ID: 1097918149

View in Genome Browser
Species Human (GRCh38)
Location 12:65041720-65041742
Sequence GGTTACACAAAGTTTAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1097918147_1097918149 -10 Left 1097918147 12:65041707-65041729 CCTGGAGTATGGGGGTTACACAA No data
Right 1097918149 12:65041720-65041742 GGTTACACAAAGTTTAGGTTAGG No data
1097918146_1097918149 -9 Left 1097918146 12:65041706-65041728 CCCTGGAGTATGGGGGTTACACA No data
Right 1097918149 12:65041720-65041742 GGTTACACAAAGTTTAGGTTAGG No data
1097918145_1097918149 -8 Left 1097918145 12:65041705-65041727 CCCCTGGAGTATGGGGGTTACAC No data
Right 1097918149 12:65041720-65041742 GGTTACACAAAGTTTAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1097918149 Original CRISPR GGTTACACAAAGTTTAGGTT AGG Intergenic
No off target data available for this crispr