38)
Location 12:64991356-64991378
Sequence TGAACTTGTTCTAGTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097913064_1097913069 29 Left 1097913064 12:64991304-64991326 CCATCTTCTGTTCATAAATGCTA No data
Right 1097913069 12:64991356-64991378 TGAACTTGTTCTAGTTTTGAGGG No data
1097913066_1097913069 1 Left 1097913066 12:64991332-64991354 CCACATTGCAGGCCAAAGTTTTT No data
Right 1097913069 12:64991356-64991378 TGAACTTGTTCTAGTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097913069 Original CRISPR TGAACTTGTTCTAGTTTTGA GGG Intergenic