ID: 1097918087

View in Genome Browser
Species Human (GRCh38)
Location 12:65040993-65041015
Sequence TCTGGGGCCCCAAAATATCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097918087_1097918091 27 Left 1097918087 12:65040993-65041015 CCATGATATTTTGGGGCCCCAGA No data
Right 1097918091 12:65041043-65041065 AACTGTATTTCTCCAAATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097918087 Original CRISPR TCTGGGGCCCCAAAATATCA TGG (reversed) Intergenic
No off target data available for this crispr